Analysis of Environmental and Pathogenic Bacteria Attached to Aerosol Particles Size-Separated with a Metal Mesh Device
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of the MMD Filter Units
2.2. Collection of Aerosol Particles
2.3. Analysis of Particle Size Distribution
2.4. Particle Counting by IR Transmittance Measurements
2.5. Extraction of DNA from Aerosol Particles
2.6. Preparation of 16S rDNA Samples
2.7. Metagenomic Analysis Based on 16S rDNA Sequence Data
2.8. Detection of the Genus Mycobacterium
3. Results
3.1. Microflora Analysis of Aerosol Particles on MMDs
3.2. Detection of Mycobacterium spp.
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Douwes, J.; Thorne, P.; Pearce, N.; Heederik, D. Bioaerosol health effects and exposure assessment: Progress and prospects. Ann. Occup. Hyg. 2003, 47, 187–200. [Google Scholar] [PubMed]
- Griffin, D.W. Atmospheric movement of microorganisms in clouds of desert dust and implications for human health. Clin. Microbiol. Rev. 2007, 20, 459–477. [Google Scholar] [CrossRef] [PubMed]
- Delfino, R.J.; Sioutas, C.; Malik, S. Potential role of ultrafine particles in associations between airborne particle mass and cardiovascular health. Environ. Health Perspect. 2005, 113, 934–946. [Google Scholar] [CrossRef] [PubMed]
- Donaldson, K.; Stone, V.; Seaton, A.; MacNee, W. Ambient particle inhalation and the cardiovascular system: Potential mechanisms. Environ. Health Perspect. 2001, 109, 523–527. [Google Scholar]
- Tomos, I.; Dimakopoulou, K.; Manali, E.D.; Papiris, S.A.; Karakatsani, A. Long-term personal air pollution exposure and risk for acute exacerbation of idiopathic pulmonary fibrosis. Environ. Health 2021, 20, 99. [Google Scholar] [CrossRef]
- Chatkin, J.; Correa, L.; Santos, U. External environmental pollution as a risk factor for asthma. Clin. Rev. Allergy Immunol. 2022, 62, 72–89. [Google Scholar] [CrossRef]
- Dong, L.; Qi, J.; Shao, C.; Zhong, X.; Gao, D.; Cao, W.; Gao, J.; Bai, R.; Long, G.; Chu, C. Concentration and size distribution of total airborne microbes in hazy and foggy weather. Sci. Total Environ. 2016, 541, 1011–1018. [Google Scholar] [CrossRef]
- Acuña, J.J.; Ruiz-Gil, T.; Marileo, L.; Carrazana, E.; Rilling, J.; Campos, M.; Correa-Araneda, F.; Fujiyoshi, S.; Jorquera, M.A. Airborne bacterial community associated with fine particulate matter (PM 2.5) under different air quality indices in Temuco city, southern Chile. Arch. Microbiol. 2022, 204, 148–157. [Google Scholar] [CrossRef]
- Griffin, D.W.; Garrison, V.H.; Herman, J.R.; Shinn, E.A. African desert dust in the Caribbean atmosphere: Microbiology and public health. Aerobiologia 2001, 17, 203–213. [Google Scholar] [CrossRef]
- Kellogg, C.A.; Griffin, D.W.; Garrison, V.H.; Peak, K.K.; Royall, N.; Smith, R.R.; Shinn, E.A. Characterization of aerosolized bacteria and fungi from desert dust events in Mali, West Africa. Aerobiologia 2004, 20, 99–110. [Google Scholar] [CrossRef]
- Griffin, D.W.; Westphal, D.L.; Gray, M.A. Airborne microorganisms in the African desert dust corridor over the mid-Atlantic ridge, Ocean Drilling Program, Leg 209. Aerobiologia 2006, 22, 211–226. [Google Scholar] [CrossRef]
- Den Boer, J.W.; Yzerman, P.F.; Schellekens, J.; Lettinga, K.D.; Boshuizen, H.C.; Van Steenbergen, J.E.; Bosman, A.; Van den Hof, S.; Van Vliet, H.A.; Peeters, M.F.; et al. A large outbreak of Legionnaires’ disease at a flower show, the Netherlands, 1999. Emerg. Infect. Dis. 2002, 8, 37–43. [Google Scholar] [CrossRef]
- Vermeulen, L.C.; Brandsema, P.; van de Kassteele, J.; Bom, B.; Sterk, H.; Sauter, F.; Berg, H.V.D.; Husman, A.D.R. Atmospheric dispersion and transmission of Legionella from wastewater treatment plants: A 6-year case-control study. Int. J. Hyg. Environ. Health 2021, 237, 113811. [Google Scholar] [CrossRef]
- Linsak, D.T.; Kese, D.; Broznic, D.; Lusic, D.V.; Cenov, A.; Moric, M.; Gobin, I. Sea water whirlpool spa as a source of Legionella infection. J. Water Health 2021, 19, 242–253. [Google Scholar] [CrossRef]
- Rodó, X.; Ballester, J.; Cayan, D.; Melish, M.E.; Nakamura, Y.; Uehara, R.; Burns, J.C. Association of Kawasaki disease with tropospheric wind patterns. Sci. Rep. 2011, 1, 152. [Google Scholar] [CrossRef]
- Wong, T.-W.; Lee, C.-K.; Tam, W.; Lau, J.T.-F.; Yu, T.-S.; Lui, S.-F.; Chan, P.; Li, Y.; Bresee, J.S.; Sung, J.J.Y.; et al. Cluster of SARS among medical students exposed to single patient, Hong Kong. Emerg. Infect. Dis. 2004, 10, 269–276. [Google Scholar] [CrossRef]
- Kutter, J.S.; Spronken, M.I.; Fraaij, P.L.; Fouchier, R.A.; Herfst, S. Transmission routes of respiratory viruses among humans. Curr. Opin. Virol. 2018, 28, 142–151. [Google Scholar] [CrossRef]
- Stadnytskyi, V.; Bax, C.E.; Bax, A.; Anfinrud, P. The airborne lifetime of small speech droplets and their potential importance in SARS-CoV-2 transmission. Proc. Natl. Acad. Sci. USA 2020, 117, 11875–11877. [Google Scholar] [CrossRef]
- Bu, Y.; Ooka, R.; Kikumoto, H.; Oh, W. Recent research on expiratory particles in respiratory viral infection and control strategies: A review. Sustain. Cities Soc. 2021, 73, 103106. [Google Scholar] [CrossRef]
- Jayaweera, M.; Perera, H.; Gunawardena, B.; Manatunge, J. Transmission of COVID-19 virus by droplets and aerosols: A critical review on the unresolved dichotomy. Environ. Res. 2020, 188, 109819. [Google Scholar] [CrossRef]
- Pulawska, A.; Manecki, M.; Flasza, M.; Styszko, K. Origin, distribution, and perspective health benefits of particulate matter in the air of underground salt mine: A case study from Bochnia, Poland. Environ. Geochem. Health 2021, 43, 3533–3556. [Google Scholar] [CrossRef]
- Seto, H.; Yamashita, C.; Kamba, S.; Kondo, T.; Hasegawa, M.; Matsuno, M.; Ogawa, Y.; Hoshino, Y.; Miura, Y. Biotinylation of silicon and nickel surfaces and detection of streptavidin as biosensor. Langmuir 2013, 29, 9457–9463. [Google Scholar] [CrossRef]
- Kamba, S.; Seto, H.; Kondo, T.; Miura, Y. Quantitative measurement of protein using metal mesh device. Anal. Sci. 2017, 33, 1033–1039. [Google Scholar] [CrossRef]
- Seto, H.; Kamba, S.; Kondo, T.; Ogawa, Y.; Hoshino, Y.; Miura, Y. Novel detection technique for particulate matter in air using metal mesh device sensors. Chem. Lett. 2014, 43, 408–410. [Google Scholar] [CrossRef]
- Kawara, N.; Kumita, M.; Kurachi, H.; Seto, T.; Kamba, S.; Kondo, T.; Otani, Y. Sieving of aerosol particles with metal screens. Aerosol Sci. Technol. 2016, 50, 535–541. [Google Scholar] [CrossRef]
- Murray, C.J.; Ortblad, K.F.; Guinovart, C.; Lim, S.S.; Wolock, T.M.; Roberts, D.A.; Dansereau, E.A.; Graetz, N.; Barber, R.M.; Brown, J.C.; et al. Global, regional, and national incidence and mortality for HIV, tuberculosis, and malaria during 1990–2013: A systematic analysis for the global burden of disease study 2013. Lancet 2014, 384, 1005–1070. [Google Scholar] [CrossRef]
- Dethlefsen, L.; Huse, S.; Sogin, M.L.; Relman, D.A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biol. 2008, 6, e280. [Google Scholar] [CrossRef]
- Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Gonzalez Peña, A.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef]
- DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E.L.; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 2006, 72, 5069–5072. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, V.D.F.S.; Queiroz Mello, F.C.; Ribeiro, M.O.; Fonseca, L.; Kritski, A.L.; Rossetti, M.L.; Zaha, A. Detection of Mycobacterium avium in blood samples of patients with AIDS by using PCR. J. Clin. Microbiol. 2002, 40, 2297–2299. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Boddinghaus, B.; Rogall, T.; Flohr, T.; Blocker, H.; Bottger, E.C. Detection and identification of mycobacteria by amplification of rRNA. J. Clin. Microbiol. 1990, 28, 1751–1759. [Google Scholar] [CrossRef] [PubMed]
- Dommergue, A.; Amato, P.; Tignat-Perrier, R.; Magand, O.; Thollot, A.; Joly, M.; Bouvier, L.; Sellegri, K.; Vogel, T.; Sonke, J.E.; et al. Methods to investigate the global atmospheric microbiome. Front. Microbiol. 2019, 10, 243. [Google Scholar] [CrossRef]
- Šantl-Temkiv, T.; Amato, P.; Gosewinkel, U.; Thyrhaug, R.; Charton, A.; Chicot, B.; Finster, K.; Bratbak, G.; Londahl, J. High-flow-rate impinger for the study of concentration, viability, metabolic activity, and ice-nucleation activity of airborne bacteria. Environ. Sci. Technol. 2017, 51, 11224–11234. [Google Scholar] [CrossRef]
- McFeters, G.A.; Cameron, S.C.; LeChevallier, M.W. Influence of diluents, media, and membrane filters on detection for injured waterborne coliform bacteria. Appl. Environ. Microbiol. 1982, 43, 97–103. [Google Scholar] [CrossRef]
- Tobin, R.S.; Lomax, P.; Kushner, D.J. Comparison of nine brands of membrane filter and the most-probable-number methods for total coliform enumeration in sewage-contaminated drinking water. Appl. Environ. Microbiol. 1980, 40, 186–191. [Google Scholar] [CrossRef]
- Bowers, R.M.; Clements, N.; Emerson, J.B.; Wiedinmyer, C.; Hannigan, M.P.; Fierer, N. Seasonal variability in bacterial and fungal diversity of the near-surface atmosphere. Environ. Sci. Technol. 2013, 47, 12097–12106. [Google Scholar] [CrossRef]
- Kaarakainen, P.; Meklin, T.; Rintala, H.; Hyvärinen, A.; Kärkkäinen, P.; Vepsäläinen, A.; Hirvonen, M.-R.; Nevalainen, A. Seasonal variation in airborne microbial concentrations and diversity at landfill, urban and rural sites. CLEAN—Soil Air Water 2008, 36, 556–563. [Google Scholar] [CrossRef]
- Pumkaeo, P.; Iwahashi, H. Bioaerosol sources, sampling methods, and major categories: A comprehensive overview. Rev. Agric. Sci. 2020, 8, 261–278. [Google Scholar] [CrossRef]
- Tanaka, D.; Terada, Y.; Nakashima, T.; Sakatoku, A.; Nakamura, S. Seasonal variations in airborne bacterial community structures at a suburban site of central Japan over a 1-year time period using PCR-DGGE method. Aerobiologia 2015, 31, 143–157. [Google Scholar] [CrossRef]
- Samutela, M.T.; Kwenda, G.; Simulundu, E.; Nkhoma, P.; Higashi, H.; Frey, A.; Bates, M.; Hang’ombe, B.M. Pigs as a potential source of emerging livestock-associated Staphylococcus aureus in Africa: A systematic review. Int. J. Infect. Dis. 2021, 109, 38–49. [Google Scholar] [CrossRef]
- Lighthart, B. The ecology of bacteria in the alfresco atmosphere. FEMS Microbiol. Ecol. 1997, 23, 263–274. [Google Scholar] [CrossRef]
Aperture Diameter (D) | Thickness (T) | Period (P) |
---|---|---|
1.0 μm | 0.8 μm | 1.4 μm |
1.8 μm | 1.0 μm | 2.6 μm |
4.5 μm | 1.0 μm | 6.4 μm |
Name | Primer Sequence (5′–3′) |
---|---|
341F | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG |
R805 | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC |
MYCGEN-F | AGAGTTTGATCCTGGCTCAG |
MYCGEN-R | TGCACACAGGCCACAAGGGA |
MMD Size | Reads | OTUs | Family | Genus | Species |
---|---|---|---|---|---|
4.5 μm | 104,884 ± 6138 | 121 ± 18 | 90 ± 16 | 50 ± 12 | 26 ± 7 |
1.8 μm | 105,624 ± 9921 | 104 ± 11 | 83 ± 8 | 53 ± 7 | 23 ± 5 |
1.0 μm | 112,534 ± 2784 | 92 ± 6 | 71 ± 4 | 53 ± 4 | 25 ± 2 |
Rank | Bacteria | Content Rate (%) |
---|---|---|
4.5 μm MMDs | ||
1 | Pseudomonas spp. | 48.896 |
2 | Gammaproteobacteria | 17.592 |
3 | Streptophyta | 5.589 |
4 | Betaproteobacteria | 4.340 |
5 | Enterobacteriaceae | 4.334 |
6 | Actinomycetales | 2.453 |
7 | Propionibacterium spp. | 1.978 |
8 | Staphylococcus saprophyticus | 1.500 |
9 | Corynebacterium spp. | 1.430 |
10 | Enhydrobacter aerosaccus | 0.582 |
1.8 μm MMDs | ||
1 | Pseudomonas spp. | 49.908 |
2 | Gammaproteobacteria | 22.097 |
3 | Enterobacteriaceae | 10.825 |
4 | Nostocales | 1.424 |
5 | Enhydrobacter aerosaccus | 1.022 |
6 | Betaproteobacteria | 0.944 |
7 | Pseudomonas syringae | 0.899 |
8 | Acinetobacter spp. | 0.863 |
9 | Actinomycetales | 0.804 |
10 | Staphylococcus saprophyticus | 0.564 |
1.0 μm MMDs | ||
1 | Pseudomonas spp. | 55.843 |
2 | Gammaproteobacteria | 24.476 |
3 | Enterobacteriaceae | 5.016 |
4 | Enhydrobacter aerosaccus | 1.371 |
5 | Staphylococcus saprophyticus | 1.012 |
6 | Pseudomonas syringae | 0.963 |
7 | Actinomycetales | 0.838 |
8 | Betaproteobacteria | 0.787 |
9 | Acinetobacter spp. | 0.533 |
10 | Propionibacterium spp. | 0.525 |
Content Rate (%) | ||||
---|---|---|---|---|
NO | Bacteria | 4.5 μm | 1.8 μm | 1.0 μm |
1 | Pseudomonas spp. | 48.896 | 49.908 | 55.843 |
2 | Staphylococcus saprophyticus | 1.5 | 0.564 | 1.012 |
3 | Propionibacterium spp. | 1.978 | 0.553 | 0.525 |
4 | Pseudomonas syringae | 0.553 | 0.899 | 0.963 |
5 | Corynebacterium spp. | 1.43 | 0.308 | 0.273 |
6 | Acinetobacter spp. | 0.393 | 0.863 | 0.533 |
7 | Streptococcus spp. | 0.337 | 0.394 | 0.067 |
8 | Elizabethkingia spp. | 0.128 | 0.059 | 0.106 |
9 | Corynebacterium pilosum | 0.006 | 0.137 | 0.074 |
10 | Peptoniphilus spp. | 0 | 0.16 | 0 |
11 | Anaerococcus spp. | 0.145 | 0 | 0 |
12 | Streptococcus equi | 0.058 | 0.087 | 0 |
13 | Bordetella ansorpii | 0 | 0 | 0.126 |
14 | Brevundimonas vesicularis | 0.091 | 0.03 | 0 |
15 | Bacillus spp. | 0 | 0 | 0.116 |
16 | Roseomonas spp. | 0.112 | 0 | 0.004 |
17 | Corynebacterium simulans | 0 | 0.111 | 0 |
18 | Haematobacter massiliensis | 0 | 0.106 | 0 |
19 | Finegoldia spp. | 0 | 0.103 | 0 |
20 | Clostridium paraputrificum | 0 | 0 | 0.097 |
21 | Enterococcus cecorum | 0.055 | 0.035 | 0 |
22 | Helicobacter spp. | 0 | 0 | 0.089 |
23 | Propionibacterium granulosum | 0.072 | 0.01 | 0 |
24 | Kocuria kristinae | 0 | 0.071 | 0 |
25 | Rhodococcus fascians | 0.063 | 0 | 0 |
26 | Rhodococcus spp. | 0 | 0.061 | 0 |
27 | Aeromonas spp. | 0 | 0 | 0.044 |
28 | Bacteroides spp. | 0.043 | 0 | 0 |
29 | Brevibacterium casei | 0 | 0 | 0.035 |
30 | Brevundimonas spp. | 0 | 0.034 | 0 |
31 | Helcobacillus massiliensis | 0 | 0 | 0.022 |
32 | Methanobrevibacter spp. | 0.015 | 0 | 0 |
33 | Bordetella spp. | 0.003 | 0 | 0 |
34 | Rothia spp. | 0.002 | 0 | 0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yin, X.; Kamba, S.; Yamamoto, K.; Ogura, A.; Wandera, E.A.; Shah, M.M.; Seto, H.; Kondo, T.; Ichinose, Y.; Hasegawa, M. Analysis of Environmental and Pathogenic Bacteria Attached to Aerosol Particles Size-Separated with a Metal Mesh Device. Int. J. Environ. Res. Public Health 2022, 19, 5773. https://doi.org/10.3390/ijerph19095773
Yin X, Kamba S, Yamamoto K, Ogura A, Wandera EA, Shah MM, Seto H, Kondo T, Ichinose Y, Hasegawa M. Analysis of Environmental and Pathogenic Bacteria Attached to Aerosol Particles Size-Separated with a Metal Mesh Device. International Journal of Environmental Research and Public Health. 2022; 19(9):5773. https://doi.org/10.3390/ijerph19095773
Chicago/Turabian StyleYin, Xiaobo, Seiji Kamba, Koki Yamamoto, Atsushi Ogura, Ernest Apondi Wandera, Mohammad Monir Shah, Hirokazu Seto, Takashi Kondo, Yoshio Ichinose, and Makoto Hasegawa. 2022. "Analysis of Environmental and Pathogenic Bacteria Attached to Aerosol Particles Size-Separated with a Metal Mesh Device" International Journal of Environmental Research and Public Health 19, no. 9: 5773. https://doi.org/10.3390/ijerph19095773
APA StyleYin, X., Kamba, S., Yamamoto, K., Ogura, A., Wandera, E. A., Shah, M. M., Seto, H., Kondo, T., Ichinose, Y., & Hasegawa, M. (2022). Analysis of Environmental and Pathogenic Bacteria Attached to Aerosol Particles Size-Separated with a Metal Mesh Device. International Journal of Environmental Research and Public Health, 19(9), 5773. https://doi.org/10.3390/ijerph19095773