Beta-Lactam Antibiotic Resistance Genes in the Microbiome of the Public Transport System of Quito, Ecuador
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Sample Collection
2.2. eDNA Extraction and Gene Amplification
2.3. 16S rDNA Clone Library
2.4. Sequence Analysis
3. Results
3.1. QTP β-Lactam Resistance Genes Screening
3.2. QTP Microbiome
4. Discussions
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Catalano, A.; Iacopetta, D.; Ceramella, J.; Scumaci, D.; Giuzio, F.; Saturnino, C.; Aquaro, S.; Rosano, C.; Sinicropi, M.S. Multidrug Resistance (MDR): A Widespread Phenomenon in Pharmacological Therapies. Molecules 2022, 27, 616. [Google Scholar] [CrossRef] [PubMed]
- Romo-Castillo, H.F.; Pazin-Filho, A. Towards implementing an antibiotic stewardship programme (ASP) in Ecuador: Evaluating antibiotic consumption and the impact of an ASP in a tertiary hospital according to World Health Organization (WHO) recommendations. J. Glob. Antimicrob. Resist. 2021, 29, 462–467. [Google Scholar] [CrossRef] [PubMed]
- Tahlan, K.; Jensen, S.E. Origins of the β-lactam rings in natural products. J. Antibiot. 2013, 66, 401–410. [Google Scholar] [CrossRef] [PubMed]
- Tooke, C.L.; Hinchliffe, P.; Bragginton, E.C.; Colenso, C.K.; Hirvonen, V.H.A.; Takebayashi, Y.; Spencer, J. β-Lactamases and β-Lactamase Inhibitors in the 21st Century. J. Mol. Biol. 2019, 431, 3472–3500. [Google Scholar] [CrossRef] [PubMed]
- Castanheira, M.; Simner, P.J.; Bradford, P.A. Extended-spectrum β-lactamases: An update on their characteristics, epidemiology and detection. JAC-Antimicrob. Resist. 2021, 3, dlab092. [Google Scholar] [CrossRef]
- Paterson, D.L.; Bonomo, R.A. Extended-Spectrum β-Lactamases: A Clinical Update. Clin. Microbiol. Rev. 2005, 18, 657–686. [Google Scholar] [CrossRef]
- Gutiérrez-Gutiérrez, B.; Rodríguez-Baño, J. Current options for the treatment of infections due to extended-spectrum beta-lactamase-producing Enterobacteriaceae in different groups of patients. Clin. Microbiol. Infect. 2019, 25, 932–942. [Google Scholar] [CrossRef]
- Boyd, S.E.; Livermore, D.M.; Hooper, D.C.; Hope, W.W. Metallo-β-Lactamases: Structure, Function, Epidemiology, Treatment Options, and the Development Pipeline. Antimicrob. Agents Chemother. 2020, 64, e00397-20. [Google Scholar] [CrossRef]
- Algammal, A.M.; Hetta, H.F.; Elkelish, A.; Alkhalifah, D.H.H.; Hozzein, W.N.; Batiha, G.E.-S.; El Nahhas, N.; AMabrok, M. Methicillin-Resistant Staphylococcus aureus (MRSA): One Health Perspective Approach to the Bacterium Epidemiology, Virulence Factors, Antibiotic-Resistance, and Zoonotic Impact. Infect. Drug Resist. 2020, 13, 3255–3265. [Google Scholar] [CrossRef]
- Ubukata, K.; Nonoguchi, R.; Matsuhashi, M.; Konno, M. Expression and inducibility in Staphylococcus aureus of the mecA gene, which encodes a methicillin-resistant S. aureus-specific penicillin-binding protein. J. Bacteriol. 1989, 171, 2882–2885. [Google Scholar] [CrossRef]
- Shore, A.C.; Rossney, A.S.; Brennan, O.M.; Kinnevey, P.M.; Humphreys, H.; Sullivan, D.J.; Goering, R.V.; Ehricht, R.; Monecke, S.; Coleman, D.C. Characterization of a Novel Arginine Catabolic Mobile Element (ACME) and Staphylococcal Chromosomal Cassette mec Composite Island with Significant Homology to Staphylococcus epidermidis ACME Type II in Methicillin-Resistant Staphylococcus aureus Genotype ST22-MRSA-IV. Antimicrob. Agents Chemother. 2011, 55, 1896–1905. [Google Scholar] [CrossRef] [PubMed]
- Becker, K.; van Alen, S.; Idelevich, E.A.; Schleimer, N.; Seggewiß, J.; Mellmann, A.; Kaspar, U.; Peters, G. Plasmid-Encoded Transferable mecB-Mediated Methicillin Resistance in Staphylococcus aureus. Emerg. Infect. Dis. 2018, 24, 242–248. [Google Scholar] [CrossRef] [PubMed]
- Lakhundi, S.; Zhang, K. Methicillin-Resistant Staphylococcus aureus: Molecular Characterization, Evolution, and Epidemiology. Clin. Microbiol. Rev. 2018, 31, e00020-18. [Google Scholar] [CrossRef]
- Larsson, D.G.J.; Flach, C.F. Antibiotic Resistance in the Environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Global Action Plan on Antmicrobial Resistance; World Health Organization: Geneva, Switzerland, 2018; Volume 1, pp. 1–28. [Google Scholar]
- The MetaSUB International Consortium. The Metagenomics and Metadesign of the Subways and Urban Biomes (MetaSUB) International Consortium inaugural meeting report. Microbiome 2016, 4, 24. [Google Scholar] [CrossRef] [PubMed]
- Klimenko, N.S.; Tyakht, A.V.; Toshchakov, S.V.; Shevchenko, M.A.; Korzhenkov, A.A.; Afshinnekoo, E.; Mason, C.E.; Alexeev, D.G. Co-occurrence patterns of bacteria within microbiome of Moscow subway. Comput. Struct. Biotechnol. J. 2020, 18, 314–322. [Google Scholar] [CrossRef]
- Naranjo-Villavicencio, M. Public Policies and Urbanization in the Metropolitan District of Quito. Rev. Latinoam. De Política Y Acción Pública 2022, 9, 9–26. [Google Scholar]
- Rawlinson, S.; Ciric, L.; Cloutman-Green, E. How to carry out microbiological sampling of healthcare environment surfaces? A review of current evidence. J. Hosp. Infect. 2019, 103, 363–374. [Google Scholar] [CrossRef]
- Yamaguchi, T.; Kawahara, R.; Harada, K.; Teruya, S.; Nakayama, T.; Motooka, D.; Nakamura, S.; Nguyen, P.D.; Kumeda, Y.; Van Dang, C.; et al. The presence of colistin resistance gene mcr-1 and -3 in ESBL producing Escherichia coli isolated from food in Ho Chi Minh City, Vietnam. FEMS Microbiol. Lett. 2018, 365, fni100. [Google Scholar] [CrossRef]
- Bastidas, C.A.; Villacrés-Granda, I.; Navarrete, D.; Monsalve, M.; Coral-Almeida, M.; Cifuentes, S.G. Antibiotic susceptibility profile and prevalence of mecA and lukS-PV/lukF-PV genes in Staphylococcus aureus isolated from nasal and pharyngeal sources of medical students in Ecuador. Infect. Drug Resist. 2019, 12, 2553–2560. [Google Scholar] [CrossRef]
- Chen, Y.-L.; Lee, C.-C.; Lin, Y.-L.; Yin, K.-M.; Ho, C.-L.; Liu, T. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples. BMC Bioinform. 2015, 16, S13. [Google Scholar] [CrossRef] [PubMed]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; McClure, J.-A.; Elsayed, S.; Louie, T.; Conly, J.M. Novel Multiplex PCR Assay for Characterization and Concomitant Subtyping of Staphylococcal Cassette Chromosome mec Types I to V in Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 5026–5033. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 1983, 166, 557–580. [Google Scholar] [CrossRef] [PubMed]
- Birnboim, H.; Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 1979, 7, 1513–1523. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Srivastava, A.; Galaev, I.Y.; Mattiasson, B. Smart polymers: Physical forms and bioengineering applications. Prog. Polym. Sci. 2007, 32, 1205–1237. [Google Scholar] [CrossRef]
- Schloss, P.D.; Westcott, S.L. Assessing and Improving Methods Used in Operational Taxonomic Unit-Based Approaches for 16S rRNA Gene Sequence Analysis. Appl. Environ. Microbiol. 2011, 77, 3219–3226. [Google Scholar] [CrossRef]
- Wood, D.E.; Salzberg, S.L. Kraken: Ultrafast metagenomic sequence classification using exact alignments. Genome Biol. 2014, 15, R46. [Google Scholar] [CrossRef]
- Ondov, B.D.; Bergman, N.H.; Phillippy, A.M. Interactive metagenomic visualization in a Web browser. BMC Bioinform. 2011, 12, 385. [Google Scholar] [CrossRef]
- Cuccuru, G.; Orsini, M.; Pinna, A.; Sbardellati, A.; Soranzo, N.; Travaglione, A.; Uva, P.; Zanetti, G.; Fotia, G. Orione, a web-based framework for NGS analysis in microbiology. Bioinformatics 2014, 30, 1928–1929. [Google Scholar] [CrossRef]
- Mahalingam, N.; Manivannan, B.; Khamari, B.; Siddaramappa, S.; Adak, S.; Bulagonda, E.P. Detection of Antibiotic Resistance Determinants and Their Transmissibility among Clinically Isolated Carbapenem-Resistant Escherichia coli from South India. Med. Princ. Pract. 2018, 27, 428–435. [Google Scholar] [CrossRef] [PubMed]
- Bastidas-Caldes, C.; Romero-alvarez, D.; Valdez-vélez, V.; Morales, R.D.; Montalvo-hernández, A.; Gomes-dias, C.; Calvopiña, M. Extended-Spectrum Beta-Lactamases Producing Escherichia Coli in South America: A Systematic Review with a One Health Perspective. Infect. Drug Resist. 2022, 15, 5759–5779. [Google Scholar] [CrossRef] [PubMed]
- Brito, B.P.; Koong, J.; Wozniak, A.; Opazo-Capurro, A.; To, J.; Garcia, P.; Hamidian, M. Genomic Analysis of Carbapenem-Resistant Acinetobacter baumannii Strains Recovered from Chilean Hospitals Reveals Lineages Specific to South America and Multiple Routes for Acquisition of Antibiotic Resistance Genes. Microbiol. Spectr. 2022, 10, e0246322. [Google Scholar] [CrossRef] [PubMed]
- Richards, A.; Abu Kwaik, Y.; Lamont, R. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity. Mol. Oral Microbiol. 2014, 30, 2–15. [Google Scholar] [CrossRef] [PubMed]
- Manishimwe, R.; Moncada, P.M.; Bugarel, M.; Scott, H.M.; Loneragan, G.H. Antibiotic resistance among Escherichia coli and Salmonella isolated from dairy cattle feces in Texas. PLoS ONE 2021, 16, e0242390. [Google Scholar] [CrossRef] [PubMed]
- Debergh, H.; Maex, M.; Garcia-Graells, C.; Boland, C.; Saulmont, M.; Van Hoorde, K.; Saegerman, C. First Belgian Report of Ertapenem Resistance in an ST11 Klebsiella Pneumoniae Strain Isolated from a Dog Carrying blaSCO-1 and blaDHA-1 Combined with Permeability Defects. Antibiotics 2022, 11, 1253. [Google Scholar] [CrossRef]
- Wyres, K.L.; Lam, M.M.C.; Holt, K.E. Population genomics of Klebsiella pneumoniae. Nat. Rev. Microbiol. 2020, 18, 344–359. [Google Scholar] [CrossRef]
- Bratulic, S.; Toll-Riera, M.; Wagner, A. Mistranslation can enhance fitness through purging of deleterious mutations. Nat. Commun. 2017, 8, 15410. [Google Scholar] [CrossRef]
- Chaibi, E.B.; Sirot, D.; Paul, G.; Labia, R. Inhibitor-resistant TEM -lactamases: Phenotypic, genetic and biochemical characteristics. J. Antimicrob. Chemother. 1999, 43, 447–458. [Google Scholar] [CrossRef]
- Yang, J.-J.; Cheng, A.; Tai, H.-M.; Chang, L.-W.; Hsu, M.-C.; Sheng, W.-H. Selected Mutations by Nemonoxacin and Fluoroquinolone Exposure among Relevant Gram-Positive Bacterial Strains in Taiwan. Microb. Drug Resist. 2020, 26, 110–117. [Google Scholar] [CrossRef]
- Mendonça, J.; Guedes, C.; Silva, C.; Sá, S.; Oliveira, M.; Accioly, G.; Baylina, P.; Barata, P.; Pereira, C.; Fernandes, R. New CTX-M Group Conferring β-Lactam Resistance: A Compendium of Phylogenetic Insights from Biochemical, Molecular, and Structural Biology. Biology 2022, 11, 256. [Google Scholar] [CrossRef] [PubMed]
- Poirel, L.; Madec, J.-Y.; Lupo, A.; Schink, A.-K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial Resistance in Escherichia coli. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [PubMed]
- Baroja, I.; Guerra, S.; Coral-Almeida, M.; Ruíz, A.; Galarza, J.M.; de Waard, J.H.; Bastidas-Caldes, C. Methicillin-Resistant Staphylococcus aureus Nasal Colonization among Health Care Workers of a Tertiary Hospital in Ecuador and Associated Risk Factors. Infect. Drug Resist. 2021, 14, 3433–3440. [Google Scholar] [CrossRef]
- Nimer, N.A. Nosocomial Infection and Antibiotic-Resistant Threat in the Middle East. Infect. Drug Resist. 2022, 15, 631–639. [Google Scholar] [CrossRef] [PubMed]
- Rey, J.; Gil, M.; de Mendoza, J.H.; García, A.; Gaitskell-Phillips, G.; Bastidas-Caldes, C.; Zalama, L. Clonality and Persistence of Multiresistant Methicillin-Resistant Coagulase-Negative Staphylococci Isolated from the Staff of a University Veterinary Hospital. Antibiotics 2022, 11, 811. [Google Scholar] [CrossRef] [PubMed]
- Gohli, J.; Bøifot, K.O.; Moen, L.V.; Pastuszek, P.; Skogan, G.; Udekwu, K.I.; Dybwad, M. The subway microbiome: Seasonal dynamics and direct comparison of air and surface bacterial communities. Microbiome 2019, 7, 160. [Google Scholar] [CrossRef]
- GBD 2019 Antimicrobial Resistance Collaborators Global Mortality Associated with 33 Bacterial Pathogens in 2019: A Systematic Analysis for the Global Burden of Disease Study 2019. Lancet 2022, 6736, 2221–2248. [CrossRef]
- Tyakht, A.V.; Manolov, A.I.; Kanygina, A.V.; Ischenko, D.S.; Kovarsky, B.A.; Popenko, A.S.; Pavlenko, A.V.; Elizarova, A.V.; Rakitina, D.V.; Baikova, J.P.; et al. Genetic diversity of Escherichia coli in gut microbiota of patients with Crohn’s disease discovered using metagenomic and genomic analyses. BMC Genom. 2018, 19, 968. [Google Scholar] [CrossRef]
- Otter, J.; French, G. Bacterial contamination on touch surfaces in the public transport system and in public areas of a hospital in London. Lett. Appl. Microbiol. 2009, 49, 803–805. [Google Scholar] [CrossRef]
- Conceição, T.; Diamantino, M.; Coelho, C.; De Lencastre, H.; Aires-De-Sousa, M. Contamination of Public Buses with MRSA in Lisbon, Portugal: A Possible Transmission Route of Major MRSA Clones within the Community. PLoS ONE 2013, 8, e77812. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Ou, Q.; Lin, D.; Xu, P.; Li, Y.; Ye, X.; Zhou, J.; Yao, Z. Metro system in Guangzhou as a hazardous reservoir of methicillin-resistant Staphylococci: Findings from a point-prevalence molecular epidemiologic study. Sci. Rep. 2015, 5, 16087. [Google Scholar] [CrossRef] [PubMed]
- Iwao, Y.; Yabe, S.; Takano, T.; Higuchi, W.; Nishiyama, A.; Yamamoto, T. Isolation and molecular characterization of methicillin-resistant Staphylococcus aureus from public transport. Microbiol. Immunol. 2011, 56, 76–82. [Google Scholar] [CrossRef] [PubMed]
- Yamada, K.; Kashiwa, M.; Arai, K.; Satoyoshi, K.; Nishiyama, H. Pantoea calida bacteremia in an adult with end-stage stomach cancer under inpatient care. J. Infect. Chemother. 2017, 23, 407–409. [Google Scholar] [CrossRef] [PubMed]
- Ioannou, P.; Vougiouklakis, G. A Systematic Review of Human Infections by Pseudomonas mendocina. Trop. Med. Infect. Dis. 2020, 5, 71. [Google Scholar] [CrossRef] [PubMed]
- Visca, P.; Petrucca, A.; de Mori, P.; Festa, A.; Boumis, E.; Antinori, A.; Petrosillo, N. Community-Acquired Acinetobacter Radioresistens Bacteremia in an HIV-Positive Patient. Emerg. Infect. Dis. 2001, 7, 1032–1035. [Google Scholar] [CrossRef]
- Oude Munnink, B.B.; Worp, N.; Nieuwenhuijse, D.F.; Sikkema, R.S.; Haagmans, B.; Fouchier, R.A.M.; Koopmans, M. The next Phase of SARS-CoV-2 Surveillance: Real-Time Molecular Epidemiology. Nat. Med. 2021, 27, 1518–1524. [Google Scholar] [CrossRef]


| Gene | Primer’s Name | Sequence (5′-3′) | PCR Product (bp) | Annealing (°C) | Reference | 
|---|---|---|---|---|---|
| 16S rDNA | 8F | AGAGTTTGATCCTGGCTCAG | 527 | 57.4 | [22] | 
| 534R | ATTACCGCGGCTGCTGG | ||||
| blaTEM | TEM-410F | GGTCGCCGCATACACTATTCTC | 372 | 60 | [20] | 
| TEM-781R | TTTATCCGCCTCCATCCAGTC | ||||
| blaSHV | SHV-287F | CCAGCAGGATCTGGTGGACTA | 231 | ||
| SHV-517R | CCGGGAAGCGCCTCAT | ||||
| blaCTXM-1 | ctxm1-115F | GAATTAGAGCGGCAGTCGGG | 588 | ||
| ctxm1-702R | CACAACCCAGGAAGCAGGC | ||||
| blaCTXM-2 | ctxm2-39F | GATGGCGACGCTACCCC | 107 | ||
| ctxm2-145R | CAAGCCGACCTCCCGAAC | ||||
| blaCTXM-9 | ctxm9-16F | GTGCAACGGATGATGTTCGC | 475 | ||
| ctxm9-490R | GAAACGTCTCATCGCCGATC | ||||
| blaCTXM-8/25 | ctxm8g25g-533F | GCGACCCGCGCGATAC | 186 | ||
| ctxm8g25g-718R | TGCCGGTTTTATCCCCG | ||||
| blaKPC | KPCfw | CGTCTAGTTCTGCTGTCTTG | 798 | 55 | [23] | 
| KPCrv | CTTGTCATCCTTGTTAGGCG | ||||
| blaVIM | VIMfw | GATGGTGTTTGGTCGCATA | 390 | ||
| VIMrv | CGAATGCGCAGCACCAG | ||||
| blaNDM | NDMfw | GGTTTGGCGATCTGGTTTTC | 621 | ||
| NDMrv | CGGAATGGCTCATCACGATC | ||||
| blaOXA-48/181 | OXA48fw | GCGTGGTTAAGGATGAACAC | 438 | ||
| OXA48rv | CATCAAGTTCAACCCAACCG | ||||
| mecA | mecA147-F | GTGAAGATATACCAAGTGATT | 147 | [24] | |
| mecA147-R | ATGCGCTATAGATTGAAAGGAT | ||||
| mecDrv | CTCCCATCTTTTCTCCATCCT | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hernández-Alomía, F.; Bastidas-Caldes, C.; Ballesteros, I.; Tenea, G.N.; Jarrín-V., P.; Molina, C.A.; Castillejo, P. Beta-Lactam Antibiotic Resistance Genes in the Microbiome of the Public Transport System of Quito, Ecuador. Int. J. Environ. Res. Public Health 2023, 20, 1900. https://doi.org/10.3390/ijerph20031900
Hernández-Alomía F, Bastidas-Caldes C, Ballesteros I, Tenea GN, Jarrín-V. P, Molina CA, Castillejo P. Beta-Lactam Antibiotic Resistance Genes in the Microbiome of the Public Transport System of Quito, Ecuador. International Journal of Environmental Research and Public Health. 2023; 20(3):1900. https://doi.org/10.3390/ijerph20031900
Chicago/Turabian StyleHernández-Alomía, Fernanda, Carlos Bastidas-Caldes, Isabel Ballesteros, Gabriela N. Tenea, Pablo Jarrín-V., C. Alfonso Molina, and Pablo Castillejo. 2023. "Beta-Lactam Antibiotic Resistance Genes in the Microbiome of the Public Transport System of Quito, Ecuador" International Journal of Environmental Research and Public Health 20, no. 3: 1900. https://doi.org/10.3390/ijerph20031900
APA StyleHernández-Alomía, F., Bastidas-Caldes, C., Ballesteros, I., Tenea, G. N., Jarrín-V., P., Molina, C. A., & Castillejo, P. (2023). Beta-Lactam Antibiotic Resistance Genes in the Microbiome of the Public Transport System of Quito, Ecuador. International Journal of Environmental Research and Public Health, 20(3), 1900. https://doi.org/10.3390/ijerph20031900
 
        



 
                         
       