Nanocomplexes of Graphene Oxide and Platinum Nanoparticles against Colorectal Cancer Colo205, HT-29, HTC-116, SW480, Liver Cancer HepG2, Human Breast Cancer MCF-7, and Adenocarcinoma LNCaP and Human Cervical Hela B Cell Lines
Abstract
:1. Background
2. Materials and Methods
2.1. Preparation and Characterization of Nanocolloids
2.1.1. Platinum Nanoparticles and Graphene Oxide
2.1.2. Complex of Graphene Oxide and Platinum Nanoparticles
2.1.3. Scanning Electron Microscopy
2.1.4. Fourier Transform Infrared (FTIR) Spectroscopy
2.1.5. ζ-Potential Measurements
2.2. Cell Cultures and Treatments
2.3. Proliferation Assay
2.4. Cell Viability Assay
2.5. Cell Morphology
2.6. Apoptosis Assay
2.7. Gene Expression
2.7.1. Isolation of Total RNA
2.7.2. Real-Time PCR
2.8. Statistical Analysis
3. Results
3.1. Characterization of Nanocolloids
3.1.1. Scanning Transmission Electron Microscopy
3.1.2. Fourier Transform Infrared (FTIR) Spectroscopy
3.1.3. ζ-Potential Measurements
3.2. Proliferation Assay by BrdU Incorporation
3.3. Cell Viability Assay
3.4. Cell Morphology
3.5. Apoptosis Assay
3.6. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Danaei, G.; Vander Hoorn, S.; Lopez, A.D.; Murray, C.J.; Ezzati, M. Comparative Risk Assessment collaborating group. Causes of cancer in the world: Comparative risk assessment of nine behavioural and environmental risk factors. Lancet 2005, 366, 1784–1793. [Google Scholar] [CrossRef]
- Sloan, F.A.; Gelband, H. Cancer causes and risk factors and the elements of cancer control. In Cancer Control Opportunities in Low- and Middle-Income Countries, 1st ed.; Sloan, F.A., Gelband, H., Eds.; National Academies Press (US): Washington, DC, USA, 2007; Volume 2, pp. 27–68. [Google Scholar]
- Chakraborty, S.; Rahman, T. The difficulties in cancer treatment. Ecancermedicalscience 2012, 6, ed16. [Google Scholar] [CrossRef] [PubMed]
- Volokitin, Y.; Sinzig, J.D.; De Jongh, L.J.; Schmid, G.; Vargaftik, M.N.; Moiseevi, I.I. Quantum-size effects in the thermodynamic properties of metallic nanoparticles. Nature 1996, 384, 621. [Google Scholar] [CrossRef]
- Iversen, T.G.; Skotland, T.; Sandvig, K. Endocytosis and intracellular transport of nanoparticles: Present knowledge and need for future studies. Nano Today 2011, 6, 176–185. [Google Scholar] [CrossRef]
- Yameen, B.; Choi, W.I.; Vilos, C.; Swami, A.; Shi, J.; Farokhzad, O.C. Insight into nanoparticle cellular uptake and intracellular targeting. J. Control. Release 2014, 190, 485–499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, L.; Xia, J.; Zhao, Q.; Liu, L.; Zhang, Z. Functional graphene oxide as a nanocarrier for controlled loading and targeted delivery of mixed anticancer drugs. Small 2010, 6, 537–544. [Google Scholar] [CrossRef]
- Jaworski, S.; Sawosz, E.; Kutwin, M.; Wierzbicki, M.; Hinzmann, M.; Grodzik, M.; Winnicka, A.; Lipińska, L.; Włodyga, K.; Chwalibog, A. In vitro and in vivo effects of graphene oxide and reduced graphene oxide on glioblastoma. Int. J. Nanomed. 2015, 10, 1585. [Google Scholar]
- Chang, Y.; Yang, S.T.; Liu, J.H.; Dong, E.; Wang, Y.; Cao, A.; Liu, Y.; Wang, H. In vitro toxicity evaluation of graphene oxide on A549 cells. Toxicol. Lett. 2011, 200, 201–210. [Google Scholar] [CrossRef]
- Lammel, T.; Boisseaux, P.; Fernández-Cruz, M.L.; Navas, J.M. Internalization and cytotoxicity of graphene oxide and carboxyl graphene nanoplatelets in the human hepatocellular carcinoma cell line Hep G2. Part. Fibre Toxicol. 2013, 10, 27. [Google Scholar] [CrossRef]
- Clinicaltrials.gov. Pilot Study of AuroLase(tm) Therapy in Refractory and/or Recurrent Tumors of the Head and Neck. Available online: http://clinicaltrials.gov/ct2/show/NCT00848042 (accessed on 8 March 2019).
- Cho, W.S.; Cho, M.; Jeong, J.; Choi, M.; Cho, H.Y.; Han, B.S.; Kim, S.H.; Kim, H.O.; Lim, Y.T.; Chung, B.H.; et al. Acute toxicity and pharmacokinetics of 13 nm-sized PEG-coated gold nanoparticles. Toxicol. Appl. Pharmacol. 2009, 236, 16–24. [Google Scholar] [CrossRef]
- Liu, J.; Cui, L.; Losic, D. Graphene and graphene oxide as new nanocarriers for drug delivery applications. Acta Biomater. 2013, 9, 9243–9257. [Google Scholar] [CrossRef]
- Chen, K.; Huang, Y.H.; Chen, J.L. Understanding and targeting cancer stem cells: Therapeutic implications and challenges. Acta Pharmacol. Sin. 2013, 34, 732. [Google Scholar] [CrossRef]
- Artelt, S.; Creutzenberg, O.; Kock, H.; Levsen, K.; Nachtigall, D.; Heinrich, U.; Rühle, T.; Schlögl, R. Bioavailability of fine dispersed platinum as emitted from automotive catalytic converters: A model study. Sci. Total Environ. 1999, 228, 219–242. [Google Scholar] [CrossRef]
- Kutwin, M.; Sawosz, E.; Jaworski, S.; Hinzmann, M.; Wierzbicki, M.; Hotowy, A.; Grodzik, M.; Winnicka, A.; Chwalibog, A. Investigation of platinum nanoparticle properties against U87 glioblastoma multiforme. Arch. Med. Sci. 2017, 13, 1322. [Google Scholar] [CrossRef]
- Kutwin, M.; Sawosz, E.; Jaworski, S.; Wierzbicki, M.; Strojny, B.; Grodzik, M.; Chwalibog, A. Assessment of the proliferation status of glioblastoma cell and tumour tissue after nanoplatinum treatment. PLoS ONE 2017, 12, e0178277. [Google Scholar] [CrossRef]
- Asharani, P.V.; Xinyi, N.; Hande, M.P.; Valiyaveettil, S. DNA damage and p53-mediated growth arrest in human cells treated with platinum nanoparticles. Nanomedicine 2010, 5, 51–64. [Google Scholar] [CrossRef]
- Gehrke, H.; Pelka, J.; Hartinger, C.G.; Blank, H.; Bleimund, F.; Schneider, R.; Gerthsen, D.; Bräse, S.; Crone, M.; Türk, M.; et al. Platinum nanoparticles and their cellular uptake and DNA platination at non-cytotoxic concentrations. Arch. Toxicol. 2011, 85, 799–812. [Google Scholar] [CrossRef]
- Mohammadi, H.; Abedi, A.; Akbarzadeh, A.; Mokhtari, M.J.; Shahmabadi, H.E.; Mehrabi, M.R.; Javadian, S.; Chiani, M. Evaluation of synthesized platinum nanoparticles on the MCF-7 and HepG-2 cancer cell lines. Int. Nano Lett. 2013, 3, 28. [Google Scholar] [CrossRef] [Green Version]
- Jawaid, P.; ur Rehman, M.; Yoshihisa, Y.; Li, P.; li Zhao, Q.; Hassan, M.A.; Miyamoto, Y.; Shimizu, T.; Kondo, T. Effects of SOD/catalase mimetic platinum nanoparticles on radiation-induced apoptosis in human lymphoma U937 cells. Apoptosis 2014, 19, 1006–1016. [Google Scholar] [CrossRef]
- Lebedová, J.; Hedberg, Y.S.; Odnevall Wallinder, I.; Karlsson, H.L. Size-dependent genotoxicity of silver, gold and platinum nanoparticles studied using the mini-gel comet assay and micronucleus scoring with flow cytometry. Mutagenesis 2017, 33, 77–85. [Google Scholar] [CrossRef] [Green Version]
- Brown, A.; Kai, M.; DuRoss, A.; Sahay, G.; Sun, C. Biodistribution and toxicity of micellar platinum nanoparticles in mice via intravenous administration. Nanomaterials 2018, 8, 410. [Google Scholar] [CrossRef]
- Zhang, L.N.; Deng, H.H.; Lin, F.L.; Xu, X.W.; Weng, S.H.; Liu, A.L.; Lin, H.A.; Xia, X.H.; Chen, W. In situ growth of porous platinum nanoparticles on graphene oxide for colorimetric detection of cancer cells. Anal. Chem. 2014, 86, 2711–2718. [Google Scholar] [CrossRef]
- Siegel, R.; Ma, J.; Zou, Z.; Jemal, A. Cancer statistics. CA Cancer J. Clin. 2014, 64, 9–29. [Google Scholar] [CrossRef]
- Bendale, Y.; Bendale, V.; Paul, S. Evaluation of cytotoxic activity of platinum nanoparticles against normal and cancer cells and its anticancer potential through induction of apoptosis. Integr. Med. Res. 2017, 6, 141–148. [Google Scholar] [CrossRef]
- Chwalibog, A.; Sawosz, E.; Hotowy, A.; Szeliga, J.; Mitura, S.; Mitura, K.; Grodzik, M.; Orłowski, P.; Sokolowska, A. Visualization of interaction between inorganic nanoparticles and bacteria or fungi. Int. J. Nanomed. 2010, 5, 1085. [Google Scholar] [CrossRef]
- Wen, Y.; Geitner, N.K.; Chen, R.; Ding, F.; Chen, P.; Andorfer, R.E.; Govindan, P.N.; Ke, P.C. Binding of cytoskeletal proteins with silver nanoparticles. RSC Adv. 2013, 3, 22002–22007. [Google Scholar] [CrossRef]
- Tomita, Y.; Rikimaru-Kaneko, A.; Hashiguchi, K.; Shirotake, S. Effect of anionic and cationic n-butylcyanoacrylate nanoparticles on NO and cytokine production in Raw264. 7 cells. Immunopharmacol. Immunotoxicol. 2011, 33, 730–737. [Google Scholar] [CrossRef]
- Zhang, S.; Li, J.; Lykotrafitis, G.; Bao, G.; Suresh, S. Size-Dependent Endocytosis of Nanoparticles. Adv. Mater. 2009, 21, 419–424. [Google Scholar] [CrossRef] [Green Version]
- Linares, J.; Matesanz, M.C.; Vila, M.; Feito, M.J.; Gonçalves, G.; Vallet-Regí, M.; Marques, P.A.A.P.; Portolés, M.T. Endocytic mechanisms of graphene oxide nanosheets in osteoblasts, hepatocytes and macrophages. ACS Appl. Mater. Interfaces 2014, 6, 13697–13706. [Google Scholar] [CrossRef]
- Fröhlich, E. The role of surface charge in cellular uptake and cytotoxicity of medical nanoparticles. Int. J. Nanomed. 2012, 7, 5577. [Google Scholar] [CrossRef]
- Yamagishi, Y.; Watari, A.; Hayata, Y.; Li, X.; Kondoh, M.; Yoshioka, Y.; Tsutsumi, Y.; Yagi, K. Acute and chronic nephrotoxicity of platinum nanoparticles in mice. Nanoscale Res. Lett. 2013, 8, 395. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.H.; Yang, S.T.; Wang, H.; Chang, Y.; Cao, A.; Liu, Y. Effect of size and dose on the biodistribution of graphene oxide in mice. Nanomedicine 2012, 7, 1801–1812. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.J.; Gurunathan, S.; Kim, J.H. Graphene oxide-silver nanocomposite enhances cytotoxic and apoptotic potential of salinomycin in human ovarian cancer stem cells (OvCSCs): A novel approach for cancer therapy. Int. J. Mol. Sci. 2018, 19, 710. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.S. Mechanisms of chemotherapeutic drug resistance in cancer therapy—a quick review. Taiwan J. Obstet. Gynecol. 2009, 48, 239–244. [Google Scholar] [CrossRef]
- Liu, X.; Chen, K.L. Interactions of graphene oxide with model cell membranes: Probing nanoparticle attachment and lipid bilayer disruption. Langmuir 2015, 31, 12076–12086. [Google Scholar] [CrossRef] [PubMed]
- Kurantowicz, N.; Strojny, B.; Sawosz, E.; Jaworski, S.; Kutwin, M.; Grodzik, M.; Wierzbicki, M.; Lipinska, L.; Mitura, K.; Chwalibog, A. Biodistribution of a high dose of diamond, graphite, and graphene oxide nanoparticles after multiple intraperitoneal injections in rats. Nanoscale Res. Lett. 2015, 10, 398. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Forward Primer | Reverse Primer |
---|---|---|
Caspase-3 | CAAACTTTTTCAGAGGGGATCG | GCATACTGTTTCAGCATGGCAC |
PCNA | AGGCACTCAAGGACCTCATCA | GAGTCCATGCTCTGCAGGTTT |
GPDH | ACATCCCCTCACCAAT AACAAC | TAGCCAAATCATACTGCTCGTC |
Level of mRNA Expression | Groups | ANOVA p-Value | SE-Pooled | ||||
---|---|---|---|---|---|---|---|
Gene | Cell Line | Control | GO-NP-Pt | NP-Pt | GO | ||
Caspase-3 | Colo205 | 0.738 a | 1.222 c | 0.555 b | 0.756 a | 0.0036 | 0.1316 |
HepG2 | 0.742 a | 0.727 a | 0.379 b | 0.321 b | 0.0122 | 0.1567 | |
MCF-7 | 0.832 | 0.692 | 0.897 | 1.067 | 0.0396 | 0.1874 | |
PCNA | Colo205 | 1.001 a | 0.774 b | 0.579 c | 0.832 a | 0.0021 | 0.0689 |
HepG2 | 1.253 | 0.991 | 0.780 | 0.886 | 0.5606 | 0.3351 | |
MCF-7 | 1.016 a | 0.588 b | 0.837 a | 0.994 a | 0.0491 | 0.1378 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kutwin, M.; Sawosz, E.; Jaworski, S.; Wierzbicki, M.; Strojny, B.; Grodzik, M.; Ewa Sosnowska, M.; Trzaskowski, M.; Chwalibog, A. Nanocomplexes of Graphene Oxide and Platinum Nanoparticles against Colorectal Cancer Colo205, HT-29, HTC-116, SW480, Liver Cancer HepG2, Human Breast Cancer MCF-7, and Adenocarcinoma LNCaP and Human Cervical Hela B Cell Lines. Materials 2019, 12, 909. https://doi.org/10.3390/ma12060909
Kutwin M, Sawosz E, Jaworski S, Wierzbicki M, Strojny B, Grodzik M, Ewa Sosnowska M, Trzaskowski M, Chwalibog A. Nanocomplexes of Graphene Oxide and Platinum Nanoparticles against Colorectal Cancer Colo205, HT-29, HTC-116, SW480, Liver Cancer HepG2, Human Breast Cancer MCF-7, and Adenocarcinoma LNCaP and Human Cervical Hela B Cell Lines. Materials. 2019; 12(6):909. https://doi.org/10.3390/ma12060909
Chicago/Turabian StyleKutwin, Marta, Ewa Sawosz, Sławomir Jaworski, Mateusz Wierzbicki, Barbara Strojny, Marta Grodzik, Malwina Ewa Sosnowska, Maciej Trzaskowski, and André Chwalibog. 2019. "Nanocomplexes of Graphene Oxide and Platinum Nanoparticles against Colorectal Cancer Colo205, HT-29, HTC-116, SW480, Liver Cancer HepG2, Human Breast Cancer MCF-7, and Adenocarcinoma LNCaP and Human Cervical Hela B Cell Lines" Materials 12, no. 6: 909. https://doi.org/10.3390/ma12060909
APA StyleKutwin, M., Sawosz, E., Jaworski, S., Wierzbicki, M., Strojny, B., Grodzik, M., Ewa Sosnowska, M., Trzaskowski, M., & Chwalibog, A. (2019). Nanocomplexes of Graphene Oxide and Platinum Nanoparticles against Colorectal Cancer Colo205, HT-29, HTC-116, SW480, Liver Cancer HepG2, Human Breast Cancer MCF-7, and Adenocarcinoma LNCaP and Human Cervical Hela B Cell Lines. Materials, 12(6), 909. https://doi.org/10.3390/ma12060909