Fine-Scale Spatial Patterns of the Genetic Diversity ofEuropean Beech (Fagus sylvatica L.) around a Mountainous Glacial Refugium in the SW Balkans
Abstract
:1. Introduction
2. Materials and Methods
2.1. Area of the Study and Sampling
2.2. Laboratory Procedures
2.3. Data Analysis
3. Results
3.1. Diversity and Differentiation of cpSSR Haplotypes
3.2. Diversity and Differentiation at nSSR Loci
4. Discussion
4.1. cpSSR Haplotypes and Postglacial Lineages
4.2. Spatial Genetic Pattern at cpSSR and nSSR Markers
4.3. Several Smaller Refugia within a Larger Refugium
4.4. A Possible Glacial Refugium for the Main European Lineage
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
cpSSRs | chloroplast Single-Sequence Repeats |
nSSRs | nuclear Single-Sequence Repeats |
EST | Expressed Sequence Tag |
AMOVA | Analysis of Molecular Variance |
MCMC | Markov chain Monte Carlo |
QGIS | Quantum geographic information system |
LGM | Last Glacial Maximum |
SW | Southwest |
SE | Standard Error |
References
- Ellenberg, H. Vegetation Ecology of Central Europe, 4th ed.; Cambridge University Press: Cambridge, UK, 1988. [Google Scholar]
- Bohn, U.; Neuhäusl, R.; Gollub, G.; Hettwer, C.; Neuhäuslová, Z.; Raus, T.; Schlüter, H.; Weber, H. Karte der Natürlichen Vegetation Europas/Map of the Natural Vegetation of Europe Scale 1:2,500,000; Federal Agency for Nature Conservation Konstantinstr: Bonn, Germany, 2000; p. 530. [Google Scholar]
- Myśliwy, M.; Szlauer-Łukaszewska, A. Flora Europaea, 2nd ed.; Tutin, T.G., Burges, N.A., Chater, A.O., Ed-mondson, J.R., Heywood, V.H., Moore, D.M., Valentine, D.H., Walters, S.M., Webb, D.A., Eds.; Cambridge University Press: Cambridge, UK, 1993; Volume 1. [Google Scholar]
- Christensen, K.I. Flora Hellenica 1; Strid, A., Tan, K., Eds.; Koeltz Scientific Books: Königstein, Germany, 1997. [Google Scholar]
- Bergmeier, E.; Dimopoulos, P. Fagus sylvatica forest vegetation in Greece: Syntaxonomy and gradient analysis. J. Veg. Sci. 2001, 12, 109–126. [Google Scholar] [CrossRef]
- Sánchez de Dios, R.; Gómez, C.; Aulló, I.; Cañellas, I.; Gea-Izquierdo, G.; Montes, F.; Sainz-Ollero, H.; Velázquez, J.C.; Hernández, L. Fagus sylvatica L. Peripheral Populations in the Mediterranean Iberian Peninsula: Climatic or Anthropic Relicts? Ecosystems 2021, 24, 211–226. [Google Scholar] [CrossRef]
- Hewitt, G.M. Some genetic consequences of ice ages, and their role in divergence and speciation. Biol. J. Linn. Soc. 1996, 58, 247–276. [Google Scholar] [CrossRef]
- Hu, F.S.; Hampe, A.; Petit, R.J. Paleoecology meets genetics: Deciphering past vegetational dynamics. Front. Ecol. Environ. 2009, 7, 371–379. [Google Scholar] [CrossRef] [Green Version]
- Médail, F.; Diadema, K. Glacial refugia influence plant diversity patterns in the Mediterranean Basin. J. Biogeogr. 2009, 36, 1333–1345. [Google Scholar] [CrossRef]
- Hampe, A.; Jump, A.S. Climate Relicts: Past, Present, Future. Annu. Rev. Ecol. Evol. Syst. 2011, 42, 313–333. [Google Scholar] [CrossRef] [Green Version]
- de Lafontaine, G.; Ducousso, A.; Lefèvre, S.; Magnanou, E.; Petit, R.J. Stronger spatial genetic structure in recolonized areas than in refugia in the European beech. Mol. Ecol. 2013, 22, 4397–4412. [Google Scholar] [CrossRef]
- Huntley, B.; Birks, H.J.B. An Atlas of Past and Present Pollen Maps for Europe: 0–13,000 Years Ago; Cambridge University Press: Cambridge, UK, 1983; Volume 1. [Google Scholar]
- Lang, A. Infra-red stimulated luminescence dating of holocene reworked silty sediments. Quat. Sci. Rev. 1994, 13, 525–528. [Google Scholar] [CrossRef]
- Gliemeroth, A.K. Paläoökologische Untersuchungen über die Letzten 22 000 Jahre in Europa: Vegetation, Biomasse und Einwanderungsgeschichte der Wichtigsten Waldbäume; 7 Tabellen; G. Fischer: Stuttgart, Germany, 1995. [Google Scholar]
- Pott, R. Palaeoclimate and vegetation—Long-term vegetation. Phytocoenologia 2000, 30, 285–333. [Google Scholar] [CrossRef]
- Brewer, S. Recolonisation Postglaciaire de Quelques Taxons Tempérés en Europe (une Approche Spatiale et Temporelle). Ph.D. Thesis, 060—Biological and Medical Sciences, General, Université de Provence, Marseille, France, 2002. [Google Scholar]
- Tinner, W.; Lotter, A. Holocene expansions of Fagus silvatica and Abies alba in Central Europe: Where are we after eight decades of debate? Quat. Sci. Rev. 2006, 25, 526–549. [Google Scholar] [CrossRef]
- Giesecke, T.; Hickler, T.; Kunkel, T.; Sykes, M.T.; Bradshaw, R.H.W. Towards an understanding of the Holocene distribution of Fagus sylvatica L. J. Biogeogr. 2007, 34, 118–131. [Google Scholar] [CrossRef]
- Magri, D. Patterns of post-glacial spread and the extent of glacial refugia of European beech (Fagus sylvatica). J. Biogeogr. 2008, 35, 450–463. [Google Scholar] [CrossRef]
- Tzedakis, P.C.; Emerson, B.C.; Hewitt, G.M. Cryptic or mystic? Glacial tree refugia in northern Europe. Trends Ecol. Evol. 2013, 28, 696–704. [Google Scholar] [CrossRef] [Green Version]
- Hewitt, G. The genetic legacy of the Quaternary ice ages. Nature 2000, 405, 907–913. [Google Scholar] [CrossRef]
- Papageorgiou, A.C.; Tsiripidis, I.; Mouratidis, T.; Hatziskakis, S.; Gailing, O.; Eliades, N.-G.H.; Vidalis, A.; Drouzas, A.D.; Finkeldey, R. Complex fine-scale phylogeographical patterns in a putative refugial region for Fagus sylvatica (Fagaceae). Bot. J. Linn. Soc. 2014, 174, 516–528. [Google Scholar] [CrossRef] [Green Version]
- Tzedakis, P.C.; Lawson, I.T.; Frogley, M.R.; Hewitt, G.M.; Preece, R.C. Buffered tree population changes in a quaternary refugium: Evolutionary implications. Science 2002, 297, 2044–2047. [Google Scholar] [CrossRef] [Green Version]
- Petit, R.; Aguinagalde, I.; de Beaulieu, J.L.; Bittkau, C.; Brewer, S.; Cheddadi, R.; Ennos, R.; Fineschi, S.; Grivet, D.; Lascoux, M.; et al. Glacial refugia: Hotspots but not melting pots of genetic diversity. Science 2003, 300, 1563–1565. [Google Scholar] [CrossRef] [Green Version]
- Huntley, B. Vegetation History; Springer: Dordrecht, The Netherlands, 1988; Volume 7, p. 804. [Google Scholar]
- Demesure, B.; Comps, B.; Petit, R.J. Chloroplast DNA phylogeography of the common beech (Fagus sylvatica L.) in Europe. Evolution 1996, 50, 2515–2520. [Google Scholar] [CrossRef]
- Pott, R. Invasion of Beech and Establishment of Beech Forest in Europe; Sapienza Università Editrice—Sapienza Università di Roma: Rome, Italy, 1997; Volume 55. [Google Scholar]
- Taberlet, P.; Fumagalli, L.; Wust-Saucy, A.G.; Cosson, J.F. Comparative phylogeography and postglacial colonization routes in Europe. Mol. Ecol. 1998, 7, 453–464. [Google Scholar] [CrossRef]
- Gömöry, D.; Paule, L.; Brus, R.; Zhelev, P.; Tomović, Z.; Gračan, J. Genetic differentiation and phylogeny of beech on the Balkan peninsula. J. Evol. Biol. 1999, 12, 746–754. [Google Scholar] [CrossRef] [Green Version]
- Comps, B.; Gömöry, D.; Letouzey, J.; Thiébaut, B.; Petit, R.J. Diverging trends between heterozygosity and allelic richness during postglacial colonization in the European beech. Genetics 2001, 157, 389–397. [Google Scholar] [CrossRef] [PubMed]
- Bradshaw, R.H.W. Past anthropogenic influence on European forests and some possible genetic consequences. For. Ecol. Manag. 2004, 197, 203–212. [Google Scholar] [CrossRef]
- Magri, D.; Vendramin, G.G.; Comps, B.; Dupanloup, I.; Geburek, T.; Gömöry, D.; Latałowa, M.; Litt, T.; Paule, L.; Roure, J.M.; et al. A new scenario for the Quaternary history of European beech populations: Palaeobotanical evidence and genetic consequences. New Phytol. 2006, 171, 199–221. [Google Scholar] [CrossRef]
- Vettori, C.; Vendramin, G.G.; Anzidei, M.; Pastorelli, R.; Paffetti, D.; Giannini, R. Geographic distribution of chloroplast variation in Italian populations of beech (Fagus sylvatica L.). Theor. Appl. Genet. 2004, 109, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Hatziskakis, S.; Papageorgiou, A.C.; Gailing, O.; Finkeldey, R. High chloroplast haplotype diversity in Greek populations of beech (Fagus sylvatica L.). Plant Biol. 2009, 11, 425–433. [Google Scholar] [CrossRef]
- Kaltenrieder, P.; Belis, C.A.; Hofstetter, S.; Ammann, B.; Ravazzi, C.; Tinner, W. Environmental and climatic conditions at a potential Glacial refugial site of tree species near the Southern Alpine glaciers. New insights from multiproxy sedimentary studies at Lago della Costa (Euganean Hills, Northeastern Italy). Quat. Sci. Rev. 2009, 28, 2647–2662. [Google Scholar] [CrossRef]
- Brus, R. Growing evidence for the existence of glacial refugia of European beech (Fagus sylvatica L.) in the south-eastern Alps and north-western Dinaric Alps. Period. Biol. 2010, 112, 239–246. [Google Scholar]
- Comps, B.; Thiebaut, B.; Sugar, I.; Trinajstic, I.; Plazibat, M. Genetic variation of the Croatian beech stands (Fagus sylvatica L): Spatial differentiation in connection with the environment. Ann. For. Sci. 1991, 48, 15–28. [Google Scholar] [CrossRef] [Green Version]
- Hazler, K.C.B.; Sugar, I.; Melovski, L. Genetic structure of Fagus sylvatica L. populations in southeastern Europe. Silvae Genet. 1997, 46, 229–236. [Google Scholar]
- Hewitt, G.M. Post-glacial re-colonization of European biota. Biol. J. Linn. Soc. 1999, 68, 87–112. [Google Scholar] [CrossRef]
- Svenning, J.-C.; Normand, S.; Kageyama, M. Glacial refugia of temperate trees in Europe: Insights from species distribution modelling. J. Ecol. 2008, 96, 1117–1127. [Google Scholar] [CrossRef]
- Gavin, D.G.; Fitzpatrick, M.C.; Gugger, P.F.; Heath, K.D.; Rodríguez-Sánchez, F.; Dobrowski, S.Z.; Hampe, A.; Hu, F.S.; Ashcroft, M.B.; Bartlein, P.J.; et al. Climate refugia: Joint inference from fossil records, species distribution models and phylogeography. New Phytol. 2014, 204, 37–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Konnert, M.; Bergmann, F. The geographical distribution of genetic variation of silver fir (Abies alba, Pinaceae) in relation to its migration history. Plant Syst. Evol. 1995, 196, 19–30. [Google Scholar] [CrossRef]
- Scaltsoyiannes, A.; Tsaktsira, M.; Drouzas, A.D. Allozyme differentiation in the Mediterranean firs (Abies, Pinaceae). A first comparative study with phylogenetic implications. Plant Syst. Evol. 1999, 216, 289–307. [Google Scholar] [CrossRef]
- Liepelt, S.; Cheddadi, R.; de Beaulieu, J.-L.; Fady, B.; Gömöry, D.; Hussendörfer, E.; Konnert, M.; Litt, T.; Longauer, R.; Terhürne-Berson, R.; et al. Postglacial range expansion and its genetic imprints in Abies alba (Mill.)—A synthesis from palaeobotanic and genetic data. Rev. Palaeobot. Palynol. 2009, 153, 139–149. [Google Scholar] [CrossRef]
- Brewer, S.; Cheddadi, R.; Beaulieu, J.d.; Reille, M. The spread of deciduous Quercus throughout Europe since the last glacial period. For. Ecol. Manag. 2002, 156, 27–48. [Google Scholar] [CrossRef]
- Petit, R.J.; Brewer, S.; Bordacs, S.; Burg, K.; Cheddadi, R.; Coart, E.; Cottrell, J.; Csaikl, U.M.; Dam, B.; Deans, J.D. Identification of refugia and post-glacial colonisation routes of European white oaks based on chloroplast DNA and fossil pollen evidence. For. Ecol. Manag. 2002, 156, 49–74. [Google Scholar] [CrossRef]
- Krebs, P.; Conedera, M.; Pradella, M.; Torriani, D.; Felber, M.; Tinner, W. Quaternary refugia of the sweet chestnut (Castanea sativa Mill.): An extended palynological approach. Veg. Hist. Archaeobot. 2004, 13, 285. [Google Scholar] [CrossRef] [Green Version]
- Lusini, I.; Velichkov, I.; Pollegioni, P.; Chiocchini, F.; Hinkov, G.; Zlatanov, T.; Cherubini, M.; Mattioni, C. Estimating the genetic diversity and spatial structure of Bulgarian Castanea sativa populations by SSRs: Implications for conservation. Conserv. Genet. 2014, 15, 283–293. [Google Scholar] [CrossRef]
- Poljak, I.; Idžojtić, M.; Šatović, Z.; Ježić, M.; Ćurković-Perica, M.; Simovski, B.; Acevski, J.; Liber, Z. Genetic diversity of the sweet chestnut (Castanea sativa Mill.) in Central Europe and the western part of the Balkan Peninsula and evidence of marron genotype introgression into wild populations. Tree Genet. Genomes 2017, 13, 18. [Google Scholar] [CrossRef]
- Havrdová, A.; Douda, J.; Krak, K.; Vít, P.; Hadincová, V.; Zákravský, P.; Mandák, B. Higher genetic diversity in recolonized areas than in refugia of Alnus glutinosa triggered by continent-wide lineage admixture. Mol. Ecol. 2015, 24, 4759–4777. [Google Scholar] [CrossRef]
- Papageorgiou, A.C.; Vidalis, A.; Gailing, O.; Tsiripidis, I.; Hatziskakis, S.; Boutsios, S.; Galatsidas, S.; Finkeldey, R. Genetic variation of beech (Fagus sylvatica L.) in Rodopi (NE Greece). Eur. J. For. Res. 2008, 127, 81–88. [Google Scholar] [CrossRef]
- Figliuolo, G. Landscape Genetics of Fagus sylvatica in One of Its Glacial Refuge Areas; Davis, R.E., Ed.; Nova Science: New York, NY, USA, 2011. [Google Scholar]
- Mavrommatis, G. The bioclimate of Greece: Relations between climate and natural vegetation, bioclimatic maps. For. Res. 1980, 1, 1–63. [Google Scholar]
- Cuervo-Alarcon, L.; Arend, M.; Müller, M.; Sperisen, C.; Finkeldey, R.; Krutovsky, K.V. Genetic variation and signatures of natural selection in populations of European beech (Fagus sylvatica L.) along precipitation gradients. Tree Genet. Genomes 2018, 14, 84. [Google Scholar] [CrossRef] [Green Version]
- Müller, M.; Cuervo-Alarcon, L.; Gailing, O.; Rajendra, K.C.; Chhetri, M.S.; Seifert, S.; Arend, M.; Krutovsky, K.V.; Finkeldey, R. Genetic variation of European beech populations and their progeny from northeast Germany to southwest Switzerland. Forests 2018, 9, 469. [Google Scholar] [CrossRef] [Green Version]
- Weising, K.; Gardner, R.C. A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome 1999, 42, 9–19. [Google Scholar] [CrossRef]
- Gailing, O.; Wuehlisch, V.G. Nuclear markers (AFLPs) and chloroplast microsatellites differ between Fagus sylvatica and F. orientalis. Silvae Genet. 2004, 53, 105–110. [Google Scholar] [CrossRef] [Green Version]
- Papageorgiou, A.C.; Manolis, A.; Vidalis, A.; Drouzas, A.D.; Kapetanidou, D.E.; Minadakis, N.; Rempi, P.; Karantona, S.; Tsikandylaki, V.R.; Papadopoulou, E.; et al. Sequences of Chloroplast Microsatellites Used for Phylogenetic Studies in Beech (Fagus sylvatica L.); Accession Number: KY496670 to KY496688; National Center for Biotechnology Information, U.S. National Library of Medicine: Bethesda, MD, USA, 2017. [Google Scholar]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [Green Version]
- Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef]
- Ueno, S.; Taguchi, Y.; Tomaru, N.; Tsumura, Y. Development of EST-SSR markers from an inner bark cDNA library of Fagus crenata (Fagaceae). Conserv. Genet. 2008, 10, 1477–1485. [Google Scholar] [CrossRef]
- Sullivan, A.R.; Lind, J.F.; McCleary, T.S.; Romero-Severson, J.; Gailing, O. Development and characterization of genomic and gene-based microsatellite markers in North American red oak species. Plant Mol. Biol. Rep. 2013, 31, 231–239. [Google Scholar] [CrossRef]
- Durand, J.; Bodénès, C.; Chancerel, E.; Frigerio, J.-M.; Vendramin, G.; Sebastiani, F.; Buonamici, A.; Gailing, O.; Koelewijn, H.-P.; Villani, F.; et al. A fast and cost-effective approach to develop and map EST-SSR markers: Oak as a case study. BMC Genom. 2010, 11, 570. [Google Scholar] [CrossRef] [Green Version]
- Carsjens, C.; Nguyen Ngoc, Q.; Guzy, J.; Knutzen, F.; Meier, I.C.; Müller, M.; Finkeldey, R.; Leuschner, C.; Polle, A. Intra-specific variations in expression of stress-related genes in beech progenies are stronger than drought-induced responses. Tree Physiol. 2014, 34, 1348–1361. [Google Scholar] [CrossRef] [Green Version]
- Teacher, A.G.F.; Griffiths, D.J. HapStar: Automated haplotype network layout and visualization. Mol. Ecol. Resour. 2010, 11, 151–153. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Green Version]
- Guillot, G.; Santos, F. Using AFLP markers and the Geneland program for the inference of population genetic structure. Mol. Ecol. Resour. 2010, 10, 1082–1084. [Google Scholar] [CrossRef] [PubMed]
- QGIS.org. QGIS Geographic Information System. QGIS Association. 2021. Available online: https://www.qgis.org/en/site/ (accessed on 31 May 2021).
- Hodel, R.G.J.; Segovia-Salcedo, M.C.; Landis, J.B.; Crowl, A.A.; Sun, M.; Liu, X.; Gitzendanner, M.A.; Douglas, N.A.; Germain-Aubrey, C.C.; Chen, S.; et al. The report of my death was an exaggeration: A review for researchers using microsatellites in the 21st century. Appl. Plant Sci. 2016, 4, apps.1600025. [Google Scholar] [CrossRef]
- Tsiripidis, I.; Drouzas, A.; Papageorgiou, A.; Stamellou, S. Are There Any Common Distribution Patterns Between Different Levels of Biodiversity? Comparing Haplotypes, Species and Plant Communities in a Beech Glacial Refugium. In Proceedings of the European Vegetation Survey, 26th International Workshop: Diversity Patterns across Communities in the Frame of Global Change: Conservation Challenges, Thessaloniki, Greece, 13–17 September 2019. [Google Scholar]
- Bennett, K.; Tallis, J. Global Vegetation Change-the Long View Plant Community History: Long-Term Changes in Plant Distribution and Diversity. J. Biogeogr. 1990, 18, 720. [Google Scholar] [CrossRef]
- Cozzolino, S.; Cafasso, D.; Pellegrino, G.; Musacchio, A.; Widmer, A. Fine-scale phylogeographical analysis of Mediterranean Anacamptis palustris (Orchidaceae) populations based on chloroplast minisatellite and microsatellite variation. Mol. Ecol. 2003, 12, 2783–2792. [Google Scholar] [CrossRef] [PubMed]
- Cozzolino, S.; Noce, M.E.; Musacchio, A.; Widmer, A. Variation at a chloroplast minisatellite locus reveals the signature of habitat fragmentation and genetic bottlenecks in the rare orchid Anacamptis palustris (Orchidaceae). Am. J. Bot. 2003, 90, 1681–1687. [Google Scholar] [CrossRef] [PubMed]
- Hampe, A.; Arroyo, J.; Jordano, P.; Petit, R.J. Rangewide phylogeography of a bird-dispersed Eurasian shrub: Contrasting Mediterranean and temperate glacial refugia. Mol. Ecol. 2003, 12, 3415–3426. [Google Scholar] [CrossRef]
- Hampe, A.; Petit, R.J. Conserving biodiversity under climate change: The rear edge matters. Ecol. Lett. 2005, 8, 461–467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lepais, O.; Muller, S.D.; Ben Saad-Limam, S.; Benslama, M.; Rhazi, L.; Belouahem-Abed, D.; Daoud-Bouattour, A.; Gammar, A.M.; Ghrabi-Gammar, Z.; Bacles, C.F.E. High genetic diversity and distinctiveness of rear-edge climate relicts maintained by ancient tetraploidisation for Alnus glutinosa. PLoS ONE 2013, 8, e75029. [Google Scholar] [CrossRef] [Green Version]
- Tzedakis, P.C.; Hooghiemstra, H.; Pälike, H. The last 1.35 million years at Tenaghi Philippon: Revised chronostratigraphy and long-term vegetation trends. Quat. Sci. Rev. 2006, 25, 3416–3430. [Google Scholar] [CrossRef]
- Raus, T. The boreal and centraI European element in the forest flora of Greece. Bocconea 1995, 5, 63–76. [Google Scholar]
- Zisi, N.; Dotsika, E.; Tsoukala, E.; Giannakopoulos, A.; Psomiadis, D. Palaeoclimatic evolution in Loutra Arideas cave (Almopia Speleopark, Macedonia, N. Greece) by stable isotopic analysis of fossil bear bones and teeth. Bull. Geol. Soc. Greece 2010, 43, 958–964. [Google Scholar] [CrossRef] [Green Version]
- Nagel, D.; Patcher, M.; Tsoukala, E. Large mammals except cave-bears from the Loutra Almopias Cave (Late Pleistocene, Macedonia, Greece). Geol. Bundesanst. 2019, 132, 122–147. [Google Scholar]
- Huntley, B.; Webb, T. Migration: Species’ response to climatic variations caused by changes in the Earth’s orbit. J. Biogeogr. 1989, 16, 5–19. [Google Scholar] [CrossRef]
- Sykes, M.T.; Prentice, I.C. Climate change, tree species distributions and forest dynamics: A case study in the mixed conifer/northern hardwoods zone of northern Europe. Clim. Chang. 1996, 34, 161–177. [Google Scholar] [CrossRef]
Locus (Cluster ID) | Motif Type/Repeat Number | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|---|
GOT066 | (GAA)10 | TCCCTAGATGATGGGGATGA | TTTTACGTCGGCCAACTTTT |
FIR004 | (CT)18 | TCTCTCTCAGGGCAGCTTCT | AACCAAACTCAGATCCAGATTCA |
FIR065 | (CTT)9 | ATTCCCATGCATCAAAATCC | TCCTTCAGTTTGAGAGCTCCTT |
FcC00464 | (AG)3GGCTCCATTACCTGGTCCT(AG)16 ATTGAAGGGCACCATTACTAGTCCT(AG)14 | GCACGAGGGTGAGAGTGAGAGTA | GCCCGTGTGTGAACATGTAGGAC |
FcC00927 | (TC)3CCAAAAAAAAAA(AC)3(TC)16 | CCTGCCGCTCAATTATTAGTCCC | ACGAGTCAGCTGGAAAACACGAG |
FcC01877 | (TC)15 | TCATAAACCCAAAATGCCTTCCC | CATTTGCTCCAAGAAGTCGTCGT |
DNA Fragment Length (bp) | ||||
---|---|---|---|---|
cpSSR Haplotype | ccmp4 | ccmp7 | ccmp10 | Individuals |
h01 | 116 | 144 | 115 | 42 |
h02 | 115 | 144 | 115 | 3 |
h03 | 117 | 144 | 115 | 2 |
h04 | 116 | 144 | 117 | 1 |
h05 | 116 | 145 | 115 | 14 |
h06 | 115 | 145 | 115 | 35 |
h07 | 116 | 145 | 116 | 1 |
h08 | 115 | 145 | 116 | 2 |
Total | 100 |
cpSSR | nSSR | |||||||
---|---|---|---|---|---|---|---|---|
Plot | N | Nh | Ne(h) | Na | Ne | Ho | He | F |
1 | 5 | 1 | 1.000 | 4.000 | 2.846 | 0.567 | 0.557 | −0.007 |
2 | 5 | 4 | 3.571 | 4.333 | 3.512 | 0.633 | 0.590 | −0.051 |
3 | 5 | 2 | 1.471 | 4.000 | 3.291 | 0.567 | 0.523 | −0.102 |
4 | 5 | 2 | 1.471 | 4.500 | 3.579 | 0.667 | 0.637 | −0.076 |
5 | 5 | 3 | 2.273 | 4.833 | 3.624 | 0.700 | 0.663 | −0.085 |
6 | 5 | 2 | 1.471 | 4.833 | 3.802 | 0.667 | 0.607 | −0.078 |
7 | 5 | 2 | 1.471 | 3.667 | 2.958 | 0.633 | 0.583 | −0.096 |
8 | 5 | 2 | 1.923 | 5.000 | 3.889 | 0.833 | 0.687 | −0.236 |
9 | 5 | 2 | 1.471 | 5.000 | 4.121 | 0.633 | 0.623 | −0.001 |
10 | 5 | 2 | 1.471 | 4.833 | 3.822 | 0.533 | 0.617 | 0.072 |
11 | 5 | 1 | 1.000 | 4.833 | 3.757 | 0.533 | 0.593 | 0.045 |
12 | 5 | 1 | 1.000 | 4.667 | 3.172 | 0.533 | 0.597 | 0.054 |
13 | 5 | 3 | 2.778 | 5.000 | 3.830 | 0.733 | 0.673 | −0.098 |
14 | 5 | 2 | 1.471 | 4.667 | 3.840 | 0.633 | 0.680 | 0.037 |
15 | 5 | 1 | 1.000 | 4.333 | 2.959 | 0.600 | 0.567 | −0.106 |
16 | 5 | 2 | 1.923 | 4.833 | 3.869 | 0.667 | 0.663 | 0.076 |
17 | 5 | 1 | 1.000 | 4.667 | 4.968 | 0.733 | 0.670 | −0.097 |
18 | 5 | 1 | 1.000 | 5.000 | 4.036 | 0.500 | 0.643 | 0.226 |
19 | 5 | 2 | 1.471 | 4.333 | 3.172 | 0.667 | 0.640 | −0.081 |
20 | 5 | 4 | 3.571 | 4.500 | 3.904 | 0.583 | 0.633 | 0.018 |
Mean | 2 | 1.657 | 4.642 | 3.648 | 0.631 | 0.622 | −0.030 | |
SE | 0.201 | 0.172 | 0.174 | 0.166 | 0.025 | 0.022 | 0.023 |
Percentage of Variation | cpSSR Haplotypes | nSSR FST | nSSR RST |
---|---|---|---|
Among plots (%) | 79 | 2 | 1 |
Among trees (%) | 21 | 11 | 77 |
Within trees (%) | - | 87 | 22 |
Φpt = 0.794 (p = 0.010) | FST = 0.023 (p = 0.001) | RST = 0.006 (p = 0.001) |
N | Na | Ne | Ho | He | F | Total N | |
---|---|---|---|---|---|---|---|
Fir065 | 4.950 | 4.700 | 3.760 | 0.818 | 0.709 | −0.167 | 9 |
GOT066 | 4.950 | 1.900 | 1.329 | 0.243 | 0.211 | −0.123 | 3 |
Fir004 | 4.950 | 3.450 | 2.210 | 0.505 | 0.490 | −0.056 | 14 |
FcC00464 | 5.000 | 5.900 | 4.878 | 0.750 | 0.781 | 0.045 | 17 |
FcC00927 | 5.000 | 5.550 | 4.285 | 0.680 | 0.737 | 0.071 | 17 |
FcC1877 | 5.000 | 6.350 | 5.424 | 0.790 | 0.806 | 0.022 | 25 |
Mean | 4.975 | 4.642 | 3.648 | 0.631 | 0.622 | −0.030 | 14.167 |
SE | 0.014 | 0.174 | 0.166 | 0.025 | 0.022 | 0.023 | 3.081 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsipidou, O.; Leinemann, L.; Korakis, G.; Finkeldey, R.; Gailing, O.; Papageorgiou, A.C. Fine-Scale Spatial Patterns of the Genetic Diversity ofEuropean Beech (Fagus sylvatica L.) around a Mountainous Glacial Refugium in the SW Balkans. Forests 2021, 12, 725. https://doi.org/10.3390/f12060725
Tsipidou O, Leinemann L, Korakis G, Finkeldey R, Gailing O, Papageorgiou AC. Fine-Scale Spatial Patterns of the Genetic Diversity ofEuropean Beech (Fagus sylvatica L.) around a Mountainous Glacial Refugium in the SW Balkans. Forests. 2021; 12(6):725. https://doi.org/10.3390/f12060725
Chicago/Turabian StyleTsipidou, Olympia, Ludger Leinemann, Georgios Korakis, Reiner Finkeldey, Oliver Gailing, and Aristotelis C. Papageorgiou. 2021. "Fine-Scale Spatial Patterns of the Genetic Diversity ofEuropean Beech (Fagus sylvatica L.) around a Mountainous Glacial Refugium in the SW Balkans" Forests 12, no. 6: 725. https://doi.org/10.3390/f12060725
APA StyleTsipidou, O., Leinemann, L., Korakis, G., Finkeldey, R., Gailing, O., & Papageorgiou, A. C. (2021). Fine-Scale Spatial Patterns of the Genetic Diversity ofEuropean Beech (Fagus sylvatica L.) around a Mountainous Glacial Refugium in the SW Balkans. Forests, 12(6), 725. https://doi.org/10.3390/f12060725