Dual Targeting of Sorafenib-Resistant HCC-Derived Cancer Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Reagents
2.2. Three-Dimensional Sphere Enrichment Assay
2.3. Colony-Forming Assay
2.4. RNA Extract and cDNA Synthesis
2.5. Quantitative Reverse Transcription-PCR (qRT-PCR)
2.6. Western Blot Analysis
2.7. Transwell Migration Assay
2.8. Proliferation Assay
2.9. siRNA Transfection
2.10. Flow Cytometry
2.11. Statistical Analysis
3. Results
3.1. Human HCC-Derived Spheres Exhibit Stem-Cell-Like Features
3.2. Anchorage-Independent Spheres Exhibit Mesenchymal Phenotype
3.3. Inhibition of EMT with SB431542 Can Enhance Cytotoxicity of SORAFENIB
3.4. CSCs Overexpress Immune Checkpoint Molecules
3.5. Combination of Immune Checkpoint and EMT Inhibition Can Sensitise Human HCC-Derived CSCs to Sorafenib Treatment
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chacko, S.; Samanta, S. Hepatocellular carcinoma: A life-threatening disease. Biomed. Pharmacother. 2016, 84, 1679–1688. [Google Scholar] [CrossRef] [Scilit]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [Scilit]
- Bruix, J.; da Fonseca, L.G.; Reig, M. Insights into the success and failure of systemic therapy for hepatocellular carcinoma. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 617–630. [Google Scholar] [CrossRef] [Scilit]
- Daher, S.; Massarwa, M.; Benson, A.A.; Khoury, T. Current and Future Treatment of Hepatocellular Carcinoma: An Updated Comprehensive Review. J. Clin. Transl. Hepatol. 2018, 6, 69–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.D.; Hainaut, P.; Gores, G.J.; Amadou, A.; Plymoth, A.; Roberts, L.R. A global view of hepatocellular carcinoma: Trends, risk, prevention and management. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 589–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Tan, X.; Luo, J.; Yao, H.; Si, Z.; Tong, J.S. The miR-30a-5p/CLCF1 axis regulates sorafenib resistance and aerobic glycolysis in hepatocellular carcinoma. Cell Death Dis. 2020, 11, 902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, A.L.; Kang, Y.K.; Chen, Z.; Tsao, C.J.; Qin, S.; Kim, J.S.; Luo, R.; Feng, J.; Ye, S.; Yang, T.S.; et al. Efficacy and safety of sorafenib in patients in the Asia-Pacific region with advanced hepatocellular carcinoma: A phase III randomised, double-blind, placebo-controlled trial. Lancet Oncol. 2009, 10, 25–34. [Google Scholar] [CrossRef] [Scilit]
- Llovet, J.M.; Ricci, S.; Mazzaferro, V.; Hilgard, P.; Gane, E.; Blanc, J.F.; de Oliveira, A.C.; Santoro, A.; Raoul, J.L.; Forner, A.; et al. Sorafenib in advanced hepatocellular carcinoma. N. Engl. J. Med. 2008, 359, 378–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Méndez-Blanco, C.; Fondevila, F.; García-Palomo, A.; González-Gallego, J.; Mauriz, J.L. Sorafenib resistance in hepatocarcinoma: Role of hypoxia-inducible factors. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.J.; Zheng, B.; Wang, H.Y.; Chen, L. New knowledge of the mechanisms of sorafenib resistance in liver cancer. Acta Pharmacol. Sin. 2017, 38, 614–622. [Google Scholar] [CrossRef] [Scilit]
- Niu, L.; Liu, L.; Yang, S.; Ren, J.; Lai, P.B.S.; Chen, G.G. New insights into sorafenib resistance in hepatocellular carcinoma: Responsible mechanisms and promising strategies. Biochim. Biophys. Acta Rev. Cancer 2017, 1868, 564–570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chow, A.K.; Ng, L.; Lam, C.S.; Wong, S.K.; Wan, T.M.; Cheng, N.S.; Yau, T.C.; Poon, R.T.; Pang, R.W. The Enhanced metastatic potential of hepatocellular carcinoma (HCC) cells with sorafenib resistance. PLoS ONE 2013, 8, e78675. [Google Scholar] [CrossRef] [Scilit]
- van Malenstein, H.; Dekervel, J.; Verslype, C.; Van Cutsem, E.; Windmolders, P.; Nevens, F.; van Pelt, J. Long-term exposure to sorafenib of liver cancer cells induces resistance with epithelial-to-mesenchymal transition, increased invasion and risk of rebound growth. Cancer Lett. 2013, 329, 74–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Zijl, F.; Mall, S.; Machat, G.; Pirker, C.; Zeillinger, R.; Weinhaeusel, A.; Bilban, M.; Berger, W.; Mikulits, W. A human model of epithelial to mesenchymal transition to monitor drug efficacy in hepatocellular carcinoma progression. Mol. Cancer Ther. 2011, 10, 850–860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernando, J.; Malfettone, A.; Cepeda, E.B.; Vilarrasa-Blasi, R.; Bertran, E.; Raimondi, G.; Fabra, À.; Alvarez-Barrientos, A.; Fernández-Salguero, P.; Fernández-Rodríguez, C.M.; et al. A mesenchymal-like phenotype and expression of CD44 predict lack of apoptotic response to sorafenib in liver tumor cells. Int. J. Cancer 2015, 136, E161–E172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.L.; Fu, D.; Ma, Y.; Shen, X.Z. The power and the promise of liver cancer stem cell markers. Stem. Cells Dev. 2011, 20, 2023–2030. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guidetti, A.; Carlo-Stella, C.; Locatelli, S.L.; Malorni, W.; Pierdominici, M.; Barbati, C.; Mortarini, R.; Devizzi, L.; Matteucci, P.; Marchianò, A.; et al. Phase II study of sorafenib in patients with relapsed or refractory lymphoma. Br. J. Haematol. 2012, 158, 108–119. [Google Scholar] [CrossRef] [Scilit]
- Tai, W.T.; Shiau, C.W.; Chen, H.L.; Liu, C.Y.; Lin, C.S.; Cheng, A.L.; Chen, P.J.; Chen, K.F. Mcl-1-dependent activation of Beclin 1 mediates autophagic cell death induced by sorafenib and SC-59 in hepatocellular carcinoma cells. Cell Death. Dis. 2013, 4, e485. [Google Scholar] [CrossRef] [Scilit]
- Liang, Y.; Zheng, T.; Song, R.; Wang, J.; Yin, D.; Wang, L.; Liu, H.; Tian, L.; Fang, X.; Meng, X.; et al. Hypoxia-mediated sorafenib resistance can be overcome by EF24 through Von Hippel-Lindau tumor suppressor-dependent HIF-1α inhibition in hepatocellular carcinoma. Hepatology 2013, 57, 1847–1857. [Google Scholar] [CrossRef] [Scilit]
- Zhao, D.; Zhai, B.; He, C.; Tan, G.; Jiang, X.; Pan, S.; Dong, X.; Wei, Z.; Ma, L.; Qiao, H.; et al. Upregulation of HIF-2α induced by sorafenib contributes to the resistance by activating the TGF-α/EGFR pathway in hepatocellular carcinoma cells. Cell. Signal 2014, 26, 1030–1039. [Google Scholar] [CrossRef] [Scilit]
- Blivet-Van Eggelpoël, M.J.; Chettouh, H.; Fartoux, L.; Aoudjehane, L.; Barbu, V.; Rey, C.; Priam, S.; Housset, C.; Rosmorduc, O.; Desbois-Mouthon, C. Epidermal growth factor receptor and HER-3 restrict cell response to sorafenib in hepatocellular carcinoma cells. J. Hepatol. 2012, 57, 108–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ezzoukhry, Z.; Louandre, C.; Trécherel, E.; Godin, C.; Chauffert, B.; Dupont, S.; Diouf, M.; Barbare, J.C.; Mazière, J.C.; Galmiche, A. EGFR activation is a potential determinant of primary resistance of hepatocellular carcinoma cells to sorafenib. Int. J. Cancer 2012, 131, 2961–2969. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.; Xiao, W.; Zhang, K.; Yin, X.; Lai, J.; Liang, L.; Chen, D. Activation of c-Jun predicts a poor response to sorafenib in hepatocellular carcinoma: Preliminary Clinical Evidence. Sci. Rep. 2016, 6, 22976. [Google Scholar] [CrossRef] [Scilit]
- Haga, Y.; Kanda, T.; Nakamura, M.; Nakamoto, S.; Sasaki, R.; Takahashi, K.; Wu, S.; Yokosuka, O. Overexpression of c-Jun contributes to sorafenib resistance in human hepatoma cell lines. PLoS ONE 2017, 12, e0174153. [Google Scholar] [CrossRef] [Scilit]
- Hagiwara, S.; Kudo, M.; Nagai, T.; Inoue, T.; Ueshima, K.; Nishida, N.; Watanabe, T.; Sakurai, T. Activation of JNK and high expression level of CD133 predict a poor response to sorafenib in hepatocellular carcinoma. Br. J. Cancer 2012, 106, 1997–2003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gedaly, R.; Angulo, P.; Hundley, J.; Daily, M.F.; Chen, C.; Koch, A.; Evers, B.M. PI-103 and sorafenib inhibit hepatocellular carcinoma cell proliferation by blocking Ras/Raf/MAPK and PI3K/AKT/mTOR pathways. Anticancer Res. 2010, 30, 4951–4958. [Google Scholar]
- Zhang, L.; Ge, C.; Zhao, F.; Zhang, Y.; Wang, X.; Yao, M.; Li, J. NRBP2 Overexpression Increases the Chemosensitivity of Hepatocellular Carcinoma Cells via Akt Signaling. Cancer Res. 2016, 76, 7059–7071. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Jin, R.; Zhao, J.; Liu, J.; Ying, H.; Yan, H.; Zhou, S.; Liang, Y.; Huang, D.; Liang, X.; et al. Potential molecular, cellular and microenvironmental mechanism of sorafenib resistance in hepatocellular carcinoma. Cancer Lett. 2015, 367, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009, 119, 1420–1428. [Google Scholar] [CrossRef] [Scilit]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.Y.; Ke, A.W.; Shi, G.M.; Zhang, X.; Zhang, C.; Shi, Y.H.; Wang, X.Y.; Ding, Z.B.; Xiao, Y.S.; Yan, J.; et al. αB-crystallin complexes with 14-3-3ζ to induce epithelial-mesenchymal transition and resistance to sorafenib in hepatocellular carcinoma. Hepatology 2013, 57, 2235–2247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mir, N.; Jayachandran, A.; Dhungel, B.; Shrestha, R.; Steel, J.C. Epithelial-to-Mesenchymal Transition: A Mediator of Sorafenib Resistance in Advanced Hepatocellular Carcinoma. Curr. Cancer Drug Targets 2017, 17, 698–706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.X.; Wang, X.Q.; Chok, S.H.; Man, K.; Tsang, S.H.Y.; Chan, A.C.Y.; Ma, K.W.; Xia, W.; Cheung, T.T. Blocking CDK1/PDK1/β-Catenin signaling by CDK1 inhibitor RO3306 increased the efficacy of sorafenib treatment by targeting cancer stem cells in a preclinical model of hepatocellular carcinoma. Theranostics 2018, 8, 3737–3750. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.F.; Li, K.S.; Shen, Y.H.; Gao, P.T.; Dong, Z.R.; Cai, J.B.; Zhang, C.; Huang, X.Y.; Tian, M.X.; Hu, Z.Q.; et al. Galectin-1 induces hepatocellular carcinoma EMT and sorafenib resistance by activating FAK/PI3K/AKT signaling. Cell Death Dis. 2016, 7, e2201. [Google Scholar] [CrossRef] [Scilit]
- Mani, S.A.; Guo, W.; Liao, M.J.; Eaton, E.N.; Ayyanan, A.; Zhou, A.Y.; Brooks, M.; Reinhard, F.; Zhang, C.C.; Shipitsin, M.; et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008, 133, 704–715. [Google Scholar] [CrossRef] [Scilit]
- Mitra, A.; Satelli, A.; Xia, X.; Cutrera, J.; Mishra, L.; Li, S. Cell-surface Vimentin: A mislocalized protein for isolating csVimentin(+) CD133(-) novel stem-like hepatocellular carcinoma cells expressing EMT markers. Int. J. Cancer 2015, 137, 491–496. [Google Scholar] [CrossRef] [Scilit]
- Scheel, C.; Weinberg, R.A. Phenotypic plasticity and epithelial-mesenchymal transitions in cancer and normal stem cells? Int. J. Cancer 2011, 129, 2310–2314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oishi, N.; Wang, X.W. Novel therapeutic strategies for targeting liver cancer stem cells. Int. J. Biol. Sci. 2011, 7, 517–535. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.; Settleman, J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010, 29, 4741–4751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Mu, D.; Feng, K. Hierarchical potential differentiation of liver cancer stem cells. Adv. Clin. Exp. Med. 2017, 26, 1137–1141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayachandran, A.; Dhungel, B.; Steel, J.C. Epithelial-to-mesenchymal plasticity of cancer stem cells: Therapeutic targets in hepatocellular carcinoma. J. Hematol. Oncol. 2016, 9, 74. [Google Scholar] [CrossRef] [Scilit]
- Capper, D.; Gaiser, T.; Hartmann, C.; Habel, A.; Mueller, W.; Herold-Mende, C.; von Deimling, A.; Siegelin, M.D. Stem-cell-like glioma cells are resistant to TRAIL/Apo2L and exhibit down-regulation of caspase-8 by promoter methylation. Acta Neuropathol. 2009, 117, 445–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xin, H.W.; Ambe, C.M.; Hari, D.M.; Wiegand, G.W.; Miller, T.C.; Chen, J.Q.; Anderson, A.J.; Ray, S.; Mullinax, J.E.; Koizumi, T.; et al. Label-retaining liver cancer cells are relatively resistant to sorafenib. Gut 2013, 62, 1777–1786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Lingala, S.; Khoobyari, S.; Nolta, J.; Zern, M.A.; Wu, J. Epithelial mesenchymal transition and hedgehog signaling activation are associated with chemoresistance and invasion of hepatoma subpopulations. J. Hepatol. 2011, 55, 838–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Khoueiry, A.B.; Sangro, B.; Yau, T.; Crocenzi, T.S.; Kudo, M.; Hsu, C.; Kim, T.Y.; Choo, S.P.; Trojan, J.; Welling, T.H.; et al. Nivolumab in patients with advanced hepatocellular carcinoma (CheckMate 040): An open-label, non-comparative, phase 1/2 dose escalation and expansion trial. Lancet 2017, 389, 2492–2502. [Google Scholar] [CrossRef] [Scilit]
- Zhu, A.X.; Finn, R.S.; Edeline, J.; Cattan, S.; Ogasawara, S.; Palmer, D.; Verslype, C.; Zagonel, V.; Fartoux, L.; Vogel, A.; et al. Pembrolizumab in patients with advanced hepatocellular carcinoma previously treated with sorafenib (KEYNOTE-224): A non-randomised, open-label phase 2 trial. Lancet Oncol. 2018, 19, 940–952. [Google Scholar] [CrossRef] [Scilit]
- Cheng, A.L.; Qin, S.; Ikeda, M.; Galle, P.; Ducreux, M.; Zhu, A.; Kim, T.Y.; Kudo, M.; Breder, V.; Merle, P.; et al. IMbrave150: Efficacy and safety results from a ph III study evaluating atezolizumab (atezo) 1 bevacizumab (bev) vs sorafenib (Sor) as first treatment (tx) for patients (pts) with unresectable hepatocellular carcinoma (HCC). Ann. Oncol. 2019, 30. [Google Scholar] [CrossRef] [Scilit]
- Yau, T.; Kang, Y.K.; Kim, T.Y.; El-Khoueiry, A.B.; Santoro, A.; Sangro, B.; Melero, I.; Kudo, M.; Hou, M.M.; Matilla, A.; et al. Efficacy and Safety of Nivolumab Plus Ipilimumab in Patients with Advanced Hepatocellular Carcinoma Previously Treated with Sorafenib: The CheckMate 040 Randomized Clinical Trial. JAMA Oncol. 2020. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y.; Zhan, H. Communication between EMT and PD-L1 signaling: New insights into tumor immune evasion. Cancer Lett. 2020, 468, 72–81. [Google Scholar] [CrossRef] [Scilit]
- Soundararajan, R.; Fradette, J.J.; Konen, J.M.; Moulder, S.; Zhang, X.; Gibbons, D.L.; Varadarajan, N.; Wistuba, I.I.; Tripathy, D.; Bernatchez, C.; et al. Targeting the Interplay between Epithelial-to-Mesenchymal-Transition and the Immune System for Effective Immunotherapy. Cancers 2019, 11, 714. [Google Scholar] [CrossRef] [Scilit]
- Sultan, M.; Coyle, K.M.; Vidovic, D.; Thomas, M.L.; Gujar, S.; Marcato, P. Hide-and-seek: The interplay between cancer stem cells and the immune system. Carcinogenesis 2017, 38, 107–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reynolds, B.A.; Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 1992, 255, 1707–1710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Yu, Y.; Wang, J.; Yan, Z.; Liu, H.; Wang, Y.; Ding, M.; Cui, L.; Wu, M.; Jiang, X.; et al. Establishment of a novel system for the culture and expansion of hepatic stem-like cancer cells. Cancer Lett. 2015, 360, 177–186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Min, S.O.; Lee, S.W.; Bak, S.Y.; Kim, K.S. Ideal sphere-forming culture conditions to maintain pluripotency in a hepatocellular carcinoma cell lines. Cancer Cell Int. 2015, 15, 95. [Google Scholar] [CrossRef] [Scilit]
- Hashimoto, N.; Tsunedomi, R.; Yoshimura, K.; Watanabe, Y.; Hazama, S.; Oka, M. Cancer stem-like sphere cells induced from de-differentiated hepatocellular carcinoma-derived cell lines possess the resistance to anti-cancer drugs. BMC Cancer 2014, 14, 722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flores-Téllez, T.N.; Villa-Treviño, S.; Piña-Vázquez, C. Road to stemness in hepatocellular carcinoma. World J. Gastroenterol. 2017, 23, 6750–6776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayachandran, A.; Shrestha, R.; Dhungel, B.; Huang, I.T.; Vasconcelos, M.Y.K.; Morrison, B.J.; Ramlogan-Steel, C.A.; Steel, J.C. Murine hepatocellular carcinoma derived stem cells reveal epithelial-to-mesenchymal plasticity. World J. Stem. Cells 2017, 9, 159–168. [Google Scholar] [CrossRef] [Scilit]
- Cao, L.; Zhou, Y.; Zhai, B.; Liao, J.; Xu, W.; Zhang, R.; Li, J.; Zhang, Y.; Chen, L.; Qian, H.; et al. Sphere-forming cell subpopulations with cancer stem cell properties in human hepatoma cell lines. BMC Gastroenterol. 2011, 11, 71. [Google Scholar] [CrossRef] [Scilit]
- Kwon, Y.C.; Bose, S.K.; Steele, R.; Meyer, K.; Di Bisceglie, A.M.; Ray, R.B.; Ray, R. Promotion of Cancer Stem-Like Cell Properties in Hepatitis C Virus-Infected Hepatocytes. J. Virol. 2015, 89, 11549–11556. [Google Scholar] [CrossRef] [Scilit]
- Shrestha, R.; Bridle, K.R.; Crawford, D.H.G.; Jayachandran, A. TNF-α-mediated epithelial-to-mesenchymal transition regulates expression of immune checkpoint molecules in hepatocellular carcinoma. Mol. Med. Rep. 2020, 21, 1849–1860. [Google Scholar] [CrossRef] [Scilit]
- Shrestha, R.; Prithviraj, P.; Bridle, K.R.; Crawford, D.H.G.; Jayachandran, A. Combined Inhibition of TGF-β1-Induced EMT and PD-L1 Silencing Re-Sensitizes Hepatocellular Carcinoma to Sorafenib Treatment. J. Clin. Med. 2021, 10, 1889. [Google Scholar] [CrossRef] [Scilit]
- Xiao, C.; Fu, X.; Wang, Y.; Liu, H.; Jiang, Y.; Zhao, Z.; You, F. Transferrin receptor regulates malignancies and the stemness of hepatocellular carcinoma-derived cancer stem-like cells by affecting iron accumulation. PLoS ONE 2020, 15, e0243812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomizawa, M.; Shinozaki, F.; Motoyoshi, Y.; Sugiyama, T.; Yamamoto, S.; Ishige, N. Proliferation of sphere-forming hepatocellular carcinoma cells is suppressed in a medium without glucose and arginine, but with galactose and ornithine. Oncol. Lett. 2017, 13, 1264–1268. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.C.; Tung, S.L.; Chen, Y.L.; Chen, P.M.; Chu, P.Y. IFI44L is a novel tumor suppressor in human hepatocellular carcinoma affecting cancer stemness, metastasis, and drug resistance via regulating met/Src signaling pathway. BMC Cancer 2018, 18, 609. [Google Scholar] [CrossRef] [Scilit]
- Shrestha, R.; Prithviraj, P.; Anaka, M.; Bridle, K.R.; Crawford, D.H.G.; Dhungel, B.; Steel, J.C.; Jayachandran, A. Monitoring Immune Checkpoint Regulators as Predictive Biomarkers in Hepatocellular Carcinoma. Front. Oncol. 2018, 8, 269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamashita, T.; Wang, X.W. Cancer stem cells in the development of liver cancer. J. Clin. Investig. 2013, 123, 1911–1918. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Chen, G.; Han, Z.; Cheng, H.; Qiao, L. IL-6/STAT3 Signaling Contributes to Sorafenib Resistance in Hepatocellular Carcinoma Through Targeting Cancer Stem Cells. Onco Targets Ther. 2020, 13, 9721–9730. [Google Scholar] [CrossRef] [Scilit]
- Morrison, B.J.; Steel, J.C.; Morris, J.C. Sphere culture of murine lung cancer cell lines are enriched with cancer initiating cells. PLoS ONE 2012, 7, e49752. [Google Scholar] [CrossRef] [Scilit]
- Shi, G.M.; Xu, Y.; Fan, J.; Zhou, J.; Yang, X.R.; Qiu, S.J.; Liao, Y.; Wu, W.Z.; Ji, Y.; Ke, A.W.; et al. Identification of side population cells in human hepatocellular carcinoma cell lines with stepwise metastatic potentials. J. Cancer Res. Clin. Oncol. 2008, 134, 1155–1163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, G.S.; Hu, Z.; Duan, W.; Tian, A.; Wang, X.M.; McLeod, D.; Lam, V.; George, J.; Qiao, L. Efficacy of using cancer stem cell markers in isolating and characterizing liver cancer stem cells. Stem Cells Dev. 2013, 22, 2655–2664. [Google Scholar] [CrossRef] [Scilit]
- Dazert, E.; Colombi, M.; Boldanova, T.; Moes, S.; Adametz, D.; Quagliata, L.; Roth, V.; Terracciano, L.; Heim, M.H.; Jenoe, P.; et al. Quantitative proteomics and phosphoproteomics on serial tumor biopsies from a sorafenib-treated HCC patient. Proc. Natl. Acad. Sci. USA 2016, 113, 1381–1386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jing, L.; Ruan, Z.; Sun, H.; Li, Q.; Han, L.; Huang, L.; Yu, S.; Wang, Y.; Guo, H.; Jiao, M. Epithelial-mesenchymal transition induced cancer-stem-cell-like characteristics in hepatocellular carcinoma. J. Cell. Physiol. 2019, 234, 18448–18458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, X.; Zhang, B.H.; Zheng, S.S.; Gao, D.M.; Qiu, S.J.; Wu, W.Z.; Ren, Z.G. Coexpression of gene Oct4 and Nanog initiates stem cell characteristics in hepatocellular carcinoma and promotes epithelial-mesenchymal transition through activation of Stat3/Snail signaling. J. Hematol. Oncol. 2015, 8, 23. [Google Scholar] [CrossRef] [Scilit]
- Zhou, P.; Li, B.; Liu, F.; Zhang, M.; Wang, Q.; Liu, Y.; Yao, Y.; Li, D. The epithelial to mesenchymal transition (EMT) and cancer stem cells: Implication for treatment resistance in pancreatic cancer. Mol. Cancer 2017, 16, 52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tallerico, R.; Todaro, M.; Di Franco, S.; Maccalli, C.; Garofalo, C.; Sottile, R.; Palmieri, C.; Tirinato, L.; Pangigadde, P.N.; La Rocca, R.; et al. Human NK cells selective targeting of colon cancer-initiating cells: A role for natural cytotoxicity receptors and MHC class I molecules. J. Immunol. 2013, 190, 2381–2390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schatton, T.; Frank, M.H. Cancer stem cells and human malignant melanoma. Pigment Cell Melanoma Res. 2008, 21, 39–55. [Google Scholar] [CrossRef] [Scilit]
- Tallerico, R.; Conti, L.; Lanzardo, S.; Sottile, R.; Garofalo, C.; Wagner, A.K.; Johansson, M.H.; Cristiani, C.M.; Kärre, K.; Carbone, E.; et al. NK cells control breast cancer and related cancer stem cell hematological spread. Oncoimmunology 2017, 6, e1284718. [Google Scholar] [CrossRef] [Scilit]
- Alvarado, A.G.; Thiagarajan, P.S.; Mulkearns-Hubert, E.E.; Silver, D.J.; Hale, J.S.; Alban, T.J.; Turaga, S.M.; Jarrar, A.; Reizes, O.; Longworth, M.S.; et al. Glioblastoma Cancer Stem Cells Evade Innate Immune Suppression of Self-Renewal through Reduced TLR4 Expression. Cell Stem Cell 2017, 20, 450–461.e454. [Google Scholar] [CrossRef] [Scilit]
- Wu, A.; Wei, J.; Kong, L.Y.; Wang, Y.; Priebe, W.; Qiao, W.; Sawaya, R.; Heimberger, A.B. Glioma cancer stem cells induce immunosuppressive macrophages/microglia. Neuro Oncol. 2010, 12, 1113–1125. [Google Scholar] [CrossRef] [Scilit]
- Zhai, Y.; Li, G.; Li, R.; Chang, Y.; Feng, Y.; Wang, D.; Wu, F.; Zhang, W. Single-Cell RNA-Sequencing Shift in the Interaction Pattern Between Glioma Stem Cells and Immune Cells During Tumorigenesis. Front. Immunol. 2020, 11, 581209. [Google Scholar] [CrossRef] [Scilit]
- Ozawa, Y.; Yamamuro, S.; Sano, E.; Tatsuoka, J.; Hanashima, Y.; Yoshimura, S.; Sumi, K.; Hara, H.; Nakayama, T.; Suzuki, Y.; et al. Indoleamine 2,3-dioxygenase 1 is highly expressed in glioma stem cells. Biochem. Biophys. Res. Commun. 2020, 524, 723–729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, C.; Fillmore, C.M.; Koyama, S.; Wu, H.; Zhao, Y.; Chen, Z.; Herter-Sprie, G.S.; Akbay, E.A.; Tchaicha, J.H.; Altabef, A.; et al. Loss of Lkb1 and Pten leads to lung squamous cell carcinoma with elevated PD-L1 expression. Cancer Cell 2014, 25, 590–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.; Shin, J.H.; Longmire, M.; Wang, H.; Kohrt, H.E.; Chang, H.Y.; Sunwoo, J.B. CD44+ Cells in Head and Neck Squamous Cell Carcinoma Suppress T-Cell-Mediated Immunity by Selective Constitutive and Inducible Expression of PD-L1. Clin. Cancer Res. 2016, 22, 3571–3581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishida, N.; Sakai, K.; Morita, M.; Aoki, T.; Takita, M.; Hagiwara, S.; Komeda, Y.; Takenaka, M.; Minami, Y.; Ida, H.; et al. Association between Genetic and Immunological Background of Hepatocellular Carcinoma and Expression of Programmed Cell Death-1. Liver Cancer 2020, 9, 426–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, P.; Xiong, Y.; Yue, J.; Hanley, S.J.B.; Watari, H. Tumor-Intrinsic PD-L1 Signaling in Cancer Initiation, Development and Treatment: Beyond Immune Evasion. Front. Oncol. 2018, 8, 386. [Google Scholar] [CrossRef] [Scilit]
- Almozyan, S.; Colak, D.; Mansour, F.; Alaiya, A.; Al-Harazi, O.; Qattan, A.; Al-Mohanna, F.; Al-Alwan, M.; Ghebeh, H. PD-L1 promotes OCT4 and Nanog expression in breast cancer stem cells by sustaining PI3K/AKT pathway activation. Int. J. Cancer 2017, 141, 1402–1412. [Google Scholar] [CrossRef] [Scilit]
- Gupta, H.B.; Clark, C.A.; Yuan, B.; Sareddy, G.; Pandeswara, S.; Padron, A.S.; Hurez, V.; Conejo-Garcia, J.; Vadlamudi, R.; Li, R.; et al. Tumor cell-intrinsic PD-L1 promotes tumor-initiating cell generation and functions in melanoma and ovarian cancer. Signal Transduct. Target Ther. 2016, 1. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.L.; Shen, M.N.; Hu, B.; Wang, B.L.; Yang, W.J.; Lv, L.H.; Wang, H.; Zhou, Y.; Jin, A.L.; Sun, Y.F.; et al. CD73 promotes hepatocellular carcinoma progression and metastasis via activating PI3K/AKT signaling by inducing Rap1-mediated membrane localization of P110β and predicts poor prognosis. J. Hematol. Oncol. 2019, 12, 37. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.L.; Hu, B.; Tang, W.G.; Xie, S.H.; Ren, N.; Guo, L.; Lu, R.Q. CD73 sustained cancer-stem-cell traits by promoting SOX9 expression and stability in hepatocellular carcinoma. J. Hematol. Oncol. 2020, 13, 11. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Zaidi, S.; Rao, S.; Chen, J.S.; Phan, L.; Farci, P.; Su, X.; Shetty, K.; White, J.; Zamboni, F.; et al. Analysis of Genomes and Transcriptomes of Hepatocellular Carcinomas Identifies Mutations and Gene Expression Changes in the Transforming Growth Factor-β Pathway. Gastroenterology 2018, 154, 195–210. [Google Scholar] [CrossRef] [Scilit]
- Cavalcante, G.C.; Schaan, A.P.; Cabral, G.F.; Santana-da-Silva, M.N.; Pinto, P.; Vidal, A.F.; Ribeiro-Dos-Santos, Â. A Cell’s Fate: An Overview of the Molecular Biology and Genetics of Apoptosis. Int. J. Mol. Sci. 2019, 20, 4133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, W.; Luo, X.; Li, W.; Zhong, J.; Cao, J.; Zhu, S.; Chen, X.; Zhou, R.; Shang, C.; Chen, Y. TNF-α is a potential therapeutic target to overcome sorafenib resistance in hepatocellular carcinoma. EBioMedicine 2019, 40, 446–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, J.M.; Xia, W.; Hsu, Y.H.; Chan, L.C.; Yu, W.H.; Cha, J.H.; Chen, C.T.; Liao, H.W.; Kuo, C.W.; Khoo, K.H.; et al. STT3-dependent PD-L1 accumulation on cancer stem cells promotes immune evasion. Nat. Commun. 2018, 9, 1908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Broutier, L.; Mastrogiovanni, G.; Verstegen, M.M.; Francies, H.E.; Gavarró, L.M.; Bradshaw, C.R.; Allen, G.E.; Arnes-Benito, R.; Sidorova, O.; Gaspersz, M.P.; et al. Human primary liver cancer-derived organoid cultures for disease modeling and drug screening. Nat. Med. 2017, 23, 1424–1435. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Primers | Sequence (5′-3′) |
|---|---|
| CD133 forward | GCTTCAGGAGTTTCATGTTGG |
| CD133 reverse | GGGGAATGCCTACATCTGG |
| CD44 forward | CCAGAAGGAACAGTGGTTTGGC |
| CD44 reverse | ACTGTCCTCTGGGCTTGGTGTT |
| KL-F4 forward | CATCTCAAGGCACACCTGCGAA |
| KLF-4 reverse | TCGGTCGCATTTTTGGCACTGG |
| OCT-4 forward | TTGTGCCAGGGTTTTTGG |
| OCT-4 reverse | ACTTCACCTTCCCTCCAACC |
| SOX-2 forward | ATGGGTTCGGTGGTCAAGT |
| SOX-2 reverse | GGAGGAAGAGGTAACCACAGG |
| NANOG forward | CTCCAACATCCTGAACCTCAGC |
| NANOG reverse | CGTCACACCATTGCTATTCTTCG |
| Snai1 forward | GCTGCAGGACTCTAATCCAGA |
| Snai1 reverse | ATCTCCGGAGGTGGGATG |
| TGF-β1 forward | TACCTGAACCCGTGTTGCTCTC |
| TGF-β1 reverse | GTTGCTGAGGTATCGCCAGGAA |
| Antibodies | Cat. No. | Manufacturer | Antibody Category | Dilution |
|---|---|---|---|---|
| CD133 | ab19898 | abcam | Primary | 1:500 |
| CD44 | ab157101 | Abcam | Primary | 1:500 |
| TGF-β1 | MA5-15065 | Thermofisher | Primary | 1:1000 |
| p-Smad 2/3 | SC-11769-R | Santa Cruz | Primary | 1:100 |
| Smad 2/3 | SC-133098 | Santa Cruz | Primary | 1:100 |
| β-Actin | 4967s | Cell Signaling | Primary | 1:2000 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shrestha, R.; Bridle, K.R.; Cao, L.; Crawford, D.H.G.; Jayachandran, A. Dual Targeting of Sorafenib-Resistant HCC-Derived Cancer Stem Cells. Curr. Oncol. 2021, 28, 2150-2172. https://doi.org/10.3390/curroncol28030200
Shrestha R, Bridle KR, Cao L, Crawford DHG, Jayachandran A. Dual Targeting of Sorafenib-Resistant HCC-Derived Cancer Stem Cells. Current Oncology. 2021; 28(3):2150-2172. https://doi.org/10.3390/curroncol28030200
Chicago/Turabian StyleShrestha, Ritu, Kim R. Bridle, Lu Cao, Darrell H. G. Crawford, and Aparna Jayachandran. 2021. "Dual Targeting of Sorafenib-Resistant HCC-Derived Cancer Stem Cells" Current Oncology 28, no. 3: 2150-2172. https://doi.org/10.3390/curroncol28030200
APA StyleShrestha, R., Bridle, K. R., Cao, L., Crawford, D. H. G., & Jayachandran, A. (2021). Dual Targeting of Sorafenib-Resistant HCC-Derived Cancer Stem Cells. Current Oncology, 28(3), 2150-2172. https://doi.org/10.3390/curroncol28030200

