Tetracalcium Phosphate/Monetite/Calcium Sulfate Hemihdrate Biocement Powder Mixtures Prepared by the One-Step Synthesis for Preparation of Nanocrystalline Hydroxyapatite Biocement-Properties and In Vitro Evaluation
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Powder Cement Mixtures, Pastes and Cement Samples
2.2. XRD Phase Analysis, Chemical Composition and Microstructure of Cements
2.3. Soaking Cements—pH Measurement, Release of Ca and Phosphates from Cements
2.4. Measurement of Compressive Strength, Setting Time and Porosity
2.5. Preparation of Cell Extracts and In Vitro Cytotoxicity Testing of Extracts
2.6. Gene Expression and SDS PAGE Analysis of Specific Markers
3. Results and Discussion
3.1. XRD and FTIR Analysis of Powder Mixtures and Cements
↓
CaHPO4 + Ca4(PO4)2O (excess in cement) → Ca5(PO4)3OH (soaking) + dissolution of CSH or CSD
3.2. Evaluation of Cement Microstructures—SEM and TEM Analysis
3.3. Analysis of Setting Process—Release of Ions, pH Changes, Setting Time and Compressive Strength
3.4. In Vitro Testing—Evaluation of Cytotoxicity Cement Extracts, Gene Expression of Specific Markers
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Friedman, C.D.; Costantino, P.D.; Takagi, S.; Chow, L.C. Bonesource hydroxyapatite cement: A novel biomaterial for craniofacial skeletal tissue engineering and reconstruction. J. Biomed. Mater. Res. 1998, 43, 428–432. [Google Scholar] [CrossRef] [Scilit]
- Bohner, M.; Gbureck, U.; Barralet, J.E. Technological issues for the development of more efficient calcium phosphate bone cements: A critical assessment. Biomaterials 2005, 26, 6423–6429. [Google Scholar] [CrossRef] [Scilit]
- Burguera, E.F.; Guitian, F.; Chow, L.C. A water setting tetracalcium phosphate–dicalciumphosphate dihydrate cement. J. Biomed. Mater. Res. A. 2004, 71, 275–282. [Google Scholar] [CrossRef] [Scilit]
- Hirayama, S.; Takagi, S.; Markovic, M.; Chow, L.C. Properties of calcium phosphate cements with different tetracalcium phosphate and dicalcium phosphate anhydrous molar ratios. J. Res. Natl. Inst. Stand. Technol. 2008, 113, 311–320. [Google Scholar] [CrossRef] [Scilit]
- Guo, H.; Su, J.; Wei, J.; Kong, H.; Liu, C. Biocompatibility and osteogenicity of degradable Ca-deficient hydroxyapatite scaffolds from calcium phosphate cement for bone tissue engineering. Acta Biomater. 2009, 5, 268–278. [Google Scholar] [CrossRef] [Scilit]
- Lee, K.; Weir, M.D.; Lippens, E.; Mehta, M.; Wang, P.; Duda, G.N.; Kim, W.S.; Mooney, D.J.; Xu, H.H. Bone regeneration via novel macroporous CPC scaffolds in critical-sized cranial defects in rats. Dent Mater. 2014, 30, 199–207. [Google Scholar] [CrossRef] [Scilit]
- Mills, D.K. The Role of Polymer Additives in Enhancing the Response of Calcium Phosphate Cement, 1st ed.; Springer International Publishing: Cham, Switzerland, 2018; pp. 345–379. [Google Scholar]
- Xu, H.H.; Wang, P.; Wang, L.; Bao, C.; Chen, Q.; Weir, M.D.; Chow, L.C.; Zhao, L.; Zhou, X.; Reynolds, M.A. Calcium phosphate cements for bone engineering and their biological properties. Bone Res. 2017, 5, 17056. [Google Scholar] [CrossRef] [Scilit]
- Medvecky, L.; Giretova, M.; Stulajterova, R.; Danko, J.; Vdoviakova, K.; Kresakova, L.; Zert, Z.; Petrovova, E.; Holovska, K.; Varga, M.; et al. Characterization of Properties, In Vitro and In Vivo Evaluation of Calcium Phosphate/Amino Acid Cements for Treatment of Osteochondral Defects. Materials 2021, 14, 436. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Thein-Han, W.; Weir, M.D.; Chen, O.; Xu, H.H.K. Prevascularization of biofunctional calciumphosphate cement for dental and craniofacial repairs. Dent. Mater. 2014, 30, 535–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Liao, J.; Li, Y.; Yang, Z.; Ying, O.; Xie, Y.; Zhou, A. Bioactive tetracalcium phosphate/magnesium phosphate composite bone cement for bone repair. J. Biomater. Appl. 2019, 34, 239–249. [Google Scholar] [CrossRef] [Scilit]
- Radha, G.; Venkatesan, B.; Jaisankar, S.N.; Rajashree, P.; Balakumar, S. Interplay between surface chemistry and osteogenic behaviour of sulphate substituted nano-hydroxyapatite. Mater. Sci. Eng. C 2021, 120, 111617. [Google Scholar]
- Civinini, R.; Capone1, A.; Carulli, C.; Matassi, F.; Nistri, L.; Innocenti, M. The kinetics of remodeling of a calcium sulfate/calcium phosphate bioceramic. J. Mater. Sci. Mater. Med. 2017, 28, 137. [Google Scholar] [CrossRef] [Scilit]
- Woo, K.M.; Yu, B.; Jung, H.M.; Lee, Y.K. Comparative evaluation of different crystal-structured calcium sulfates as bone-filling materials. J. Biomed. Mater. Res. B. Appl. Biomater. 2009, 91, 545–554. [Google Scholar] [CrossRef] [PubMed]
- Lodoso-Torrecilla, I.; van den Beucken, J.J.J.P.; Jansen, J.A. Calcium phosphate cements: Optimization toward biodegradability. Acta Biomater. 2021, 119, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, B.C.; Lee, J.W.; Ju, C.P.; Chern Lin, J.H. Physical/Chemical Properties and Resorption Behavior of a Newly Developed Ca/P/S-Based Bone Substitute Material. Materials 2020, 13, 3458. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.S.; Tägil, M.; Isaksson, H.; Boström, M.; Lidgren, L. Tissue reaction and material biodegradation of a calcium sulfate/apatite biphasic bone substitute in rat muscle. J. Orthop. Translat. 2015, 6, 10–17. [Google Scholar] [CrossRef] [Scilit]
- Goldberg, M.A.; Fomin, A.S.; Petrakova, N.V.; Fedotov, A.Y.; Shvorneva, L.I.; Smirnov, V.V.; Popova, A.V.; Barinov, S.M. Gypsum transformation to calcium phosphates. Doklady Akademii Nauk. 2012, 444, 275–278. [Google Scholar] [CrossRef] [Scilit]
- Bohner, M.; Merkle, H.P.; Landuyt, P.V.; Trophardy, G.; Lemaitre, J. Effect of several additives and their admixtures on the physico-chemical properties of a calcium phosphate cement. J. Mater. Sci. Mater. Med. 2000, 11, 111–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, H.; Wei, J.; Liu, C.S. Development of a degradable cement of calcium phosphate and calcium sulfate composite for bone reconstruction. Biomed. Mater. 2006, 1, 193–197. [Google Scholar] [CrossRef] [Scilit]
- Hu, G.; Xiao, L.; Fu, H.; Bi, D.; Ma, H.; Tong, P. Study on injectable and degradable cement of calcium sulphate and calcium phosphate for bone repair. J. Mater. Sci. Mater. Med. 2010, 21, 627–634. [Google Scholar] [CrossRef] [Scilit]
- Lin, J.H.C.; Hung, S.H.; Chen, W.L.; Chen, C.K.; Lee, J.W.; Lin, R.M.; Ju, C.P. Properties of TTCP/DCPA/CSH Cement Immersed in Hanks’ Solution. J. Med. Biol. Eng. 2012, 32, 201–204. [Google Scholar] [CrossRef]
- Smirnov, V.V.; Goldberg, M.A.; Khairutdinova, D.R.; Antonova, O.S.; Smirnov, S.V.; Konovalov, A.A.; Barinov, S.M. Synthesis and properties of bone cement materials in the calcium phosphate–calcium sulfate system. Neorg. Mater. 2017, 53, 1099–1104. [Google Scholar] [CrossRef] [Scilit]
- Greish, Z.E. Phase evolution during the low temperature formation of calcium-deficient hydroxyapatite–gypsum composites. Ceram. Int. 2011, 37, 1493–1500. [Google Scholar] [CrossRef] [Scilit]
- Fernandez, E.; Vlad, M.D.; Gel, M.M.; Lopez, J.; Torres, R.; Juan, V.; Cauich, J.V.; Bohner, M. Modulation of porosity in apatitic cements by the use of a-tricalcium phosphate—calcium sulphate dihydrate mixtures. Biomaterials 2005, 26, 3395–3404. [Google Scholar] [CrossRef] [Scilit]
- Tas, C. Synthesis of biomimetic Ca-hydroxyapatite powders at 37 degrees C in synthetic body fluids. Biomaterials 2000, 21, 1429–1438. [Google Scholar]
- ISO. Standard 1566-Dental Zinc Phosphate Cement; International Organization for Standardization: Geneva, Switzerland, 1978. [Google Scholar]
- Giretova, M.; Medvecky, L.; Petrovova, E.; Cizkova, D.; Danko, J.; Mudronova, D.; Bures, R. Polyhydroxybutyrate/Chitosan 3D Scaffolds Promote In Vitro and In Vivo Chondrogenesis. Appl. Biochem. Biotechnol. 2019. [Google Scholar] [CrossRef] [Scilit]
- ISO 10993-12. Biological Evaluation of Medical Devices—Part 12: Sample Preparation and Reference Materials; International Organization for Standardization: Geneva, Switzerland, 2012. [Google Scholar]
- ISO 10993-5. Biological Evaluation of Medical Devices—Part 5: Tests For In Vitro Cytotoxicity; International Organization for Standardization: Geneva, Switzerland, 2003. [Google Scholar]
- Grässel, S.; Ahmed, N.; Göttl, C.; Grifka, J. Gene and protein expression profile of naive and osteo-chondrogenically differentiated rat bone marrow-derived mesenchymal progenitor cells. Int. J. Mol. Med. 2009, 23, 745–755. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Chen, X.; Yuan, T.; Yang, X.; Fan, Y.; Zhang, X. Regulation of the secretion of immunoregulatory factors of mesenchymal stem cells (MSCs) by collagen-based scaffolds during chondrogenesis. Mater. Sci. Eng. C 2017, 70, 983–991. [Google Scholar] [CrossRef] [Scilit]
- Yusop, N.; Battersby, P.; Alraies, A.; Sloan, A.J.; Moseley, R.; Waddington, R.J. Isolation and Characterisation of Mesenchymal Stem Cells from Rat Bone Marrow and the Endosteal Niche: A Comparative Study. Stem Cells Int. 2018, 2018, 6869128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karaoz, E.; Aksoy, A.; Ayhan, S.; Sarıboyaci, A.E.; Kaymaz, F.; Kasap, M. Characterization of mesenchymal stem cells from rat bone marrow: Ultrastructural properties, differentiation potential and immunophenotypic markers. Histochem. Cell. Biol. 2009, 132, 533. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Su, W.; Ma, X.; Zhang, H.; Sun, Z.; Li, X. Comparison of the osteogenic capability of rat bone mesenchymal stem cells on collagen, collagen/hydroxyapatite, hydroxyapatite and biphasic calcium phosphate. Regen. Biomater. 2018, 5, 93–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moseke, C.; Gbureck, U. Tetracalcium phosphate:synthesis, properties and biomedical applications. Acta Biomater. 2010, 6, 3815–3823. [Google Scholar] [CrossRef] [Scilit]
- Jalota, S.; Tas, A.C.; Bhaduri, S.B. Synthesis of HA-Seeded TTCP (Ca4(PO4)2O) Powders at 12301C from Ca(CH3COO)2.H2O and NH4H2PO4. J. Am. Ceram. Soc. 2005, 88, 3353–3360. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Butler, I.S.; Gilson, D.F.R. FT-Raman and high-pressure infrared spectroscopic studies of dicalcium phosphate dehydrate (CaHPO4.2H2O) and anhydrous dicalcium phosphate (CaHPO4). Spectrochim. Acta Part A 1999, 55, 2801–2809. [Google Scholar] [CrossRef] [Scilit]
- Bishop, J.L.; Lane, M.D.; Dyar, M.D.; King, S.J.; Brown, A.J.; Swayze, G.A. Spectral properties of Ca-sulfates: Gypsum, bassanite, and anhydrite. Am. Mineral. 2014, 99, 2105–2115. [Google Scholar] [CrossRef] [Scilit]
- Krajewski, A.; Mazzocchi, M.; Buldini, P.L.; Ravaglioli, A.; Tinti, A.; Taddei, P.; Fagnano, C. Synthesis of carbonated hydroxyapatites: Efficiency of the substitution and critical evaluation of analytical methods. J. Mol. Struct. 2005, 744, 221–228. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.L.; Chen, C.K.; Lee, J.W.; Lee, Y.L.; Ju, C.P.; Lin, J.H. Structure, properties and animal study of a calcium phosphate/calcium sulfate composite cement. Mater. Sci. Eng. C 2014, 37, 60–67. [Google Scholar] [CrossRef] [Scilit]
- Wanga, J.C.; Ko, C.L.; Hung, C.C.; Tyan, Y.C.; Lai, C.H.; Chen, W.C.; Wang, C.K. Deriving fast setting properties of tetracalcium phosphate/ dicalcium phosphate anhydrous bone cement with nanocrystallites on the reactant surfaces. J. Dent. 2010, 38, 158–165. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.H.K.; Quinn, J.B.; Takagi, S.; Chow, L.C.; Eichmiller, F.C. Strong and macroporous calcium phosphate cement: Effects of porosity and fiber reinforcement on mechanical properties. J. Biomed. Mater. Res. 2001, 57, 457–466. [Google Scholar] [CrossRef] [Scilit]
- Nilsson, M.; Fernandez, E.; Sarda, S.; Lidgren, L.; Planell, J.A. Characterization of a novel calcium phosphate/sulphate bone cement. J. Biomed. Mater. Res. 2002, 61, 600–607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.C.; Ju, C.P.; Lin, J.H.C. Variation in structure and properties of a non-dispersive TTCP/DCPA-derived CPC immersed in Hanks’ solution. J. Oral Rehab. 2007, 34, 541–551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, C.; Shao, H.; Chen, F.; Zheng, H. Effects of the granularity of raw materials on the hydration and hardening process of calcium phosphate cement. Biomaterials 2003, 24, 4103–4113. [Google Scholar] [CrossRef] [Scilit]
- Bohner, M. New hydraulic cements based on a-tricalcium phosphate-calcium sulfate dihydrate mixtures. Biomaterials 2004, 25, 741–749. [Google Scholar] [CrossRef] [Scilit]
- Van Driessche, A.E.S.; Stawski, T.M.; Benning, L.G.; Kellermeier, M. Calcium sulfate precipitation throughout its phase diagram. In New Perspectives on Mineral Nucleation and Growth; Van Driessche, A., Kellermeier, M., Benning, L., Gebauer, D., Eds.; Springer: Cham, Switzerland, 2017; pp. 227–256. [Google Scholar]
- Gericke, A.; Qin, C.; Spevak, L.; Fujimoto, Y.; Butler, W.T.; Sˇrrensen, E.S.; Boskey, A.L. Importance of phosphorylation for osteopontin regulation of biomineralization. Calcif. Tissue Int. 2005, 77, 45–54. [Google Scholar] [CrossRef] [Scilit]
- Termine, J.D.; Kleinman, H.K.; Whitson, S.W.; Conn, K.M.; McGarvey, M.L.; Martin, G.R. Osteonectin, a bone-specific protein linking mineral to collagen. Cell 1981, 26, 99–105. [Google Scholar] [CrossRef] [Scilit]
- Rosseta, E.M.; Bradshaw, A.D. SPARC/osteonectin in mineralized tissue. Matrix Biol. 2016, 52, 78–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maeno, S.; Niki, Y.; Matsumoto, H.; Morioka, H.; Yatabe, T.; Funayama, A.; Tanaka, J. The effect of calcium ion concentration on osteoblast viability, proliferation and differentiation in monolayer and 3D culture. Biomaterials 2005, 26, 4847–4855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sollazzo, V.; Lucchese, A.; Palmieri, A.; Carnevali, G.; Iaccarino, C.; Zollino, I.; Della Valle, M.; Pezzetti, F.; Brunelli, G.; Carnici, F. Calcium sulfate stimulates pulp stem cells towards osteoblasts differentiation. Int. J. Immunopathol. Pharmacol. 2011, 24, 51–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aquino-Martínez, R.; Angelo, A.P.; Pujol, F.V. Calcium-containing scaffolds induce bone regeneration by regulating mesenchymal stem cell differentiation and migration. Stem Cell Res. Ther. 2017, 8, 265. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Genes | Primers (5′3′) | Reference |
|---|---|---|
| B-actin rat | F: GTAGCCATCCAGGCTGTGTT R: CCCTCATAGATGGGCAGAGT | [31] |
| Type I collagen rat | F: CCAGCTGACCTTCCTGCGCC R: CGGTGTGACTCGTGCAGCCA | [32] |
| Osteocalcin rat | FACAGACAAGTCCCACACAGCAACT R: CCTGCTTGGACATGAAGGCTTTGT | [33] |
| Osteopontin rat | F: CCGATGAATCTGATGAGTCCTT R: TCCAGCTGACTTGACTCATGG | [34] |
| Osteonectin rat | F: GGAAGCTGCAGAAGAGATGG R: TGCACACCTTTTCAAACTCG | [34] |
| Alkaline phosphatase rat | F: AACCTGACTGACCCTTCCCTCT R: TCAATCCTGCCTCCTTCCACTA | [35] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Medvecky, L.; Giretova, M.; Stulajterova, R.; Luptakova, L.; Sopcak, T. Tetracalcium Phosphate/Monetite/Calcium Sulfate Hemihdrate Biocement Powder Mixtures Prepared by the One-Step Synthesis for Preparation of Nanocrystalline Hydroxyapatite Biocement-Properties and In Vitro Evaluation. Materials 2021, 14, 2137. https://doi.org/10.3390/ma14092137
Medvecky L, Giretova M, Stulajterova R, Luptakova L, Sopcak T. Tetracalcium Phosphate/Monetite/Calcium Sulfate Hemihdrate Biocement Powder Mixtures Prepared by the One-Step Synthesis for Preparation of Nanocrystalline Hydroxyapatite Biocement-Properties and In Vitro Evaluation. Materials. 2021; 14(9):2137. https://doi.org/10.3390/ma14092137
Chicago/Turabian StyleMedvecky, Lubomir, Maria Giretova, Radoslava Stulajterova, Lenka Luptakova, and Tibor Sopcak. 2021. "Tetracalcium Phosphate/Monetite/Calcium Sulfate Hemihdrate Biocement Powder Mixtures Prepared by the One-Step Synthesis for Preparation of Nanocrystalline Hydroxyapatite Biocement-Properties and In Vitro Evaluation" Materials 14, no. 9: 2137. https://doi.org/10.3390/ma14092137
APA StyleMedvecky, L., Giretova, M., Stulajterova, R., Luptakova, L., & Sopcak, T. (2021). Tetracalcium Phosphate/Monetite/Calcium Sulfate Hemihdrate Biocement Powder Mixtures Prepared by the One-Step Synthesis for Preparation of Nanocrystalline Hydroxyapatite Biocement-Properties and In Vitro Evaluation. Materials, 14(9), 2137. https://doi.org/10.3390/ma14092137

