Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design and Pot Experiments
2.2. Leaf Traits
2.3. Pigment Content and Gas Exchange
2.4. Chlorophyll Fluorescence Measurements
2.5. Extraction of Pb in Subcellular Distribution
2.6. Leaf RNA Extraction and Transcriptome Sequencing
2.7. Quantitative Real-Time PCR (qRT-PCR) Validation
2.8. Statistical Analysis
3. Results
3.1. Leaf Functional Traits
3.2. Chlorophyll Pigments and Gas Exchange Parameters
3.3. Chlorophyll Fluorescence
3.4. Principal Component Analysis
3.5. Extraction of Pb in Subcellular Distribution
3.6. Concentration of Nutritional Elements in Chloroplasts and Cell Nuclei
3.7. Correlation Coefficients among Elemental Contents
3.8. KEGG Enrichment Analyses and the DEGs Related to Photosynthesis
4. Discussion
4.1. Sexual Differences in Leaf Morphology
4.2. Sexual Difference in Photosynthesis and Chlorophyll Pigments
4.3. Sexual Difference in PSII under Pb Stress
4.4. Sexual Difference in Subcellular Distribution of Nutritional Ions
4.5. Sexual Difference in Activity of Genes Involved in Photosynthetic Antenna Proteins and Photosynthesis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Gene ID | Gene Name | Sense Primer | Tm1 (°C) | Antisense Primer | Tm2 (°C) |
---|---|---|---|---|---|
Lc0063017 | PAL | ATGTTCTGCGAGGTGATGCT | 57.8 | GTTTGGGCTTGGTCAGTGGA | 60.5 |
Lc0064810 | HCT | CCTCTCCCTCCCTTAGACACC | 59.3 | CACAGGAGAAGCGGTTGAGT | 57.4 |
Lc0053527 | CYP707A1 | TATTGGGGTGTCCTTGTGTGA | 58.4 | TCGCTTTGTGGAAGAGGGTC | 59.9 |
Lc0027922 | COMT1 | CTCCCCACAGAAAACCCAGA | 59.6 | CAACACCTCCACCCACATCA | 59.2 |
Lc0036038 | CAT1 | GCACAGTTTGTTCGGGCT | 56.3 | TTGCTATGATGGTGGGGCTC | 60.6 |
Lc0008270 | trpB2 | GGCGTCCCAAAGTGAGAGAA | 59.9 | TACATCCAAACGGCACCCAG | 61.5 |
Lc0039444 | TUBB1 | CCATTCCCCCGTCTTCACTT | 61.1 | GCCATTTTCAACCCCTTCGG | 64 |
P:Fs | P:Fp | P:Fsxp | |
---|---|---|---|
LA | ** | ** | ** |
SLA | ** | ** | ** |
LDMC | ns | ns | ns |
Lth | ** | ** | ** |
Chl a | ** | ns | ** |
Chl b | ** | ** | ** |
Caro | ** | * | ** |
TChl | ** | * | ** |
Pn | ** | ns | ** |
Gs | ** | ** | ** |
Ci | ns | ns | ns |
Tr | ** | ** | ** |
Fv/Fm | ns | ns | ns |
Fv’/Fm’ | ** | ** | ns |
ETR | ns | ** | ns |
NPQ | * | ns | * |
qP | ns | ** | ns |
Y(II) | ns | ** | ns |
Y(NPQ) | ** | ** | ** |
Y(NO) | ns | ns | * |
F1 | ** | ** | ** |
F2 | ** | ** | ** |
F3 | ** | ** | ** |
F4 | ** | ** | ** |
Ca | ** | ** | ** |
Fe | ** | ** | ** |
K | ** | ** | ** |
Mg | ** | ** | ** |
Mn | ** | ** | ** |
Zn | ** | ** | ** |
Abbreviation | Gene Name |
---|---|
CAB7 | chlorophyll a-b binding protein 7 |
LHCA6 | photosystem I chlorophyll a/b-binding protein 6 |
LHCB4.2 | chlorophyll a-b binding protein CP29.1 |
CAB8 | chlorophyll a-b binding protein 8 |
LHCA1 | chlorophyll a-b binding protein 6 |
CAB13 | hypothetical protein B296_00038081 |
CAP10A | chlorophyll A-B binding protein |
CAB40 | chlorophyll a-b binding protein of LHCII type 1-like protein |
CAB215 | chlorophyll a-b binding protein |
PHYPADRAFT_124625 | chlorophyll a-b binding protein |
LHCSR1 | stress-related chlorophyll a b binding 2 |
psaD | PSI reaction center subunit II |
PSAL | photosystem I reaction center subunit XI |
PSAK | photosystem I reaction center subunit psaK |
PSAH | photosystem I reaction center subunit VI |
PSAN | photosystem I reaction center subunit N |
PSAF | hypothetical protein HHK36_000716 |
psaB | photosystem I P700 apoprotein A1 |
PSBS | photosystem II protein |
PSBY | photosystem II core complex proteins psbY |
PSBQ1 | oxygen-evolving enhancer protein 3-2, chloroplastic-like protein |
PSB27-1 | photosystem 2 family protein |
PNSL3 | photosystem II PsbQ |
PPL1 | psbP-like protein 1 |
PSB28 | photosystem II reaction center PSB28 protein |
psbB | photosystem II CP47 reaction center-like protein |
PSBP | oxygen-evolving enhancer protein 2 |
psbD | photosystem II protein D2 |
psbC | photosystem II 43 kDa protein |
psbA | photosystem II Q(b) protein D1 |
PETH | ferredoxin--NADP reductase, leaf isozyme |
PETE | plastocyanin, chloroplastic |
AP1 | ferredoxin |
Os07g0147900 | ferredoxin--NADP reductase |
SEND33 | ferredoxin-like protein |
FDC2 | 2Fe-2S ferredoxin-like superfamily protein |
ATPD | hypothetical protein HHK36_001355 |
ATPC | ATP synthase gamma chain 1 |
atpB | ATP synthase subunit beta |
petC | cytochrome b6-f complex iron-sulfur subunit 1 |
petC2 | cytochrome b6-f complex iron-sulfur subunit 2 |
petA | cytochrome f-like |
References
- Duan, D.C.; Tong, J.H.; Xu, Q.; Dai, L.Y.; Ye, J.E.; Wu, H.X.; Xu, C.; Shi, J.Y. Regulation mechanisms of humic acid on Pb stress in tea plant (Camellia sinensis L.). Environ. Pollut. 2020, 267, 5546. [Google Scholar] [CrossRef]
- Jin, Z.M.; Deng, S.Q.; Wen, Y.C.; Jin, Y.F.; Pan, L.; Zhang, Y.F.; Black, T.; Jones, K.C.; Zhang, H.; Zhang, D.Y. Application of Simplicillium chinense for Cd and Pb biosorption and enhancing heavy metal phytoremediation of soils. Sci. Total Environ. 2019, 697, 4178. [Google Scholar] [CrossRef]
- Meng, L.D.; Yang, Y.P.; Ma, Z.W.; Jiang, J.W.; Zhang, X.M.; Chen, Z.R.; Cui, X.J.; Yin, X.J. Integrated physiological, transcriptomic and metabolomic analysis of the response of Trifolium pratense L. to Pb toxicity. J. Hazard. Mater. 2022, 436, 129128. [Google Scholar] [CrossRef]
- Bamagoos, A.A.; Alharby, H.F.; Abbas, G. Differential uptake and translocation of cadmium and lead by quinoa: A multivariate comparison of physiological and oxidative stress responses. Toxics 2022, 10, 68. [Google Scholar] [CrossRef]
- Oorts, K.; Smolders, E.; Lanno, R.; Chowdhury, M.J. Bioavailability and ecotoxicity of lead in soil: Implications for setting ecological soil quality standards. Environ. Toxicol. Chem. 2021, 40, 1948–1961. [Google Scholar] [CrossRef]
- Chen, L.H.; Hu, X.W.; Yang, W.Q.; Xu, Z.F.; Zhang, D.J.; Gao, S. The effects of arbuscular mycorrhizal fungi on sex-specific responses to Pb pollution in Populus cathayana. Ecotoxicol. Environ. Saf. 2015, 113, 460–468. [Google Scholar] [CrossRef]
- Pulford, I.D.; Watson, C. Phytoremediation of heavy metalcontaminated land by trees—A review. Environ. Int. 2003, 29, 529–540. [Google Scholar] [CrossRef]
- Huang, X.H.; Zhu, F.; He, Z.X.; Chen, X.Y.; Wang, G.J.; Liu, M.S.; Xu, H.Y. Photosynthesis performance and antioxidative enzymes response of Melia azedarach and Ligustrum lucidum plants under Pb–Zn mine tailing conditions. Front. Plant Sci. 2020, 11, 1157. [Google Scholar] [CrossRef]
- Mishra, S.; Tripathi, R.D.; Srivastava, S.; Dwivedi, S.; Trivedi, P.K.; Dhankher, O.P.; Khare, A. Thliol metabolism play significant role during cadmium detoxification by Ceratophyllum demersum L. Bioresour. Technol. 2009, 99, 2155–2161. [Google Scholar] [CrossRef]
- Gupta, D.K.; Huang, H.G.; Yang, X.E.; Razafindrabe, B.H.N.; Inouhe, M. The detoxification of lead in Sedum alfredii H. is not related to phytochelatins but the glutathione. J. Hazard. Mater. 2010, 177, 437–444. [Google Scholar] [CrossRef]
- Huang, X.H.; Zhu, F.; Yan, W.D.; Chen, X.Y.; Wang, G.J.; Wang, R.J. Effects of Pb and Zn toxicity on chlorophyll fluorescence and biomass production of Koelreuteria paniculata and Zelkova schneideriana young plants. Photosynthetica 2019, 57, 688–697. [Google Scholar] [CrossRef] [Green Version]
- Fontenele, N.B.; Oliveira Otoch, M.D.L.; Gomes-Rochette, N.F.; Cecilia, M.S.A.; Annderson, G.C.B.A.; Dalton, B.D.O.F.; Costa, J.H.; Borges, S.D.S.S.; Ferreira, D.N.R.; Fernandes, D.M.D. Effect of lead on physiological and antioxidant responses in two Vigna unguiculata cultivars differing in Pb-accumulation. Chemosphere 2017, 176, 397–404. [Google Scholar] [CrossRef]
- Li, T.; Liu, Y.J.; Shi, L.; Jiang, C.D. Systemic regulation of photosynthetic function in field-grown sorghum. Plant Physiol. Biochem. 2015, 94, 86–94. [Google Scholar] [CrossRef]
- Xu, Z.F.; Chen, L.H.; Tang, S.S.; Zhuang, L.Y.; Yang, W.Q.; Tu, L.H.; Tan, B.; Zhang, L. Sex-specific responses to Pb stress in Populus deltoides: Root architecture and Pb translocation. Trees 2016, 30, 2019–2027. [Google Scholar] [CrossRef]
- Fattahi, B.; Arzani, K.; Souri, M.K.; Barzegar, M. Morphophysiological and phytochemical responses to cadmium and lead stress in coriander (Coriandrum sativum L.). Ind. Crops Prod. 2021, 171, 113979. [Google Scholar] [CrossRef]
- Zhang, H.H.; Li, X.; Xu, Z.S.; Wang, Y.; Teng, Z.Y.; An, M.J.; Zhang, Y.H.; Zhu, W.X.; Xu, N.; Sun, G. Toxic effects of heavy metals Pb and Cd on mulberry (Morus alba L.) seedling leaves: Photosynthetic function and reactive oxygen species (ROS) metabolism responses. Ecotoxicol. Environ. Saf. 2020, 195, 469. [Google Scholar]
- Guo, P.; Qi, Y.P.; Cai, Y.T.; Yang, T.Y.; Yang, L.T.; Huang, Z.R.; Chen, L.S. Aluminum effects on photosynthesis, reactive oxygen species and methylglyoxal detoxification in two citrus species differing in aluminum tolerance. Tree Physiol. 2018, 38, 1548–1565. [Google Scholar] [CrossRef] [Green Version]
- Sorrentino, M.C.; Capozzi, F.; Amitrano, C.; Giordano, S.; Arena, C.; Spagnuolo, V. Performance of three cardoon cultivars in an industrial heavy metal contaminated soil: Effects on morphology, cytology and photosynthesis. J. Hazard. Mater. 2018, 351, 131–137. [Google Scholar] [CrossRef]
- Shi, W.G.; Li, J.; Kan, D.X.; Yu, W.J.; Chen, X.; Zhang, Y.H.; Ma, C.F.; Deng, S.R.; Zhou, J.; Fayyaz, P.; et al. Sulfur metabolism, organic acid accumulation and phytohormone regulation are crucial physiological processes modulating the different tolerance to Pb stress of two contrasting poplars. Tree Physiol. 2022, 42, 1799–1811. [Google Scholar] [CrossRef]
- Kuang, X.S.; Wang, W.Y.; Hu, J.Y.; Liu, W.S.; Zeng, W.B. Subcellular distribution and chemical forms of manganese in Daucus carota in relation to its tolerance. Front. Plant Sci. 2022, 13, 947882. [Google Scholar] [CrossRef]
- Wu, Z.P.; McGrouther, K.; Chen, D.L.; Wu, W.D.; Wang, H.L. Subcellular distribution of metals within Brassica chinensis L. in response to elevated lead and chromium stress. J. Agric. Food. Chem. 2013, 61, 4715–4722. [Google Scholar] [CrossRef]
- Zhou, C.F.; Huang, M.Y.; Li, Y.; Luo, J.W.; Cai, L.P. Changes in subcellular distribution and antioxidant compounds involved in Pb accumulation and detoxification in Neyraudia reynaudiana. Environ. Sci. Pollut. Res. 2016, 23, 21794–21804. [Google Scholar] [CrossRef]
- Li, Y.; Zhou, C.F.; Huang, M.Y.; Luo, J.W.; Hou, X.L.; Wu, P.F.; Ma, X.Q. Lead tolerance mechanism in Conyza canadensis: Subcellular distribution, ultrastructure, antioxidative defense system, and phytochelatins. J. Plant Res. 2016, 129, 251–262. [Google Scholar] [CrossRef]
- Crist, R.H.; Martin, J.R.; Crist, D.L.R. Heavy metal uptake by lignin: Comparison of biotic ligand models with an ion-exchange process. Environ. Sci. Technol. 2002, 36, 1485–1490. [Google Scholar] [CrossRef]
- Sheng, Y.B.; Yan, X.X.; Huang, Y.; Han, Y.Y.; Zhang, C.; Ren, Y.B.; Fan, T.T.; Xiao, F.M.; Liu, Y.S.; Cao, S.Q. The WRKY transcription factor, WRKY13, activates PDR8 expression to positively regulate cadmium tolerance in Arabidopsis. Plant Cell Environ. 2019, 42, 891–903. [Google Scholar] [CrossRef]
- Eugene, A.L.; Alexander, A.K.; Alexander, V.K.; Victor, V.K. Specificity of Cd, Cu, and Fe effects on barley growth, metal contents in leaves and chloroplasts, and activities of photosystem I and photosystem II. Plant Physiol. Biochem. 2020, 147, 191–204. [Google Scholar]
- Li, J.; Yokosho, K.; Liu, S.; Cao, H.R.; Yamaji, N.; Zhu, X.G.; Liao, H.; Ma, J.F.; Chen, Z.C. Diel magnesium fluctuations in chloroplasts contribute to photosynthesis in rice. Nat. Plants 2020, 6, 848–859. [Google Scholar] [CrossRef]
- Pittman, J.K. Managing the manganese: Molecular mechanisms of manganese transport and homeostasis. New Phytol. 2005, 167, 733–742. [Google Scholar] [CrossRef]
- Xu, Z.L.; Wang, Y.D.; Chen, Y.C.; Yin, H.F.; Wu, L.W.; Zhao, Y.X.; Wang, M.Y.; Gao, M. A model of hormonal regulation of stamen abortion during pre-meiosis of Litsea cubeba. Genes 2019, 11, 48. [Google Scholar] [CrossRef] [Green Version]
- Hu, W.L. The Research on the Response of Litsea cubeba (Lour.) Pers Seedlings to Lead and Zinc Stress. Master Dissertation, Central South University of Forestry and Technology, Changsha, China, 2019. [Google Scholar]
- Wang, Q.Y. Physiological and Biochemical Changes during Flower Bud Development of Male and Female Litsea cubeba in Pb and Zn Contaminated Soils. Master Dissertation, Central South University of Forestry and Technology, Changsha, China, 2021. [Google Scholar]
- Yu, P.Y.; Sun, Y.P.; Huang, Z.L.; Zhu, F.; Sun, Y.J.; Jiang, L.J. The effects of ectomycorrhizal fungi on heavy metals’ transport in Pinus massoniana and bacteria community in rhizosphere soil in mine tailing area. J. Hazard. Mater. 2020, 381, 121203. [Google Scholar] [CrossRef]
- Perez-Harguindeguy, N.; Diaz, S.; Garnier, E.; Lavorel, S.; Poorter, H.; Jaureguiberry, P.; Bret-Harte, M.S.; Cornwell, W.K.; Craine, J.M.; Gurvich, D.E.; et al. New handbook for standardised measurement of plant functional traits worldwide. Aust. J. Bot. 2013, 61, 167–234. [Google Scholar] [CrossRef]
- Dai, Y.J.; Shen, Z.G.; Liu, Y.; Wang, L.L.; Hannaway, D.; Lu, H.F. Effects of shade treatments on the photosynthetic capacity, chlorophyll fluorescence, and chlorophyll content of Tetrastigma hemsleyanum Diels et Gilg. Environ. Exp. Bot. 2009, 65, 177–182. [Google Scholar] [CrossRef]
- Kramer, D.M.; Johnson, G.; Kiirats, O.; Edwards, G.E. New fluorescence parameters for the determination of QA redox state and excitation energy fluxes. Photosynth. Res. 2004, 79, 209–218. [Google Scholar] [CrossRef]
- Pan, G.; Yan, W.D.; Zhang, H.P.; Xiao, Z.H.; Li, X.H.; Liu, W.S.; Zheng, L. Subcellular distribution and chemical forms involved in manganese accumulation and detoxification for Xanthium strumarium L. Chemosphere 2019, 237, 4531. [Google Scholar] [CrossRef]
- Qiao, Y.; Cheng, Q.M.; Zhang, Y.T.; Yan, W.; Yi, F.Y.; Shi, F.L. Transcriptomic and chemical analyses to identify candidate genes involved in color variation of sainfoin flowers. BMC Plant Biol. 2021, 21, 61. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Wright, I.J.; Reich, P.B.; Westoby, M.; Ackerly, D.D.; Baruch, Z.; Bongers, F.; Cavender-Bares, J.; Chapin, T.; Cornelissen, J.H.C.; Diemer, M. The worldwide leaf economics spectrum. Nature 2004, 428, 821–827. [Google Scholar] [CrossRef]
- Poorter, L. Leaf traits show different relationships with shade tolerance in moist versus dry tropical forests. New Phytol. 2009, 181, 890–900. [Google Scholar] [CrossRef]
- Hussain, S.; Li, S.X.; Mumtaz, M.; Shafiq, I.; Iqbal, N.; Brestic, M.; Shoaib, M.; Qin, S.S.; Wang, L.; Yang, W.Y.; et al. Foliar application of silicon improves stem strength under low light stress by regulating lignin biosynthesis genes in soybean (Glycine max (L.) Merr.). J. Hazard. Mater. 2020, 401, 3256. [Google Scholar] [CrossRef]
- Colzi, I.; Renna, L.; Bianchi, E.; Castellani, M.B.; Coppi, A.; Pignattelli, S.; Loppi, S.; Gonnelli, C. Impact of microplastics on growth, photosynthesis and essential elements in Cucurbita pepo L. J. Hazard. Mater. 2021, 7, 7238. [Google Scholar] [CrossRef]
- Vera-Estrella, R.; Gómez-Méndez, M.F.; Amezcua-Romero, J.C.; Barkla, B.J.; Rosas-Santiago, P.; Pantoja, O. Cadmium and zinc activate adaptive mechanisms in Nicotiana tabacum similar to those observed in metal tolerant plants. Planta 2017, 246, 433–451. [Google Scholar] [CrossRef]
- Rana, S. Plant response towards cadmium toxicity: An overview. Ann. Plant Sci. 2015, 7, 1162–1172. [Google Scholar]
- Jayasri, M.A.; Suthindhiran, K. Effect of zinc and lead on the physiological and biochemical properties of quatic plant Lemna minor: Its potential role in phytoremediation. Appl. Water Sci. 2017, 7, 1247–1253. [Google Scholar] [CrossRef] [Green Version]
- Xiong, Z.T. Bioaccumulation and physiological effects of excess lead roadside pioneer species Sonchus oleraceus. Environ. Pollut. 1997, 97, 275–279. [Google Scholar] [CrossRef]
- Zhang, L.L.; Zhu, X.M.; Kuang, Y.W. Responses of Pinus massoniana seedlings to lead stress. Biol. Plant 2017, 61, 785–790. [Google Scholar] [CrossRef]
- Amir, W.; Farid, M.; Ishaq, H.K.; Farid, S.; Zubair, M.; Alharby, H.F.; Bamagoos, A.A.; Rizwan, M.; Raza, N.; Hakeem, K.R.; et al. Accumulation potential and tolerance response of Typha latifolia L. under citric acid assisted phytoextraction of lead and mercury. Chemosphere 2020, 157, 127247–127261. [Google Scholar] [CrossRef]
- Gill, S.S.; Khan, N.A.; Tuteja, N. Cadmium at high dose perturbs growth, photosynthesis and nitrogen metabolism while at low dose it up regulates sulfur assimilation and antioxidant machinery in garden cress (Lepidium sativum L.). Plant Sci. 2012, 182, 112–120. [Google Scholar] [CrossRef]
- Deng, G.; Li, M.; Li, H.; Yin, L.Y.; Li, W. Exposure to cadmium causes declines in growth and photosynthesis in the endangered aquatic fern (Ceratopteris pteridoides). Aquat. Bot. 2014, 112, 23–32. [Google Scholar] [CrossRef]
- Tang, L.; Yao, A.J.; Yuan, M.; Tang, Y.T.; Liu, J.; Liu, X.; Qiu, R.L. Transcriptional up-regulation of genes involved in photosynthesis of the Zn/Cd hyperaccumulator Sedum alfredii in response to zinc and cadmium. Chemosphere 2016, 164, 190–200. [Google Scholar] [CrossRef]
- Juvany, M.; Munné-Bosch, S. Sex-related differences in stress tolerance in dioecious plants: A critical appraisal in a physiological context. J. Exp. Bot. 2015, 66, 6083–6092. [Google Scholar] [CrossRef] [Green Version]
- Liao, J.; Cai, Z.Y.; Song, H.F.; Zhang, S. Poplar males and willow females exhibit superior adaptation to nocturnal warming than the opposite sex. Sci. Total Environ. 2020, 717, 7179. [Google Scholar] [CrossRef]
- Zhang, S.; Chen, L.G.; Duan, B.L.; Korpelainen, H.; Li, C.Y. Populus cathayana males exhibit more efficient protective mechanisms than females under drought stress. For. Ecol. Manag. 2012, 275, 68–78. [Google Scholar] [CrossRef]
- Ferrero-Serrano, Á.; Assmann, S.M. The α-subunit of the rice heterotrimeric G protein, RGA1, regulates drought tolerance during the vegetative phase in the dwarf rice mutant d1. J. Exp. Bot. 2016, 67, 3433–3443. [Google Scholar] [CrossRef] [Green Version]
- Miller, M.A.E.; O’Cualain, R.; Selley, J.; Knight, D.; Karim, M.F.; Hubbard, S.J.; Johnson, G.N. Dynamic acclimation to high light in Arabidopsis thaliana involves widespread reengineering of the leaf proteome. Front. Plant Sci. 2017, 8, 1239. [Google Scholar] [CrossRef] [Green Version]
- Tikkanen, M.; Mekala, N.R.; Aro, E.M. Photosystem II photoinhibition-repair cycle protects Photosystem I from irreversible damage. Biochim. Biophys. Acta 2014, 1837, 210–215. [Google Scholar] [CrossRef] [Green Version]
- Fu, W.G.; Wang, F.K. Effects of high soil lead concentration on photosynthetic gas exchange and chlorophyll fluorescence in Brassica chinensis L. Plant Soil Environ. 2015, 61, 316–321. [Google Scholar] [CrossRef] [Green Version]
- Lanna, A.C.; Mitsuzono, S.T.; Terra, T.G.R.; Vianello, R.P.; Carvalho, M.A.D.F. Physiological characterization of common bean (Phaseolus vulgaris L.) genotypes: Water stress induced with contrasting response towards drought. Aust. J. Crop Sci. 2016, 10, 1–6. [Google Scholar]
- Rudzani, M.; Diana, M.; Joachim, M.S. The effect of drought stress on yield, leaf gaseous exchange and chlorophyll fluorescence of dry beans (Phaseolus vulgaris L.). Agric. Water Manag. 2017, 180, 118–125. [Google Scholar]
- Li, X.P.; Bjorkman, O.; Shih, C.; Grossman, A.R.; Rosenquist, M.; Jansson, S.; Niyogi, K.K. A pigment-binding protein essential for regulation of photosynthetic light harvesting. Nature 2000, 403, 391–395. [Google Scholar] [CrossRef]
- Xu, N.; Zhang, H.H.; Zhong, H.X.; Wu, Y.N.; Li, J.B.; Xin, L.; Yin, Z.P.; Zhu, W.X.; Qu, Y.; Sun, G.Y. The response of photosynthetic functions of F1 cutting seedlings from Physocarpus amurensis Maxim (♀) × Physocarpus opulifolius “Diabolo” (♂) and the parental leaves to salt stress. Front. Plant Sci. 2018, 9, 714. [Google Scholar]
- Wang, Y.; Shen, H.; Xu, L.; Zhu, X.W.; Li, C.; Zhang, W.; Xie, Y.; Gong, Y.Q.; Liu, L.W. Transport, ultrastructural localization, and distribution of chemical forms of lead in radish (Raphanus sativus L.). Front. Plant Sci. 2015, 6, 293. [Google Scholar] [CrossRef] [Green Version]
- Xin, J.L.; Huang, B.F. Subcellular distribution and chemical forms of cadmium in two hot pepper cultivars differing in cadmium accumulation. J. Agric. Food Chem. 2014, 62, 508–515. [Google Scholar] [CrossRef]
- Zou, J.Z.; Zhang, Y.X.; Li, X.; Ma, X.D.; Liu, J.X.; Peng, X.Y.; Sun, Z.Y. Sexual differences in root growth and antioxidant characteristics in Salix viminalis exposed to cadmium stress. Int. J. Phytoremed. 2021, 23, 1466–1475. [Google Scholar] [CrossRef]
- Li, X.Y.; Yang, Z.J.; Li, Y.C.; Zhao, H.X. Different responses to joint exposure to cadmium and zinc depends on the sex in Populus cathayana. Ecotoxicol. Environ. Saf. 2022, 248, 114297. [Google Scholar] [CrossRef]
- Wang, Q.Y.; Liu, J.S.; Hu, B. Integration of copper subcellular distribution and chemical forms to understand copper toxicity in apple trees. Environ. Exp. Bot. 2016, 123, 125–131. [Google Scholar] [CrossRef]
- Guo, W.L.; Nazim, H.; Liang, Z.S.; Yang, D.F. Magnesium deficiency in plants: An urgent problem. Crop J. 2016, 4, 83–91. [Google Scholar] [CrossRef] [Green Version]
- Trankner, M.; Jaghdani, S.J. Minimum magnesium concentrations for photosynthetic efficiency in wheat and sunflower seedlings. Plant Physiol. Biochem. 2019, 144, 234–243. [Google Scholar] [CrossRef]
- Xu, H.X.; He, J.; Yi, H.; Wang, L. Sex specific response mechanism of transcriptome in both male and female Marchantia polymorpha under cadmium stress. Chin. Boll. Bot. 2022, 57, 182–196. [Google Scholar]
- Wang, Y.; Yu, Y.T.; Zhang, H.B.; Huo, Y.Z.; Liu, X.Q.; Che, Y.H.; Wang, J.C.; Sun, G.Y.; Zhang, H.H. The phytotoxicity of exposure to two polybrominated diphenyl ethers (BDE47 and BDE209) on photosynthesis and the response of the hormone signaling and ROS scavenging system in tobacco leaves. J. Hazard. Mater. 2022, 426, 128012. [Google Scholar] [CrossRef]
Treatment | Sex | Pb (μg g−1 FW) | Ca (μg g−1 FW) | Fe (μg g−1 FW) | K (μg g−1 FW) | Mg (μg g−1 FW) | Mn (μg g−1 FW) | Zn (μg g−1 FW) |
---|---|---|---|---|---|---|---|---|
CK | Female | 1.17 ± 0.17 bc | 219.25 ± 3.49 e | 30.73 ± 0.26 d | 425.64 ± 1.51 a | 44.31 ± 0.23 c | 8.57 ± 0.04 g | 11.76 ± 0.06 a |
Male | 1.53 ± 0.29 abc | 154.39 ± 1.08 g | 19.97 ± 0.01 h | 225.44 ± 2.23 f | 27.91 ± 0.89 f | 5.94 ± 0.02 h | 7.41 ± 0.10 c | |
P1 | Female | 0.95 ± 0.03 cd | 274.71 ± 2.90 d | 24.06 ± 0.21 g | 166.53 ± 3.93 h | 34.48 ± 0.87 e | 11.64 ± 0.07 e | 11.91 ± 0.09 a |
Male | 0.51 ± 0.10 d | 281.85 ± 2.43 cd | 44.71 ± 0.64 a | 323.04 ± 5.66 c | 44.22 ± 0.44 c | 15.28 ± 0.06 d | 6.22 ± 0.04 e | |
P2 | Female | 1.86 ± 0.26 a | 660.13 ± 7.03 a | 37.91 ± 0.40 c | 253.31 ± 4.21 e | 91.61 ± 1.20 a | 21.33 ± 0.20 a | 7.78 ± 0.04 b |
Male | 1.62 ± 0.12 ab | 311.44 ± 2.43 b | 24.80 ± 0.09 f | 264.63 ± 1.38 d | 52.80 ± 0.98 b | 20.16 ± 0.21 b | 6.64 ± 0.03 d | |
P3 | Female | 1.17 ± 0.05 bc | 199.61 ± 2.50 f | 42.16 ± 0.29 b | 359.07 ± 1.13 b | 29.26 ± 1.34 f | 10.20 ± 0.08 f | 4.02 ± 0.05 f |
Male | 1.20 ± 0.05 bc | 286.97 ± 1.31 c | 26.38 ± 0.42 e | 203.93 ± 1.88 g | 38.90 ± 0.30 d | 16.74 ± 0.04 c | 7.32 ± 0.18 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, S.; Wang, Q.; Li, W.; Yang, Y.; Jiang, L. Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution. Forests 2023, 14, 724. https://doi.org/10.3390/f14040724
Li S, Wang Q, Li W, Yang Y, Jiang L. Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution. Forests. 2023; 14(4):724. https://doi.org/10.3390/f14040724
Chicago/Turabian StyleLi, Simeng, Qinyi Wang, Wenjun Li, Yan Yang, and Lijuan Jiang. 2023. "Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution" Forests 14, no. 4: 724. https://doi.org/10.3390/f14040724
APA StyleLi, S., Wang, Q., Li, W., Yang, Y., & Jiang, L. (2023). Litsea Males Are Better Adapted to Pb Stress Than Females by Modulating Photosynthesis and Pb Subcellular Distribution. Forests, 14(4), 724. https://doi.org/10.3390/f14040724