Next Article in Journal
Development of an Interdisciplinary Master of Forestry Program Focused on Forest Management in a Changing Climate
Next Article in Special Issue
Use of Inoculator Bacteria to Promote Tuber melanosporum Root Colonization and Growth on Quercus faginea Saplings
Previous Article in Journal
An Effect of Urban Forest on Urban Thermal Environment in Seoul, South Korea, Based on Landsat Imagery Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 11
Issue 6
10.3390/f11060631
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nitrogen Forms Alter Triterpenoid Accumulation and Related Gene Expression in Cyclocarya paliurus (Batalin) Iljinsk. Seedlings

by
Jian Qin
1,
Xiliang Yue
1,
Xulan Shang
1,2 and
Shengzuo Fang
1,2,*
1
College of Forestry, Nanjing Forestry University, Nanjing 210037, China
2
Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
Forests 2020, 11(6), 631; https://doi.org/10.3390/f11060631
Submission received: 23 April 2020 / Revised: 20 May 2020 / Accepted: 25 May 2020 / Published: 2 June 2020
(This article belongs to the Special Issue Non-wood Forest Products)
Browse Figures
Versions Notes

Abstract

:
Cyclocarya paliurus (Batalin) Iljinsk. is a multiple function tree species distributed in subtropical areas, and its leaves have been used in medicine and nutraceutical foods in China. However, little information on the effects of nitrogen (N) forms and ratios on growth and secondary metabolite accumulation is available for C. paliurus. The impact of five NO3−/NH4+ ratios on biomass production, triterpenoid accumulation and related gene expression in C. paliurus seedlings was evaluated at the middle N nutrition supply. Significant differences in seedling growth, triterpenoid accumulation and relative gene expression were observed among the different NO3−/NH4+ ratio treatments. The highest triterpenoid content was achieved in a sole NO3− or NH4+ nutrition, while the mixed N nutrition with equal ratio of NO3− to NH4+ produced the highest biomass production in the seedlings. However, the highest triterpenoid accumulation was achieved at the treatment with the ratio of NO3−/NH4+ = 2.33. Therefore, the mixed N nutrition of NO3− and NH4+ was beneficial to the triterpenoid accumulation per plant. The relative expression of seven genes that are involved in triterpenoid biosynthesis were all up-regulated under the sole NH4+ or NO3− nutrition conditions, and significantly positive correlations between triterpenoid content and relative gene expression of key enzymes were detected in the leaves. Our results indicated that NO3− is the N nutrition preferred by C. paliurus, but the mixture of NO3− and NH4+ at an appropriate ratio would improve the leaf triterpenoid yield per area.

1. Introduction

As one of the important secondary metabolites in plants, triterpenoids allow plant to better adapt to the environment, such as their defence against natural enemies and plant communication [1], but also have been confirmed to contain a variety of health-promoting effects in human beings, such as anti-hyperglycemic, anti-hyperlipidemic and antioxidant effects [2,3,4]. In plants, triterpenoids are synthesized by the isoprenoid pathway, which is composed of three synthetic stages: (1) 3-isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) are formed by mevalonate acid (MVA) or the 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway [5]; (2) 2,3-oxidosqualene is formed by geranyl diphosphate synthase (GPS), farnesyl diphosphate synthase (FPPS), squalene synthase (SQS) and squalene epoxidase (SE), which is subsequently cyclized to triterpenoid skeletons by 2,3-oxidosqualene cyclases (OSCs). Then, cytochrome P450 monooxygenase (PDMO) catalyzes oxidation of triterpenoid skeletons to produce aglycones; (3) the aglycones are glycosylated to triterpenoid saponins by glycosyltransferase (GT) [6] (Figure 1).
Cyclocarya paliurus (Batalin) Iljinsk., a member of Juglandaceae, is mainly scattered in the mountainous across sub-tropical regions of China [8]. Leaves of C. paliurus have been made into nutraceutical tea for a long time in China, while its leaf, bark and root are used in traditional Chinese medicine [9,10]. Moreover, the leaves of C. paliurus have been listed as new food raw material by the National Health and Family Planning Commission of China since 2013 [11]. Previous studies have found that C. paliurus leaves contain various bioactive constituents, including polyphenolics, flavonoids, triterpenoids, polysaccharides [4,11,12]. However, triterpenoids in C. paliurus play a very important role in the health-promoting effect, such as enhancing antihyperlipidemic activity and ameliorating diabetes [13,14]. Moreover, there are several specific triterpenoids that have been identified and isolated from C. paliurus leaves [15,16]. Due to its various health-promoting effects, a huge production of C. paliurus leaves is required for tea production and for medical use. However, C. paliurus is mainly distributed in natural forests and there are not enough C. paliurus plantations to produce the leaves. Therefore, there is an urgent need to develop C. paliurus plantations for meeting the strong market demand for high-quality raw material.
Environmental factors can affect growth, secondary metabolite biosynthesis and accumulation in plants. It was reported that the concentration of CO2 in the Earth’s atmospheric would increase to between 600 and 1000 μmol/mol by the end of 21st century [17]. This will affect the ratio of carboxylation to oxygenation, and consequently decrease photorespiration. Nitrogen (N), as an important environmental factor for plant growth, is primarily absorbed by plants in the form of ammonium (NH4+) and nitrate (NO3−) [18]. Many studies have indicated that the response of higher plants to elevated CO2 is determined by nitrogen availability, and is primarily related to the different forms of nitrogen nutrition [17,19,20,21]. Modification of the NO3−/NH4+ ratio can modulate the relative uptake of other anion and cations, consequently modifying primary and secondary metabolism and influencing plant growth and quality, Therefore the N forms and the most effective ratio of NO3−/NH4+ have been received considerable attentions in the research of N nutrition of plants [22]. However, most of the studies were focused on effects of N forms on the growth and quality of crops, vegetables and some herbal medicinal plants [17,22,23,24]. For example, previous studies showed that nitrogen form and ratio affect not only plant growth but also the secondary metabolite of herbal medicinal plants, such as Artemisia annua [25], Eleutherococcus koreanum [26], Centella asiatica [23], and Prunella vulgaris [27]. However, the responses of different plants to the nitrogen form and ratio vary with species [17,22,27,28], which could be linked to alterations in gene expression and readjustments of metabolic processes [29]. Alterations in secondary metabolite profiles of medicinal plants may improve their pharmacological properties, and can be potentially used to stimulate the synthesis of phytochemicals with beneficial properties in medicinal plants. However, biomass production is another key parameter for the cultivation of medicinal plants [30,31]. Hence, the trade-off between biomass production and pharmaceutically active metabolite content is a key parameter for culturing medicinal plants. To date, the effects of nitrogen forms and ratios on secondary metabolites were most reported in agricultural crops, horticultural and herbal medicinal plants, and little information is available for C. paliurus. Furthermore, the response of triterpenoid biosynthesis genes to nitrogen forms and ratios in C. paliurus is poorly understood. Therefore, it is critical to systematically assess the impact of fertilization on the growth, development, and secondary metabolism of woody medicinal plants. The objective of this study was to detect the effect of nitrogen forms and ratios on triterpenoid accumulation, and to elucidate the response of triterpenoid biosynthesis genes to nitrogen forms and ratios in C. paliurus. The result aims to provide optimal cropping strategies for harvesting the higher yield of triterpenoid of C. paliurus.

2. Material and Methods

2.1. Plant Material and Experimental Design

The experiment was carried out at Nanjing Forestry University (31°59′ N, 119°18′ E) in 2018. Seeds of C. paliurus were collected from Wufeng county (30°41′ N, 119°41′ E), Hubei province, China in late October 2016. The seeds were subjected to exogenous gibberellin A3 (GA3) and stratification treatments to break seed dormancy, according to the methods of Fang et al. [8]. The germinated seedlings were planted in non-woven containers filled with turfy soil/perlite/composted poultry manure/soil (4/2/2/2, v/v/v/v) in April 2018. The substrate was a loam with pH 6.4, organic matter content of 86.3 g/kg, total N content of 63.5 g/kg, total P content of 3.0 g/kg, and total K content of 10.1 g/kg. After 3 months of cultivation, C. paliurus seedlings with base diameter around 3.5 mm and height around 21.0 cm were moved into a greenhouse and transferred to the 35 L polypropylene containers with full-strength Hoagland nutrient solution. The full-strength nutrient solution contained the following macronutrients (mg/L): NO3−-N (224), NH4+-N (14.0), PO43−-P (15.5), K (298.0), Mg (48.1), Ca (210) and micronutrients (mg/L): B (0.5), Mn (0.5), Zn (0.5), Cu (0.5), Mo (0.5) and Fe (5.6).
After cultivated in the nutrient solution for 1 week, C. paliurus seedlings were carried out for N form and ratio treatments. Twenty-one seedlings for each treatment were used, which were arranged in a completely randomized design. Treatments consisted of N at 238 mg/L supplied as (T1) 100% NO3−-N: 0% NH4+-N, (T2) 70% NO3−-N: 30% NH4+-N, (T3) 50% NO3−-N: 50% NH4+-N, (T4) 30% NO3−-N: 70% NH4+-N, and (T5) 0% NO3−-N: 100% NH4+-N. NH4+-N was supplied as (NH4)2SO4, while NO3−-N was supplied as Ca(NO3)2 and KNO3. Throughout the experiment, the pH of each nutrient solution was adjusted to 5.5 ± 0.2 with 0.1 mol/L NaOH or 0.1 mol/L HCl. To prevent nitrification, the nitrification inhibitor dicyandiamide (DCD, 7% of total nitrogen content) was added to the nutrient solution. The solution was replaced on a weekly basis and aerated with an electric pump.
Environmental factors were monitored using a hand-held Agricultural Weather Station (TNHY series model, Zhejiang Top Instrument Co. Ltd., Hangzhou, China). The air temperature varied between 13 and 27 °C. The relative humidity of air varied between 55 and 80%. The photosynthetic photon flux density (PPFD) varied between 256.4 and 487.6 μmol/(m2·s).

2.2. Plant Material Sampling and Biomass Measurements

Plant materials (leaf, stem and root) were harvested and sampled at 30, 60 and 90 days after the N form treatments respectively, based on the mean base diameter and height of seedlings for each treatment. Three replicates of each treatment were sampled and harvested for biomass measurement, then washed and separated according to the components (leaf, stem and root). All of the sampling components were dried to constant weight at 70 °C. Total biomass of each seedling was calculated as the sum of root, stem and leaf biomass.

2.3. Measurement of Triterpenoid Contents

Triterpenoids were extracted as described by Cao et al. [32]. The total triterpenoid content was measured following the method of Fan and He [33], and the oleanolic acid was used as standard curve for calculating triterpenoid content.
The individual triterpenoid content was detected using high-performance liquid chromatography [32]. The mobile phases were composed of water/acetic acid (10,000/1, v/v) (A) and acetonitrile (B). The column temperature was 45 °C. The gradient program was as follows: 8–19% B at 0–13 min; 19–21% B at 13–28 min; 21–50% B at 28–42 min; 50% B at 42–46 min; 50–55% B at 46–60 min; 55–56% B at 60–64 min; 56–66% B at 64–74 min; 66–85% B at 74–90 min; 85–100% B at 90–95 min; 100% B at 95–100 min.

2.4. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis

The RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) analysis were performed as described by Chen et al. [34]. Seven genes related to the synthesis of triterpenoid (3-hydroxy-3-methylglutaryl-coenzyme A reductase, HMGR; 1-deoxy-D-xylulose 5-phosphate reductoisomerase, DXR; squalene synthase, SQS; UDP-glycosyltransferase, UDP; β-amyrin synthase, β-AS and glucose-1-phosphate adenylyltransferase, GPS) were selected. Relative gene expression was calculated by the 2−ΔΔCt method with 18S ribosomal RNA as an internal control gene [35] (Table 1 presents primer information for the studied genes). For comparison of the relative expression of the mRNA in different N form treatments and sampling times, transcript levels for each gene in all nitrogen treatments and sampling times were normalized to that of the T1 treatment at 30 days after N form treatments.

2.5. Statistical Analysis

Analysis of variance (ANOVA) was performed to analyze the impacts of nitrogen forms and ratios on growth, triterpenoid accumulation and relative gene expression of triterpenoid biosynthesis, followed by Tukey’s test with p < 0.05. Relationships among different indexes were evaluated by Pearson’s correlation analysis. All statistical analyses were conducted using SPSS 19.0 software (SPSS, Chicago, IL, USA). All values were expressed as mean ± standard deviation (SD).

3. Results

3.1. Seedling Biomass

Nitrogen form and ratio had a significant effect on biomass production of C. paliurus seedlings at all sampling times (p < 0.05) (Figure 2), while C. paliurus seedlings had died at 52 days after the treatment in T5. Meanwhile, significant differences in each biomass component and whole plant were also found between 30 and 90 days after the treatments. At the end of the experiment (90 days of treatment), total biomass production per seedling among the treatments was in the order of T3 > T2 > T4 > T1 treatment. Compared with T3 treatment, the total biomass per plant reduced by 34.7% in T1, 11.3% in T2 and 26.9% in T4, respectively.
A similar treatment effect on the biomass production of leaf, stem and root was also observed. However, the influence extent of N forms on the biomass varied among the components. Compared with T3 at 90 days after the treatments, the leaf biomass per plant reduced by 38.0% in T1, 10.9% in T2 and 30.6% in T4 respectively, while the stem biomass per plant reduced by 33.6% in T1, 10.9% in T2 and 26.1% in T4. Moreover, the ratio of root to shoot varied from 0.39 to 0.45, and increased by 1.8–11.0% for T1, T3 and T4 treatment as compared to T2 at 90 days after the treatments (Figure 3).

3.2. Triterpenoid Contents

The contents of total triterpenoid and five individual triterpenoids were determined in this study. Analysis of variance indicated triterpenoid contents were significantly influenced by N forms and their ratios (p < 0.05) (Figure 4). Among the components evaluated, leaves accumulated the greatest total triterpenoids (ranging from 14.32 to 23.45 mg/g), followed by stems (3.92–5.96 mg/g) and roots (3.38–5.48 mg/g), while the contents of five individual triterpenoids in the various components also followed this pattern. As a general tendency, the contents of total triterpenoid and five individual triterpenoids were enhanced with the prolongation of treatment times except for cyclocaric acid B and pterocaryoside A in roots and stems (Figure 4).
At 90 days after N form treatments, the highest contents of both total triterpenoid and the selected individual triterpenoids in C. paliurus leaves were detected in the T1 treatment, while the T3 treatment resulted in the lowest content (Figure 4). The contents of total triterpenoid and the selected triterpenoids in stems and roots showed a similar variation pattern. Compared with the T1 treatment sampled at 90 days, the contents of total triterpenoid, arjunolic acid, cyclocaric acid B, pterocaryoside A, hederagenin and oleanolic acid in the leaves of T2, T3 and T4 treatments decreased by 11.9–18.3%, 25.0–31.4% and 4.8–8.2%, respectively.

3.3. Triterpenoid Accumulation per Plant

In practice, only C. paliurus leaves are harvested for making tea or nutraceutical foods. The accumulations of total and selected triterpenoids in the leaves and in whole plant were respectively calculated for different N form treatments based on the component biomass and their corresponding triterpenoid contents (Figure 5). Analysis of variance showed that the accumulations of total triterpenoid and five individual triterpenoids per plant were significantly affected by NO3−/NH4+ ratio, and the accumulation of measured phytochemicals per plant showed an increasing tendency with the treatment periods (Figure 5). The quantities of total triterpenoid, arjunolic acid, cyclocaric acid B, and pterocaryoside A accumulated in the leaves per plant accounted for 66.9–74.0%, 65.6–70.8%, 72.4–75.2%, and 74.4–80.7% respectively, while the hederagenin and oleanolic acid were only detected in the leaves.
At the end of the experiment, the highest accumulations of total and selected triterpenoids were achieved in the T2 treatment, while the lowest productions were observed in the T1 treatment. Compared with T1 treatment, the accumulations of total triterpenoid, arjunolic acid, cyclocaric acid B, pterocaryoside A, hederagenin and oleanolic acid in leaves of T2, T3 and T4 treatments increased by 17.3–25.9%, 8.6–20.8% and 2.2–6.8%, respectively, while the accumulations per plant were enhanced by 14.6–25.9%, 8.6–20.8% and 2.4–6.8%.

3.4. Gene Expression Related to Triterpenoid Biosynthesis

The ANOVA indicated that NO3−/NH4+ ratios significantly modified relative gene expression of HMGR, DXR, GPS, SQS, β-AS and UDP in leaves of C. paliurus among different treatment periods (Figure 6). Generally, the relative expression of DXR and UDP displayed an increasing trend over time. Relative expression of HMGR, DXR, GPS, SQS, β-AS and UDP was consistently the lowest under T3 treatment across the treatment periods. At the N concentration of 238 mg/L, addition of 100% NO3−-N (T1) or 100% NH4+-N (T5) significantly upregulated relative expression of all genes evaluated on day 30 (Figure 6), but this upregulation effect was much greater in the T5 treatment (100% NH4+-N supplied), approaching 1.4–13.4 times the T1 treatment (100% NO3−-N supplied). Correlation analysis between relative gene expression of triterpenoid biosynthesis pathway (HMGR, DXR, GPS, SQS, β-AS and UDP) and the content of measured triterpenoids content showed significantly positive relationships (p < 0.01, Table 2).

4. Discussion

4.1. Effects of NO3−/NH4+ Ratio on Growth and Triterpenoid Content

Nitrate and ammonium are predominant forms of inorganic nitrogen absorbed by the roots of higher plants, but there exists controversy about the relative advantage of one form over the other in terms of various physiological processes or plant species [18,24]. For example, rice, tea and sugarcane, prefer NH4+ nutrient to NO3−, while NO3− is nutrient preferred by maize, sugarcane wheat and poplar [29,36,37,38,39]. For most plants, NH4+ is toxic and inhibits plant growth by induced nutrient deficiency, when supplied at high concentration without NO3− [40]. Despite NH4+ can induce toxicity symptoms, higher energy was consumed by of NO3− uptake relative to NH4+ [41]. Our study demonstrated that growth in mixed NO3− and NH4+ (T2, T3 and T4) was significantly superior to that in a sole N source (T1 and T5) (Figure 2), consistent with reports from Zhu et al. [27] who found that the growth of P. vulgaris was inhibited by a high concentration of either NO3− or NH4+. When NH4+ is the sole N source, in C. paliurus seedlings there occurred a symptom of toxicity, for example, old leaves’ margins turning brown and withering, having shorter stems, and even dying at 52 days after treatments. However, the survival and growth of C. paliurus seedlings were relatively uninfluenced when NO3− is the sole N source, compared to the sole NH4+ source (Figure 1). Meanwhile, Figure 1 also shows that the biomass production in T2 (NO3−/NH4+ = 2.33) was significantly higher than in T4 (NO3−/NH4+ = 0.43) for all components. Thus, it is inferred that C. paliurus may prefer NO3− to NH4+. Our results confirm that NH4+ as the sole nitrogen source inhibited growth compared to NO3− nutrition or a mixture of NO3− and NH4+. The possible reason is that the NH4+ supply affects regulatory processes by which plants adjust their metabolism to nitrogen assimilation [16], such as altering osmotic regulation [42,43], and hormonal regulation between root and shoot [44].
The nitrogen form and ratio had a similar effect on biomass production of root, stem and leaf (Figure 3), consistent with a report by He et al. [45]. However, nitrogen forms (NO3−-N and NH4+-N) and their ratios also affect dry matter distribution and carbohydrate consumption. Our results showed that NH4+ promotes root growth of C. paliurus seedlings, resulting in higher root/shoot ratio compared to NO3− nutrition or the mixture of NO3− and NH4+ (Figure 3), inconsistent with the results reviewed by Guo et al. [17] for agricultural crops (wheat, bean, tomato and maize plants), where NH4+ inhibits root growth, and results in higher shoot/root ratio compared to NO3− nutrition or the mixture of NO3− and NH4+. However, this promoting effect reduced as treatment times were prolonged (Figure 3). The possible reason is the losses of organic carbon vary due to differences between NO3− and NH4+ in the metabolism of absorption, assimilation, transportation, and energy cost.
Both plant growth and the biosynthesis of secondary metabolites are stimulated by multiple factors, such as the specific characteristics of visible light qualities [46,47] and N nutrition [17,29,48]. Our results confirmed that a sole concentration of NO3− or NH4+ (T1 and T5) accumulated more total and individual triterpenoids content (Figure 3), and support the resource availability hypothesis, where plant defense will increase when resources (such as light, water and nutrient) become stressed or limited [49]. Moreover, some hypotheses have also been presented to explain the potential trade-off between plant growth and synthesis of secondary metabolite [50,51,52], which are supported by the results from our study, where C. paliurus seedlings grow better under T2 and T3 treatments, and possess lower triterpenoid contents (Figure 2 and Figure 4), when compared with the T4 treatment. These results suggest that the manipulation of nitrogen form and ratio in the practice is necessary to enhance production of target triterpenoids in C. paliurus.

4.2. Effects of NO3−/NH4+ Ratio on Relative Gene Expression

Some studies on the effect of N nutrition on metabolism and biosynthesis of secondary metabolites have been conducted in woody plants [29,47,53]. For instance, recent investigations have shown that growth-promoting N nutrition reduced flavonoid accumulation in the leaves of apple trees [53,54], where phenylalanine ammonia-lyase (PAL) activity seems to be downregulated, thus forming a bottle-neck resulting in a generally decreased flavonoid accumulation. Huang et al. [55] reported the metabolic and transcriptional responses of young shoots of Camellia sinensis to four N conditions (N-deficiency, nitrate, ammonia, and nitric oxide), and indicated that N-deficiency tea plants accumulated diverse flavonoids, corresponding with higher expression of hub genes including flavonoid dioxygenase (F3H), flavone synthase (FNS), UDPG-flavonoids glucosyl transferase (UFGT), basic helix-loop-helix protein 35 (bHLH35), and basic helix-loop-helix protein 35 (bHLH36).
Triterpenoids are synthesized by the isoprenoids pathway in plants, while HMGR and DXR are the key enzymes of MVA and MEP pathways, respectively, in the upstream pathway. GPS is a gene involved in the synthesis of glycosides of triterpenoid saponins, whereas SQS is the first key enzyme in the branch of triterpene synthesis. The downstream pathway consists of 3 gene families (OSCs, POMD and GT), where UDP belongs to GT, and β-AS belong to OSCs. Li et al. [56] showed that the secondary metabolites content was increased or decreased by modifying the gene expression involved in secondary metabolic pathways under stress conditions in medicinal plants with same genetic background. Moreover, in various plant species, the positive correlations between the activities and gene expression levels of the key enzymes and the accumulation levels of triterpenoid saponins have been proved [7]. Our results indicated that expression of genes involved in the triterpenoid biosynthesis pathway was affected by nitrogen form and ratio (Figure 6). Significantly positive correlations were determined between the relative gene expression (HMGR, DXR, GPS, SQS, β-AS, and UDP) with total and selected triterpenoid contents (Table 2). Overall, the sole NH4+ or NO3− nutrition increased the content of triterpenoid by enhancing the relative gene expression of triterpenoid biosynthesis. On the basis of the presented results, an upregulation of measured genes under the sole NH4+ or NO3− nutrition can be assumed when N nutrition supply is not at N-deficiency or at high concentration, although this has to be confirmed by further studies at the level of more detailed transcripts.

4.3. Effects of NO3−/NH4+ Ratio on Triterpenoid Production per Plant

Metabolite profiles of plants are often modified by environmental stress conditions, which may promote the production of bioactive secondary metabolites with beneficial properties in medicinal plants [23,27,57]. However, the potential trade-off between plant growth and carbon-based secondary metabolite (such as triterpenoid) was proved [58], therefore, how to get the best trade-off is quite important in the practices for obtaining the greatest yield of target phytochemicals. When the C. paliurus plantations are planted, the management goal is to obtain not only higher quality (e.g., higher bioactive substance, such as triterpenoid contents in the leaves) but also greater target phytochemical accumulation per area (e.g., economic yield). Given the middle N nutrition supplied (at the N concentration of 238 mg/L) in the present study, the highest leaf biomass production was achieved at the ratio of NO3−/NH4+ = 1.0 (T3) (Figure 6), while the sole concentration of NO3− (T1) or NH4+ (T5) accumulated the highest triterpenoid content in the leaves. However, the maximum yield of total triterpenoids in the leaves per plant was obtained at the ratio of NO3−/NH4+ = 2.33 (T2), which could be referenced as the effective ratio of NO3−/NH4+ to induce the highest triterpenoid yield in practice. Moreover, regression analysis showed that the polynomial functions best described the relationship of total triterpenoid content in the leaves, total leaf triterpenoid accumulation and leaf biomass per plant to nitrogen forms (Figure 7), with a R2 ranging from 0.41 to 0.83 (p < 0.001). Therefore, results from this study provide a basis for optimizing the NH4+/NO3− ratio in nitrogen fertilization to achieved the triterpenoid yield per area in C. paliurus plantations.

5. Conclusions

Growth, triterpenoid accumulation and relative gene expression of C. paliurus seedlings were significantly influenced by nitrogen forms and their ratios. Given the middle N nutrition supplied (at the N concentration of 238 mg/L), the highest triterpenoid content was achieved in a sole NO3− or NH4+ nutrition, while the mixed N nutrition with an equal ratio of NO3− to NH4+ (T3) induced the highest biomass production in C. paliurus seedlings. However, the mixed N nutrition with a ratio of NO3− to NH4+ of 2.33 (T2) produced the highest triterpenoid accumulation per plant. Regression analysis suggests the polynomial functions can best describe the relationship of total triterpenoid content in the leaves, total leaf triterpenoid accumulation, and leaf biomass per plant to nitrogen forms and their ratios. The relative expression of HMGR, DXR, GPS, SQS, β-AS and UDP involved in triterpenoid biosynthesis were all up-regulated under the sole NH4+ or NO3− nutrition conditions, which was consistent with the increase of total and selected triterpenoid contents in the leaves. Our results provide a theoretical basis for manipulating nitrogen fertilization to achieve the highest yield of triterpenoids in C. paliurus cultivation. However, how to obtain a higher triterpenoid accumulation in C. paliurus plantations through fertilizing with the nitrogen form and ratio needs to be further studied in the field trial with better designed tests.

Supplementary Files

Supplementary File 1

Author Contributions

Methodology and experimental design, S.F. and J.Q.; data curation, J.Q., X.Y., Y.L. and X.S.; data analysis, J.Q. and X.Y.; writing—original draft preparation, J.Q.; writing—review and editing, S.F. and J.Q.; funding acquisition, S.F. and X.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Key Research and Development Program of Jiangsu Province (BE2019388), the National Natural Science Foundation of China (31971642), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) and the Doctorate Fellowship Foundation of Nanjing Forestry University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chung, I.M.; Miller, D.A. Natural herbicide potential of alfalfa residue on selected weed species. Agron. J. 1995, 87, 920–925. [Google Scholar] [CrossRef]
  2. Somova, L.O.; Nadar, A.; Rammanan, P.; Shode, F.O. Cardiovascular, antihyperlipidemic and antioxidant effects of oleanolic and ursolic acids in experimental hypertension. Phytomedicine 2003, 10, 115–121. [Google Scholar] [CrossRef] [PubMed]
  3. Alqahtani, A.; Hamid, K.; Kam, A.; Wong, K.H.; Abdelhak, Z.; Razmovski-Naumovski, V.; Chan, K.; Li, K.M.; Groundwater, P.W.; Li, G.Q. The pentacyclic triterpenoids in herbal medicines and their pharmacological activities in diabetes and diabetic complications. Curr. Med. Chem. 2013, 20, 908–931. [Google Scholar]
  4. Zhou, M.M.; Chen, P.; Lin, Y.; Fang, S.Z.; Shang, X.L. A comprehensive assessment of bioactive metabolites, antioxidant and antiproliferative activities of Cyclocarya paliurus (Batal.) Iljinskaja leaves. Forests 2019, 10, 625. [Google Scholar] [CrossRef] [Green Version]
  5. Pulido, P.; Perello, C.; Rodriguez-Concepcion, M. New insights into plant isoprenoid metabolism. Mol. Plant. 2012, 5, 964–967. [Google Scholar] [CrossRef] [Green Version]
  6. Zhao, Y.; Li, C. Biosynthesis of plant triterpenoid saponins in microbial cell factories. J. Agric. Food Chem. 2018, 66, 12155–12165. [Google Scholar] [CrossRef]
  7. Zhao, C.L.; Cui, X.M.; Chen, Y.P.; Liang, Q. Key enzymes of triterpenoid saponin biosynthesis and the induction of their activities and gene expressions in plants. Nat. Prod. Commun. 2010, 5, 1147–1158. [Google Scholar] [CrossRef] [Green Version]
  8. Fang, S.Z.; Wang, J.Y.; Wei, Z.Y.; Zhu, Z.X. Methods to break seed dormancy in Cyclocarya paliurus (Batal.) Iljinskaja. Sci. Hortic. 2006, 110, 305–309. [Google Scholar] [CrossRef]
  9. Xie, J.H.; Xie, M.Y.; Nie, S.P.; Shen, M.Y.; Wang, Y.X.; Li, C. Isolation, chemical composition and antioxidant activities of a water-soluble polysaccharide from Cyclocarya paliurus (Batal.) Iljinskaja. Food Chem. 2010, 119, 1626–1632. [Google Scholar] [CrossRef]
  10. Fang, S.Z.; Yang, W.X.; Chu, X.L.; Shang, X.L.; She, C.Q.; Fu, X.X. Provenance and temporal variations in selected flavonoids in leaves of Cyclocarya paliurus. Food Chem. 2011, 124, 1382–1386. [Google Scholar] [CrossRef]
  11. Xie, J.H.; Wang, Z.J.; Shen, M.Y.; Nie, S.P.; Xie, M.Y. Sulfated modification, characterization and antioxidant activities of polysaccharide from Cyclocarya paliurus. Food Hydrocolloids. 2016, 53, 7–15. [Google Scholar] [CrossRef]
  12. Liu, Y.; Fang, S.Z.; Zhou, M.M.; Shang, X.L.; Yang, W.X.; Fu, X.X. Geographic variation in water-soluble polysaccharide content and antioxidant activities of Cyclocarya paliurus leaves. Ind. Crop. Prod. 2018, 121, 180–186. [Google Scholar] [CrossRef]
  13. Wu, Z.F.; Meng, F.C.; Cao, L.J.; Jiang, C.H.; Zhao, M.G.; Shang, X.L.; Fang, S.Z.; Ye, W.C.; Zhang, Q.W.; Zhang, J.; et al. Triterpenoids from Cyclocarya paliurus and their inhibitory effect on the secretion of apoliprotein B48 in Caco-2 cells. Phytochemistry 2017, 142, 76–84. [Google Scholar] [CrossRef]
  14. Liu, Y.; Cao, Y.N.; Fang, S.Z.; Wang, T.L.; Yin, Z.Q.; Shang, X.L.; Yang, W.X.; Fu, X.X. Antidiabetic effect of Cyclocarya paliurus leaves depends on the contents of antihyperglycemic flavonoids and antihyperlipidemic triterpenoids. Molecules 2018, 23, 1042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Yang, D.J.; Zhong, Z.C.; Xie, Z.M. Studies on the sweet principles from the leaves of Cyclocarya paliurus (Batal.) Iljinskaya. Acta Pharm Sin. 1992, 27, 841–844. [Google Scholar]
  16. Shu, R.G.; Xu, C.R.; Li, L.N. Studies on the sweet principles from the leaves of Cyclocarya paliurus (Batal.) Iljinsk. Acta Pharm Sin. 1995, 30, 757–761. [Google Scholar]
  17. Guo, S.; Zhou, Y.; Shen, Q.; Zhang, F. Effect of ammonium and nitrate nutrition on some physiological processes in higher plants-growth, photosynthesis, photorespiration, and water relations. Plant Biol. 2007, 9, 21–29. [Google Scholar] [CrossRef]
  18. Tang, Z.H.; Liu, Y.J.; Guo, X.R.; Zu, Y.G. The combined effects of salinity and nitrogen forms on Catharanthus roseus: The role of internal ammonium and free amino acids during salt stress. J. Plant Nutr. Soil Sci. 2011, 174, 135–144. [Google Scholar]
  19. Bowler, J.M.; Press, M.C. Effects of elevated CO2, nitrogen form and concentration on growth and photosynthesis of a fast- and slow-growing grass. New Phytol. 1996, 132, 391–401. [Google Scholar] [CrossRef]
  20. Makino, A.; Mae, T. Photosynthesis and plant growth at elevated levels of CO2. Plant Cell Physiol. 1999, 40, 999–1006. [Google Scholar] [CrossRef]
  21. Moore, B.D.; Cheng, S.H.; Sims, D.; Seemann, J.R. The biochemical and molecular basis for photosynthetic acclimation to elevated atmospheric CO2. Plant Cell Environ. 1999, 22, 567–582. [Google Scholar] [CrossRef]
  22. Chen, W.; Luo, J.K.; Shen, Q.R. Effect of NH4+-N/NO3–-N ratios on growth and some physiological parameters of Chinese cabbage cultivars. Pedosphere 2005, 15, 310–318. [Google Scholar]
  23. Prasad, A.; Mathur, A.; Singh, M.; Gupta, M.M.; Uniyal, G.C.; Lal, R.K.; Mathur, A.K. Growth and asiaticoside production in multiple shoot cultures of a medicinal herb, Centella asiatica (L.) Urban, under the influence of nutrient manipulations. J. Nat. Med. 2012, 66, 383–387. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, J.W.; Tan, R.X. Artemisinin production in Artemisia annua hairy root cultures with improved growth by altering the nitrogen source in the medium. Biotechnol. Lett. 2002, 24, 1153–1156. [Google Scholar] [CrossRef]
  25. Liu, C.Z.; Guo, C.; Wang, Y.C.; Ouyang, F. Factors influencing artemisinin production from shoot cultures of Artemisia annua L. World J. Microbiol. Biotechnol. 2003, 19, 535–538. [Google Scholar] [CrossRef]
  26. Lee, E.J.; Paek, K.Y. Effect of nitrogen source on biomass and bioactive compound production in submerged cultures of Eleutherococcus koreanum Nakai adventitious roots. Biotechnol. Prog. 2012, 28, 508–514. [Google Scholar] [CrossRef]
  27. Zhu, Z.B.; Yu, M.M.; Chen, Y.H.; Guo, Q.S.; Zhang, L.X.; Shi, H.Z.; Liu, L. Effects of ammonium to nitrate ratio on growth, nitrogen metabolism, photosynthetic efficiency and bioactive phytochemical production of Prunella vulgaris. Pharm. Biol. 2014, 52, 1518–1525. [Google Scholar] [CrossRef] [Green Version]
  28. Figura, T.; Weiser, M.; Ponert, J. Orchid seed sensitivity to nitrate reflects habitat preferences and soil nitrate content. Plant Biol. 2020, 22, 21–29. [Google Scholar] [CrossRef]
  29. Liu, M.Y.; Burgos, A.; Zhang, Q.F.; Tang, D.D.; Shi, Y.Z.; Ma, L.F.; Yi, X.Y.; Ruan, J.Y. Analyses of transcriptome profiles and selected metabolites unravel the metabolic response to NH4+ and NO3− as signaling molecules in tea plant (Camellia sinensis L.). Sci. Hortic. 2017, 218, 293–303. [Google Scholar] [CrossRef]
  30. Karray-Bouraoui, N.; Harbaoui, F.; Rabhi, M.; Jallali, I.; Ksouri, R.; Attia, H.; Msilini, N.; Lachaâl, M. Different antioxidant responses to salt stress in two different provenances of Carthamus tinctorius L. Acta Physiol. Plant. 2010, 33, 1435–1444. [Google Scholar] [CrossRef]
  31. Deng, B.; Shang, X.L.; Fang, S.Z.; Li, Q.Q.; Fu, X.X.; Su, J. Integrated effects of light intensity and fertilization on growth and flavonoid accumulation in Cyclocarya paliurus. J. Agric. Food Chem. 2012, 60, 6286–6292. [Google Scholar] [CrossRef] [PubMed]
  32. Cao, Y.N.; Fang, S.Z.; Yin, Z.Q.; Fu, X.X.; Shang, X.L.; Yang, W.X.; Yang, H.M. Chemical fingerprint and multicomponent quantitative analysis for the quality evaluation of Cyclocarya paliurus leaves by HPLC–Q–TOF–MS. Molecules 2017, 22, 1927. [Google Scholar] [CrossRef] [Green Version]
  33. Fan, J.P.; He, C.H. Simultaneous quantification of three major bioactive triterpene acids in the leaves of Diospyros kaki by high-performance liquid chromatography method. J. Pharm. Biomed. Anal. 2006, 41, 950–956. [Google Scholar] [CrossRef] [PubMed]
  34. Chen, X.L.; Mao, X.; Huang, P.; Fang, S.Z. Morphological characterization of flower buds development and related gene expression profiling at bud break stage in heterodichogamous Cyclocarya paliurus (Batal.) lljinskaja. Genes 2019, 10, 818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Faulconnier, Y.; Boby, C.; Pires, J.; Labonne, C.; Lerous, C. Effects of Azgp1(-/-) on mammary gland, adipose tissue and liver gene expression and milk lipid composition in lactating mice. Gene 2019, 692, 201–207. [Google Scholar] [CrossRef] [PubMed]
  36. Britto, D.T.; Kronzucker, H.J. NH4+ toxicity in higher plants: A critical review. J. Plant Physiol. 2002, 159, 567–584. [Google Scholar] [CrossRef] [Green Version]
  37. Hessini, K.; Issaoui, K.; Ferchichi, S.; Abdelly, C.; Siddique, K.H.M.; Cruz, C. Interactive effects of salinity and nitrogen forms on plant growth, photosynthesis and osmotic adjustment in maize. Plant Physiol. Biochem. 2019, 139, 171–178. [Google Scholar] [CrossRef]
  38. Zhang, C.X.; Meng, S.; Li, Y.M.; Su, L.; Zhao, Z. Nitrogen uptake and allocation in Populus simonii in different seasons supplied with isotopically labeled ammonium or nitrate. Trees Struct. Funct. 2016, 30, 2011–2018. [Google Scholar] [CrossRef]
  39. Boschiero, B.N.; Mariano, E.; Azevedo, R.A.; Trivelin, P.C.O. Influence of nitrate-ammonium ratio on the growth, nutrition, and metabolism of sugarcane. Plant Physiol. Biochem. 2019, 139, 246–255. [Google Scholar] [CrossRef]
  40. Ruan, J.; Gerendás, J.; Härdter, R.; Sattelmacher, B. Effect of nitrogen form and root-zone pH on growth and nitrogen uptake of tea (Camellia sinensis) plants. Ann. Bot. 2007, 99, 301–310. [Google Scholar] [CrossRef] [Green Version]
  41. Glibert, P.M.; Wilkerson, F.P.; Dugdale, R.C.; Raven, J.A.; Dupont, C.L.; Leavitt, P.R.; Parker, A.E.; Burkholder, J.M.; Kana, T.M. Pluses and minuses of ammonium and nitrate uptake and assimilation by phytoplankton and implications for productivity and community composition, with emphasis on nitrogen-enriched conditions. Limnol. Oceanogr. 2015, 61, 165–197. [Google Scholar] [CrossRef]
  42. Heuer, B. Growth, photosynthesis and protein content in cucumber plants as affected by supplied nitrogen form. J. Plant Nutr. 1991, 14, 363–373. [Google Scholar] [CrossRef]
  43. Leidi, E.O.; Silberbush, M.; Soares, M.I.M.; Lips, S.H. Salinity and nitrogen nutrition studies on peanut and cotton plants. J. Plant Nutr. 1992, 15, 591–604. [Google Scholar] [CrossRef]
  44. Walch-Liu, P.; Neumann, G.; Bangerth, F.; Engels, C. Rapid effects of nitrogen form on leaf morphogenesis in tobacco. J. Exp. Bot. 2000, 51, 227–237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. He, C.E.; Lu, L.L.; Jin, Y.; Wei, J.H.; Christie, P. Effects of nitrogen on root development and contents of bioactive compounds in Salvia miltiorrhiza Bunge. Crop Sci. 2013, 53, 2028–2039. [Google Scholar] [CrossRef]
  46. Taulavuori, K.; Hyöky, V.; Oksanen, J.; Taulavuori, E.; Julkunen-Tiitto, R. Species-specific differences in synthesis of flavonoids and phenolic acids under increasing periods of enhanced blue light. Environ. Exp. Bot. 2016, 121, 145–150. [Google Scholar] [CrossRef]
  47. Liu, Y.; Fang, S.Z.; Yang, W.X.; Shang, X.L.; Fu, X.X. Light quality affects flavonoid production and related gene expression in Cyclocarya paliurus. J. Photochem. Photobiol. B Biol. 2018, 179, 66–73. [Google Scholar] [CrossRef]
  48. Deng, B.; Li, Y.Y.; Lei, G.; Liu, G.H. Effects of nitrogen availability on mineral nutrient balance and flavonoid accumulation in Cyclocarya paliurus. Plant Physiol. Biochem. 2019, 135, 111–118. [Google Scholar] [CrossRef]
  49. Coley, P.D.; Bryant, J.P.; Chapin, F.S. Resource availability and plant antiherbivore defense. Science 1985, 230, 895–899. [Google Scholar] [CrossRef] [Green Version]
  50. Hakulinen, J.; Julkunen-Tiitto, R.; Tahvanainen, J. Does nitrogen fertilization have an impact on the trade-off between willow growth and defensive secondary metabolism? Trees Struct. Funct. 1995, 9, 235–240. [Google Scholar] [CrossRef]
  51. Stamp, N. Out of the quagmire of plant defense hypotheses. Q. Rev. Biol. 2003, 78, 23–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Stamp, N. Can the growth–differentiation balance hypothesis be tested rigorously? Oikos 2004, 107, 439–448. [Google Scholar] [CrossRef]
  53. Strissel, T.; Halbwirth, H.; Hoyer, U.; Zistler, C.; Stich, K.; Treutter, D. Growth-promoting nitrogen nutrition affects flavonoid biosynthesis in young apple (Malus domestica Borkh.) Leaves. Plant Biol. 2005, 7, 677–685. [Google Scholar] [CrossRef] [PubMed]
  54. Leser, C.; Treutter, D. Effects of nitrogen supply on growth, contents of phenolic compounds and pathogen(scab) resistance of apple trees. Physiol. Plant. 2005, 123, 49–56. [Google Scholar] [CrossRef]
  55. Huang, H.; Yao, Q.; Xia, E.; Gao, L. Metabolomics and transcriptomics analyses reveal nitrogen influences on the accumulation of flavonoids and amino acids in young shoots of tea plant (Camellia sinensis L.) associated with tea flavor. J. Agric. Food Chem. 2018, 66, 9828–9838. [Google Scholar] [CrossRef] [PubMed]
  56. Li, Y.Q.; Kong, D.X.; Fu, Y.; Sussman, M.R.; Wu, H. The effect of developmental and environmental factors on secondary metabolites in medicinal plants. Plant Physiol. Biochem. 2020, 148, 80–89. [Google Scholar] [CrossRef] [PubMed]
  57. Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [Green Version]
  58. Herms, D.A.; Mattson, W.J. The dilemma of plants: To grow or defend. Q. Rev. Biol. 1992, 67, 283–335. [Google Scholar] [CrossRef] [Green Version]
Forests 11 00631 g001 550
Figure 1. Biosynthetic pathway of triterpenoid in higher plants. Abbreviations: AACT: acetyl CoA: acetyl CoA C-acetyltransferase or acetoacetyl-CoA thiolase; CAS: cycloartenol synthase; CMK: 4-(cytidine 5′-diphospho)-2-C-methyl-D-erythritol kinase; DS: dammarenediol synthase; DXPS, i.e., DXS: 1-deoxy-D-xylulose-5-phosphate synthase); DXR1-deoxy-D-xylulose-5-phosphate reductoisomerase; FPPS: farnesyl diphosphate synthase; GPPS: geranyl diphosphate synthase; GT: glycosyltransferases; HDR: 4-hydroxy-3-methyl but-2-(E)-enyl diphosphate reductase; HDS: 4-hydroxy-3-methyl but-2-(E)-enyl diphosphate synthase; HMGR: 3-hydroxy-3-methylglutaryl CoA reductase; HMGS: 3-hydroxy-3-methylglutaryl CoA synthase; IPPI: isopentenyl diphosphate isomerase; LAS: lanosterol synthase; LS, i.e., LUS: lupeol synthase; MCT: 2-C-methyl-D-erythritol 4-phosphate cytidylyl transferase or 4-(cytidine 5′-diphospho)-2-C-methyl-D-erythritol synthase; MDC: mevalonate-5-pyrophosphate decarboxylase; MECPS: 2-C-methyl-D-erythritol-2, 4-cyclodiphosphate synthase; MK: mevalonate kinase; OSCs: 2, 3-oxidosqualene cyclases; PDMO: cytochrome P 450 -dependent monooxygenases; PMK: phosphomevalonate kinase; SE: squalene epoxidase; SS: squalene synthase; β-AS: β-amyrin synthase (quoted from Zhao et al. [7]).
Figure 1. Biosynthetic pathway of triterpenoid in higher plants. Abbreviations: AACT: acetyl CoA: acetyl CoA C-acetyltransferase or acetoacetyl-CoA thiolase; CAS: cycloartenol synthase; CMK: 4-(cytidine 5′-diphospho)-2-C-methyl-D-erythritol kinase; DS: dammarenediol synthase; DXPS, i.e., DXS: 1-deoxy-D-xylulose-5-phosphate synthase); DXR1-deoxy-D-xylulose-5-phosphate reductoisomerase; FPPS: farnesyl diphosphate synthase; GPPS: geranyl diphosphate synthase; GT: glycosyltransferases; HDR: 4-hydroxy-3-methyl but-2-(E)-enyl diphosphate reductase; HDS: 4-hydroxy-3-methyl but-2-(E)-enyl diphosphate synthase; HMGR: 3-hydroxy-3-methylglutaryl CoA reductase; HMGS: 3-hydroxy-3-methylglutaryl CoA synthase; IPPI: isopentenyl diphosphate isomerase; LAS: lanosterol synthase; LS, i.e., LUS: lupeol synthase; MCT: 2-C-methyl-D-erythritol 4-phosphate cytidylyl transferase or 4-(cytidine 5′-diphospho)-2-C-methyl-D-erythritol synthase; MDC: mevalonate-5-pyrophosphate decarboxylase; MECPS: 2-C-methyl-D-erythritol-2, 4-cyclodiphosphate synthase; MK: mevalonate kinase; OSCs: 2, 3-oxidosqualene cyclases; PDMO: cytochrome P 450 -dependent monooxygenases; PMK: phosphomevalonate kinase; SE: squalene epoxidase; SS: squalene synthase; β-AS: β-amyrin synthase (quoted from Zhao et al. [7]).
Forests 11 00631 g001
Forests 11 00631 g002 550
Figure 2. Effects of NO3−/NH4+ ratio on biomass in different components of Cyclocarya paliurus (Batalin) Iljinsk. seedlings sampled at 30, 60 and 90 days after treatments. Different capital letters indicate significant differences among different NO3−/NH4+ ratio treatment for the same sampling time according to Tukey’s test (p < 0.05). Different small letters indicate significant differences among different sampling time for the same NO3−/NH4+ ratio treatment according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Figure 2. Effects of NO3−/NH4+ ratio on biomass in different components of Cyclocarya paliurus (Batalin) Iljinsk. seedlings sampled at 30, 60 and 90 days after treatments. Different capital letters indicate significant differences among different NO3−/NH4+ ratio treatment for the same sampling time according to Tukey’s test (p < 0.05). Different small letters indicate significant differences among different sampling time for the same NO3−/NH4+ ratio treatment according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Forests 11 00631 g002
Forests 11 00631 g003 550
Figure 3. Ratios of root to shoot (including leaf and stem) biomass among the different treatments of nitrogen forms at various sampling times. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same sampling time according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Figure 3. Ratios of root to shoot (including leaf and stem) biomass among the different treatments of nitrogen forms at various sampling times. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same sampling time according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Forests 11 00631 g003
Forests 11 00631 g004 550
Figure 4. Effects of NO3−/NH4+ ratio on the contents of total triterpenoid and five individual triterpenoids in different components of C. paliurus seedlings sampled at 30, 60 and 90 days after the treatments. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same category according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Figure 4. Effects of NO3−/NH4+ ratio on the contents of total triterpenoid and five individual triterpenoids in different components of C. paliurus seedlings sampled at 30, 60 and 90 days after the treatments. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same category according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Forests 11 00631 g004
Forests 11 00631 g005 550
Figure 5. Effects of NO3−/NH4+− ratio on the accumulations of total triterpenoid and five individual triterpenoids in leaves and whole plants of C. paliurus seedlings sampled at 30, 60 and 90 days after the treatments. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same category according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Figure 5. Effects of NO3−/NH4+− ratio on the accumulations of total triterpenoid and five individual triterpenoids in leaves and whole plants of C. paliurus seedlings sampled at 30, 60 and 90 days after the treatments. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same category according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Forests 11 00631 g005
Forests 11 00631 g006 550
Figure 6. Effects of NO3−/NH4+ ratio on relative gene expression of HMGR (A), DXR (B), GPS (C), SQS (D), β-AS (F) and UDP (E) in C. paliurus leaves sampled at 30, 60 and 90 days after treatments. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same sampling time according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Figure 6. Effects of NO3−/NH4+ ratio on relative gene expression of HMGR (A), DXR (B), GPS (C), SQS (D), β-AS (F) and UDP (E) in C. paliurus leaves sampled at 30, 60 and 90 days after treatments. Different letters indicate significant differences among different NO3−/NH4+ ratio treatments for the same sampling time according to Tukey’s test (p < 0.05). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Forests 11 00631 g006
Forests 11 00631 g007 550
Figure 7. Relationships of total triterpenoid content in the leaves (yTTC), total leaf triterpenoid accumulation (yTTY) and leaf biomass (yLB) per plant to nitrogen forms at the concentration of 238 mg/L (x) across the sampling times (n = 39). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Figure 7. Relationships of total triterpenoid content in the leaves (yTTC), total leaf triterpenoid accumulation (yTTY) and leaf biomass (yLB) per plant to nitrogen forms at the concentration of 238 mg/L (x) across the sampling times (n = 39). All C. paliurus seedlings had died at 52 days after the treatment in T5.
Forests 11 00631 g007
Table
Table 1. Primers used in quantitative real-time polymerase chain reaction (qRT-PCR) in this study.
Table 1. Primers used in quantitative real-time polymerase chain reaction (qRT-PCR) in this study.
Gene NameSequence of Primer (5′-3′)
HMGR-FTTTAGCGATGGACATGAGCA
HMGR-RGGAGTGGCAGAGCGTCAGAGGC
DXR-FGCTGGTTCAATGTAACTCTTC
DXR-RCTCTATGACTCCTTGCTCCC
GPS-FGAGCGAAGTTATTCCTGGTG
GPS-RGTGTAAATGGGAGATGAACG
SQS-FGAACAGGCTGGATGCGATAC
SQS-RTCAATTATTTGGTCGTTTGG
β-AS-FTGGTTCATGGTTTGCACTTGGAG
β-AS-RCTCTCTCAGCCTGTCCAGCATGA
UDP-FTCTACTATCACCTCGACCTCCT
UDP-RTTTTTACATCCTGAAATGCCTT
18s-FAGTATGGTCGCAAGGCTGAAA
18s-RCAGACAAATCGCTCCACCAA
Table
Table 2. Pearson correlation coefficients (r value) between triterpenoid content and gene expression in the leaves across the nitrogen treatment periods (n = 39).
Table 2. Pearson correlation coefficients (r value) between triterpenoid content and gene expression in the leaves across the nitrogen treatment periods (n = 39).
Gene ExpressionTotal TriterpenoidArjunolic AcidCyclocaric Acid BPterocaryoside AHederageninOleanolic Acid
HMGR0.50 **0.69 **0.91 **0.57 **0.53 **0.68 **
DXR0.61 **0.76 **0.78 **0.79 **0.77 **0.78 **
GPS0.43 **0.54 **0.81 **0.44 **0.41 **0.58 **
SQS0.73 **0.80 **0.87 **0.73 **0.71 **0.81 **
β-AS0.71 **0.74 **0.64 **0.82 **0.81 **0.77 **
UDP0.50 **0.69 **0.91 **0.57 **0.53 **0.68 **
** indicate correlation is significant at the 0.01 level.

Share and Cite

MDPI and ACS Style

Qin, J.; Yue, X.; Shang, X.; Fang, S. Nitrogen Forms Alter Triterpenoid Accumulation and Related Gene Expression in Cyclocarya paliurus (Batalin) Iljinsk. Seedlings. Forests 2020, 11, 631. https://doi.org/10.3390/f11060631

AMA Style

Qin J, Yue X, Shang X, Fang S. Nitrogen Forms Alter Triterpenoid Accumulation and Related Gene Expression in Cyclocarya paliurus (Batalin) Iljinsk. Seedlings. Forests. 2020; 11(6):631. https://doi.org/10.3390/f11060631

Chicago/Turabian Style

Qin, Jian, Xiliang Yue, Xulan Shang, and Shengzuo Fang. 2020. "Nitrogen Forms Alter Triterpenoid Accumulation and Related Gene Expression in Cyclocarya paliurus (Batalin) Iljinsk. Seedlings" Forests 11, no. 6: 631. https://doi.org/10.3390/f11060631

APA Style

Qin, J., Yue, X., Shang, X., & Fang, S. (2020). Nitrogen Forms Alter Triterpenoid Accumulation and Related Gene Expression in Cyclocarya paliurus (Batalin) Iljinsk. Seedlings. Forests, 11(6), 631. https://doi.org/10.3390/f11060631

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop