In Vivo Study of Organ and Tissue Stability According to the Types of Bioresorbable Bone Screws
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials Preparation
2.2. Animals and Surgery
2.3. Serum Assay of Biochemical Parameter
2.4. Assessment of Bone Microstructure Using Micro-Computed Tomography
2.5. Immunoblotting and Real-Time PCR Analysis
2.6. Hematoxylin and Eosin Staining
2.7. Statistical Analysis
3. Results
3.1. Systemic Toxicity Evaluation
3.2. Micro-CT Evaluation
3.3. Analysis of Protein and Gene Expression
3.4. Histologic Analysis for the Surrounding Bone Tissue by H and E Staining
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Navarro, M.; Michiardi, A.; Castano, O.; Planell, J. Biomaterials in orthopaedics. J. R. Soc. Interface 2008, 5, 1137–1158. [Google Scholar] [CrossRef] [PubMed]
- Uhthoff, H.K.; Poitras, P.; Backman, D.S. Internal plate fixation of fractures: Short history and recent developments. J. Orthop. Sci. 2006, 11, 118–126. [Google Scholar] [CrossRef]
- Nair, L.S.; Laurencin, C.T. Biodegradable polymers as biomaterials. Prog. Polym. Sci. 2007, 32, 762–798. [Google Scholar] [CrossRef]
- Wang, N.; Ma, Y.; Shi, H.; Song, Y.; Guo, S.; Yang, S. Mg-, Zn-, and Fe-Based Alloys with Antibacterial Properties as Orthopedic Implant Materials. Front. Bioeng. Biotechnol. 2022, 10, 888084. [Google Scholar] [CrossRef]
- Li, G.; Zhao, M.; Xu, F.; Yang, B.; Li, X.; Meng, X.; Teng, L.; Sun, F.; Li, Y. Synthesis and Biological Application of Polylactic Acid. Molecules 2020, 25, 5023. [Google Scholar] [CrossRef]
- Kawamura, N.; Nakao, Y.; Ishikawa, R.; Tsuchida, D.; Iijima, M. Degradation and Biocompatibility of AZ31 Magnesium Alloy Implants In Vitro and In Vivo: A Micro-Computed Tomography Study in Rats. Materials 2020, 13, 473. [Google Scholar] [CrossRef]
- Ballerini, G.; Bardi, U.; Bignucolo, R.; Ceraolo, G. About some corrosion mechanisms of AZ91D magnesium alloy. Corros. Sci. 2005, 47, 2173–2184. [Google Scholar] [CrossRef]
- Kim, Y.K.; Park, I.S.; Lee, S.J.; Lee, M.H. Biodegradation and cytotoxic properties of pulse anodized Mg alloys. Met. Mater. Int. 2013, 19, 353–360. [Google Scholar] [CrossRef]
- Shaw, B.A. Corrosion resistance of magnesium alloys. In ASM Handbook; Pennsylvania State University: University Park, PA, USA, 2003; pp. 692–696. [Google Scholar]
- Adetunla, A.; Fide-Akwuobi, A.; Benjamin, H.; Adeyinka, A.; Kolawole, A. A study of degradable orthopedic implant: An insight in magnesium metal matrix composites. Heliyon 2022, 8, e10503. [Google Scholar] [CrossRef] [PubMed]
- Fayzullin, A.; Churbanov, S.; Ignatieva, N.; Zakharkina, O.; Tokarev, M.; Mudryak, D.; Khristidis, Y.; Balyasin, M.; Kurkov, A.; Golubeva, E.N.; et al. Local Delivery of Pirfenidone by PLA Implants Modifies Foreign Body Reaction and Prevents Fibrosis. Biomedicines 2021, 9, 853. [Google Scholar] [CrossRef]
- Pérez Davila, S.; González Rodríguez, L.; Chiussi, S.; Serra, J.; González, P. How to Sterilize Polylactic Acid Based Medical Devices? Polymers 2021, 13, 2115. [Google Scholar] [CrossRef] [PubMed]
- Rutala, W.A.; Weber, D.J. Infection control: The role of disinfection and sterilization. J. Hosp. Infect. 1999, 43, S43–S55. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.-K.; Lee, G.-H.; Bhattarai, K.R.; Junjappa, R.P.; Lee, H.-Y.; Handigund, M.; Marahatta, A.; Bhandary, B.; Baek, I.-H.; Pyo, J.S. PI3Kδ contributes to ER stress-associated asthma through ER-redox disturbances: The involvement of the RIDD–RIG-I–NF-κB axis. Exp. Mol. Med. 2018, 50, e444. [Google Scholar] [CrossRef]
- Liu, Z.; Yao, X.; Jiang, W.; Zhou, Z.; Yang, M. Sodium butyrate enhances titanium nail osseointegration in ovariectomized rats by inhibiting the PKCα/NOX4/ROS/NF-κB pathways. J. Orthop. Surg. Res. 2023, 18, 556. [Google Scholar] [CrossRef]
- Chagnon, M.; Guy, L.-G.; Jackson, N. Evaluation of magnesium-based medical devices in preclinical studies: Challenges and points to consider. Toxicol. Pathol. 2019, 47, 390–400. [Google Scholar] [CrossRef]
- Kamata, M.; Sakamoto, Y.; Kishi, K. Foreign-body reaction to bioabsorbable plate and screw in craniofacial surgery. J. Craniofacial Surg. 2019, 30, e34–e36. [Google Scholar] [CrossRef]
- Gerlach, K.; Eitenmuller, J. Biomaterials and Clinical Applications; Elsevier: Amsterdam, The Netherlands, 1987. [Google Scholar]
- Lee, B.Y.; Park, J.Y.; Kim, Y.C. Effect of polycarbonate structure and reduction time on graphene oxide dispersion. Polym. Adv. Technol. 2015, 26, 1241–1246. [Google Scholar] [CrossRef]
- Chen, J.; Du, Y.; Que, W.; Xing, Y.; Chen, X.; Lei, B. Crack-free polydimethylsiloxane–bioactive glass–poly (ethylene glycol) hybrid monoliths with controlled biomineralization activity and mechanical property for bone tissue regeneration. Colloids Surf. B Biointerfaces 2015, 136, 126–133. [Google Scholar] [CrossRef]
- Laughlin, R.M.; Block, M.S.; Wilk, R.; Malloy, R.B.; Kent, J.N. Resorbable plates for the fixation of mandibular fractures: A prospective study. J. Oral Maxillofac. Surg. 2007, 65, 89–96. [Google Scholar] [CrossRef]
- Shikinami, Y.; Matsusue, Y.; Nakamura, T. The complete process of bioresorption and bone replacement using devices made of forged composites of raw hydroxyapatite particles/poly l-lactide (Fu-HA/PLLA). Biomaterials 2005, 26, 5542–5551. [Google Scholar] [CrossRef]
- Feng, P.; Jia, J.; Liu, M.; Peng, S.; Zhao, Z.; Shuai, C. Degradation mechanisms and acceleration strategies of poly (lactic acid) scaffold for bone regeneration. Mater. Des. 2021, 210, 110066. [Google Scholar] [CrossRef]
- Godard, H.P. The Corrosion of Light Metals; John Wiley & Sons: Hoboken, NJ, USA, 1967. [Google Scholar]
- Song, G.; Atrens, A.; Stjohn, D.; Nairn, J.; Li, Y. The electrochemical corrosion of pure magnesium in 1 N NaCl. Corros. Sci. 1997, 39, 855–875. [Google Scholar] [CrossRef]
- Okutan, B.; Schwarze, U.Y.; Berger, L.; Martinez, D.C.; Herber, V.; Suljevic, O.; Plocinski, T.; Swieszkowski, W.; Santos, S.G.; Schindl, R. The combined effect of zinc and calcium on the biodegradation of ultrahigh-purity magnesium implants. Biomater. Adv. 2023, 146, 213287. [Google Scholar] [CrossRef] [PubMed]
- Chou, D.T.; Hong, D.; Oksuz, S.; Schweizer, R.; Roy, A.; Lee, B.; Shridhar, P.; Gorantla, V.; Kumta, P.N. Corrosion and bone healing of Mg-Y-Zn-Zr-Ca alloy implants: Comparative in vivo study in a non-immobilized rat femoral fracture model. J. Biomater. Appl. 2019, 33, 1178–1194. [Google Scholar] [CrossRef] [PubMed]
- Shunmugasamy, V.C.; Abdel Gawad, M.; Sohail, M.U.; Ibrahim, T.; Khan, T.; Seers, T.D.; Mansoor, B. In vitro and in vivo study on fine-grained Mg-Zn-RE-Zr alloy as a biodegradeable orthopedic implant produced by friction stir processing. Bioact. Mater. 2023, 28, 448–466. [Google Scholar] [CrossRef]
- Kim, Y.K.; Kim, S.Y.; Lee, S.H.; Lee, M.H.; Lee, K.B. Stabilized Loading of Hyaluronic Acid-Containing Hydrogels into Magnesium-Based Cannulated Screws. ACS Biomater. Sci. Eng. 2020, 6, 715–726. [Google Scholar] [CrossRef]
- Hohlinger, M.; Christa, D.; Zimmermann, V.; Heise, S.; Boccaccini, A.R.; Virtanen, S. Influence of proteins on the corrosion behavior of a chitosan-bioactive glass coated magnesium alloy. Mater. Sci. Eng. C Mater. Biol. Appl. 2019, 100, 706–714. [Google Scholar] [CrossRef]
- Tran, N.T.; Kim, Y.K.; Kim, S.Y.; Lee, M.H.; Lee, K.B. Comparative Osteogenesis and Degradation Behavior of Magnesium Implant in Epiphysis and Diaphysis of the Long Bone in the Rat Model. Materials 2022, 15, 5630. [Google Scholar] [CrossRef]
- Wang, Y.; Liang, W.; Liu, X.; Li, Q.; Xie, Y.; Jiang, Y. Osteogenesis and degradation behavior of magnesium alloy plate in vivo. Eur. J. Inflamm. 2021, 19, 20587392211034078. [Google Scholar] [CrossRef]
- Kim, Y.K.; Lee, K.B.; Kim, S.Y.; Bode, K.; Jang, Y.S.; Kwon, T.Y.; Jeon, M.H.; Lee, M.H. Gas formation and biological effects of biodegradable magnesium in a preclinical and clinical observation. Sci. Technol. Adv. Mater. 2018, 19, 324–335. [Google Scholar] [CrossRef]
- Noviana, D.; Paramitha, D.; Ulum, M.F.; Hermawan, H. The effect of hydrogen gas evolution of magnesium implant on the postimplantation mortality of rats. J. Orthop. Transl. 2016, 5, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Schaller, B.; Burkhard, J.P.M.; Chagnon, M.; Beck, S.; Imwinkelried, T.; Assad, M. Fracture healing and bone remodeling with human standard-sized magnesium versus polylactide–Co-glycolide plate and screw systems using a mini-swine craniomaxillofacial osteotomy fixation model. J. Oral Maxillofac. Surg. 2018, 76, 2138–2150. [Google Scholar] [CrossRef]
- Eppley, B.; Prevel, C.; Sadove, A.; Sarver, D. Resorbable bone fixation: Its potential role in cranio-maxillofacial trauma. J. Cranio-Maxillofac. Trauma 1996, 2, 56–60. [Google Scholar]
- Suuronen, R.; Lindqvist, C. Bioresorbable materials for bone fixation: Review of biological concepts and mechanical aspects. In Craniomaxillofacial Reconstructive and Corrective Bone Surgery: Principles of Internal Fixation Using the AO/ASIF Technique; Springer: New York, NY, USA, 2002; pp. 113–123. [Google Scholar]
- Chen, Y.; Xu, Z.; Smith, C.; Sankar, J. Recent advances on the development of magnesium alloys for biodegradable implants. Acta Biomater. 2014, 10, 4561–4573. [Google Scholar] [CrossRef] [PubMed]
- Zwawi, M. Recent advances in bio-medical implants; mechanical properties, surface modifications and applications. Eng. Res. Express 2022, 4, 032003. [Google Scholar] [CrossRef]
- Teo, A.J.T.; Mishra, A.; Park, I.; Kim, Y.J.; Park, W.T.; Yoon, Y.J. Polymeric Biomaterials for Medical Implants and Devices. ACS Biomater. Sci. Eng. 2016, 2, 454–472. [Google Scholar] [CrossRef]
- Nieminen, T.; Rantala, I.; Hiidenheimo, I.; Keränen, J.; Kainulainen, H.; Wuolijoki, E.; Kallela, I. Degradative and mechanical properties of a novel resorbable plating system during a 3-year follow-up in vivo and in vitro. J. Mater. Sci. Mater. Med. 2008, 19, 1155–1163. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
TNF-α | CAGGGGCCACCACGCTCTTC | CTTGGGGCAGGGGCTCTTGA |
IL-6 | AGGGCATGTTAAGGAGC | CATCAGAGGCAAGGAGGA |
IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGT CCGTCAACT |
β-actin | TTCAACACCCCAGCCATGT | CAGTGGTACGACCAGAGGCATA |
Group | Implantation Time | Body Weight (g) | Kidney Weight (g) | Liver Weight (g) | LDH (U/L) | Creatine (mg/dl) | ALT (U/L) | AST (U/L) |
---|---|---|---|---|---|---|---|---|
Sham | 1 week | 251.3 ± 16.1 | 3.13 ± 0.22 | 14.92 ± 0.79 | 742.2 ± 180.58 | 0.37 ± 0.04 | 21.8 ± 5.23 | 51.9 ± 5.71 |
2 weeks | 265.5 ± 12.2 | 2.43 ± 0.17 | 12.52 ± 0.45 | 996.00 ± 112.59 | 0.53 ± 0.03 | 38.08 ± 5.98 | 73.64 ± 11.34 | |
4 weeks | 265.1 ± 13.1 | 2.74 ± 0.12 | 14.42 ± 2.12 | 764.40 ± 229.34 | 0.46 ± 0.05 | 34.86 ± 7.71 | 60.92 ± 7.37 | |
8 weeks | 269.4 ± 18.8 | 3.32 ± 0.35 | 18.03 ± 2.11 | 1632.40 ± 274.03 | 0.48 ± 0.03 | 26.54 ± 5.27 | 81.10 ± 10.17 | |
Magnesium Alloy | 1 week | 252.2 ± 2.5 | 3.23 ± 0.28 | 13.97 ± 1.23 | 709.80 ± 69.35 | 0.41 ± 0.04 | 21.00 ± 2.18 | 61.04 ± 4.41 |
2 weeks | 252.1 ± 1.4 | 2.56 ± 0.23 | 12.48 ± 1.87 | 1061.40 ± 194.65 | 0.61 ± 0.03 | 42.00 ± 8.00 | 83.08 ± 14.79 | |
4 weeks | 251.1 ± 8.2 | 2.64 ± 0.22 | 12.69 ± 1.43 | 286.20 ± 175.76 | 0.44 ± 0.05 | 27.70 ± 5.15 | 47.68 ± 9.19 | |
8 weeks | 250.1 ± 8.4 | 3.39 ± 0.79 | 18.48 ± 3.98 | 1707.80 ± 672.28 | 0.53 ± 0.03 | 27.38 ± 3.24 | 87.44 ± 16.51 | |
Polylactide | 1 week | 246.7 ± 6.1 | 3.17 ± 0.35 | 14.11 ± 1.68 | 1107.80 ± 177.48 | 0.40 ± 0.03 | 21.70 ± 1.83 | 70.94 ± 12.11 |
2 weeks | 244.5 ± 8.9 | 2.56 ± 0.15 | 12.95 ± 1.05 | 902.80 ± 104.98 | 0.53 ± 0.05 | 35.50 ± 5.48 | 69.04 ± 5.87 | |
4 weeks | 245.9 ± 16.2 | 2.54 ± 0.18 | 11.80 ± 0.69 | 165.75 ± 46.76 | 0.45 ± 0.05 | 31.10 ± 8.87 | 44.20 ± 8.63 | |
8 weeks | 244.5 ± 11.3 | 3.45 ± 0.23 | 16.60 ± 0.99 | 1010.60 ± 333.49 | 0.51 ± 0.06 | 25.62 ± 4.36 | 66.14 ± 14.52 | |
Ti | 1 week | 259.7 ± 6.3 | 2.93 ± 0.14 | 14.00 ± 0.65 | 403.40 ± 150.95 | 0.39 ± 0.04 | 17.68 ± 2.07 | 45.82 ± 6.40 |
2 weeks | 259.9 ± 6.1 | 2.60 ± 0.22 | 14.73 ± 1.97 | 713.20 ± 278.45 | 0.64 ± 0.03 | 37.38 ± 2.69 | 68.58 ± 10.63 | |
4 weeks | 265.1 ± 11.3 | 2.66 ± 0.47 | 13.23 ± 0.51 | 771.20 ± 207.11 | 0.46 ± 0.05 | 34.70 ± 12.18 | 58.32 ± 11.99 | |
8 weeks | 262.9 ± 6.7 | 3.25 ± 0.45 | 17.13 ± 1.39 | 1010.60 ± 333.49 | 0.43 ± 0.02 | 20.42 ± 1.47 | 67.54 ± 10.45 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kwon, T.-Y.; Lee, G.-H.; Lee, H.; Lee, K.-B. In Vivo Study of Organ and Tissue Stability According to the Types of Bioresorbable Bone Screws. Materials 2024, 17, 5632. https://doi.org/10.3390/ma17225632
Kwon T-Y, Lee G-H, Lee H, Lee K-B. In Vivo Study of Organ and Tissue Stability According to the Types of Bioresorbable Bone Screws. Materials. 2024; 17(22):5632. https://doi.org/10.3390/ma17225632
Chicago/Turabian StyleKwon, Tae-Young, Geum-Hwa Lee, Hyuk Lee, and Kwang-Bok Lee. 2024. "In Vivo Study of Organ and Tissue Stability According to the Types of Bioresorbable Bone Screws" Materials 17, no. 22: 5632. https://doi.org/10.3390/ma17225632
APA StyleKwon, T.-Y., Lee, G.-H., Lee, H., & Lee, K.-B. (2024). In Vivo Study of Organ and Tissue Stability According to the Types of Bioresorbable Bone Screws. Materials, 17(22), 5632. https://doi.org/10.3390/ma17225632