Association between Vitamin D Receptor Polymorphisms (BsmI and FokI) and Glycemic Control among Patients with Type 2 Diabetes
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Participants
2.2. Power Calculation
2.3. Biochemical Measurements
2.4. Genotyping
2.5. Statistical Analysis
3. Results
3.1. Demographic and Biochemical Parameters
3.2. Distribution of VDR 2228570 C > T (FokI) and VDR 1544410 G > A (BsmI) Gene Polymorphisms among Patients with T2DM Having Good and Poor Glycemic Control
3.3. Association between FokI (VDR 2228570 C > T) and BsmI (VDR 1544410 G > A) and Risk of Insulin Resistance
3.4. Association between FokI (VDR 2228570 C > T) and BsmI (VDR 1544410 G > A) and Glycemic Control Factors
3.5. Association between FokI (VDR 2228570 C > T) and BsmI (VDR 1544410 G > A) and Risk of Obesity
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nair, R.; Maseeh, A. Vitamin D: The “sunshine” vitamin. J. Pharmacol. Pharmacother. 2012, 3, 118. [Google Scholar] [PubMed]
- bt Khaza’ai, H. Review on Potential Vitamin D Mechanism with Type 2 Diabetes Mellitus Pathophysiology in Malaysia. Curr. Res. Nutr. Food Sci. J. 2018, 6, 1–11. [Google Scholar]
- Johnson, J.A.; Grande, J.P.; Roche, P.C.; Kumar, R. Immunohistochemical localization of the 1,25(OH)2D3 receptor and calbindin D28k in human and rat pancreas. Am. J. Physiol. 1994, 267, E356–E360. [Google Scholar] [CrossRef] [PubMed]
- Bland, R.; Markovic, D.; Hills, C.E.; Hughes, S.V.; Chan, S.L.; Squires, P.E.; Hewison, M. Expression of 25-hydroxyvitamin D3-1α-hydroxylase in pancreatic islets. J. Steroid Biochem. Biol. 2004, 89, 121–125. [Google Scholar] [CrossRef] [PubMed]
- Afzal, S.; Bojesen, S.E.; Nordestgaard, B.G. Low 25-hydroxyvitamin D and risk of type 2 diabetes: A prospective cohort study and metaanalysis. Clin. Chem. 2013, 59, 381–391. [Google Scholar] [CrossRef] [PubMed]
- Knekt, P.; Laaksonen, M.; Mattila, C.; Härkänen, T.; Marniemi, J.; Heliövaara, M.; Rissanen, H.; Montonen, J.; Reunanen, A. Serum vitamin D and subsequent occurrence of type 2 diabetes. Epidemiology 2008, 19, 666–671. [Google Scholar] [CrossRef]
- Pittas, A.G.; Harris, S.S.; Stark, P.C.; Dawson-Hughes, B. The effects of calcium and vitamin D supplementation on blood glucose and markers of inflammation in nondiabetic adults. Diabetes Care 2007, 30, 980–986. [Google Scholar] [CrossRef]
- Pittas, A.G.; Lau, J.; Hu, F.B.; Dawson-Hughes, B. The role of vitamin D and calcium in type 2 diabetes. A systematic review and meta-analysis. J. Clin. Endocrinol. Metab. 2007, 92, 2017–2029. [Google Scholar] [CrossRef]
- Talaei, A.; Mohamadi, M.; Adgi, Z. The effect of vitamin D on insulin resistance in patients with type 2 diabetes. Diabetol. Metab. Syndr. 2013, 5, 8. [Google Scholar] [CrossRef] [PubMed]
- Kayaniyil, S.; Retnakaran, R.; Harris, S.B.; Vieth, R.; Knight, J.A.; Gerstein, H.C.; Perkins, B.A.; Zinman, B.; Hanley, A.J. Prospective associations of vitamin D with beta-cell function and glycemia: The PROspective Metabolism and ISlet cell Evaluation (PROMISE) cohort study. Diabetes 2011, 60, 2947–2953. [Google Scholar] [CrossRef] [PubMed]
- Zeitz, U.; Weber, K.; Soegiarto, D.W.; Wolf, E.; Balling, R.; Erben, R.G. Impaired insulin secretory capacity in mice lacking a functional vitamin D receptor. FASEB J. 2003, 17, 509–511. [Google Scholar] [CrossRef] [PubMed]
- Mitri, J.; Dawson-Hughes, B.; Hu, F.B.; Pittas, A.G. Effects of vitamin D and calcium supplementation on pancreatic β cell function, insulin sensitivity, and glycemia in adults at high risk of diabetes: The Calcium and Vitamin D for Diabetes Mellitus (CaDDM) randomized controlled trial. Am. J. Clin. Nutr. 2011, 94, 486–494. [Google Scholar] [CrossRef] [PubMed]
- Haussler, M.R.; Haussler, C.A.; Bartik, L.; Whitfield, G.K.; Hsieh, J.C.; Slater, S.; Jurutka, P.W. Vitamin D receptor: Molecular signaling and actions of nutritional ligands in disease prevention. Nutr. Rev. 2008, 66, S98–S112. [Google Scholar] [CrossRef] [PubMed]
- Palomer, X.; Gonzalez-Clemente, J.M.; Blanco-Vaca, F.; Mauricio, D. Role of vitamin D in the pathogenesis of type 2 diabetes mellitus. Diabetes Obes. Metab. 2008, 10, 185–197. [Google Scholar] [CrossRef]
- Filus, A.; Trzmiel, A.; Kuliczkowska-Płaksej, J.; Tworowska, U.; Jędrzejuk, D.; Milewicz, A.; Mędraś, M. Relationship between vitamin D receptor BsmI and FokI polymorphisms and anthropometric and biochemical parameters describing metabolic syndrome. Aging Male 2008, 11, 134–139. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; van Meurs, J.B.; d’Alesio, A.; Jhamai, M.; Zhao, H.; Rivadeneira, F.; Hofman, A.; van Leeuwen, J.P.T.; Jehan, F.; Pols, H.A.P.; et al. Promoter and 3’-untranslated-region haplotypes in the vitamin d receptor gene predispose to osteoporotic fracture: The rotterdam study. Am. J. Hum. Genet. 2005, 77, 807–823. [Google Scholar] [CrossRef] [PubMed]
- Naito, M.; Miyaki, K.; Naito, T.; Zhang, L.; Hoshi, K.; Hara, A.; Masaki, K.; Tohyama, S.; Muramatsu, M.; Hamajima, N.; et al. Association between vitamin D receptor gene haplotypes and chronic periodontitis among Japanese men. Int. J. Med. Sci. 2007, 4, 216. [Google Scholar] [CrossRef] [PubMed]
- Rahmadhani, R.; Zaharan, N.L.; Mohamed, Z.; Moy, F.M.; Jalaludin, M.Y. The associations between VDR BsmI polymorphisms and risk of vitamin D deficiency, obesity and insulin resistance in adolescents residing in a tropical country. PLoS ONE 2017, 12, e0178695. [Google Scholar]
- TIsmail, T.S.; Yaacob, N.M.; Omar, J.; Mustapha, Z.; Yusuff, H.; Nordin, H. Serum magnesium levels patients with Type 2 diabetes mellitus: Comparisons between good and poor glycaemic control. Brunei Int. Med. J. 2015, 11, 23–29. [Google Scholar]
- Rajagambeeram, R.; Malik, I.; Vijayan, M.; Gopal, N.; Ranganadin, P., Jr. Evaluation of serum electrolytes and their relation to glycemic status in patients with T2DM. Int. J. Clin. Biochem. Res. 2020, 6, 10. [Google Scholar] [CrossRef]
- Li, L.; Wu, B.; Liu, J.Y.; Yang, L.B. Vitamin D receptor gene polymorphisms and type 2 diabetes: A meta-analysis. Arch. Med. Res. 2013, 44, 235–241. [Google Scholar] [CrossRef] [PubMed]
- Ross, A.C.; Manson, J.E.; Abrams, S.A.; Aloia, J.F.; Brannon, P.M.; Clinton, S.K.; Durazo-Arvizu, R.A.; Gallagher, J.C.; Gallo, R.L.; Jones, G.; et al. The 2011 report on dietary reference intakes for calcium and vitamin D from the Institute of Medicine: What clinicians need to know. J. Clin. Endocrinol. Metab. 2011, 96, 53–58. [Google Scholar] [CrossRef] [PubMed]
- Garg, M.K.; Kharb, S. Dual energy X-ray absorptiometry: Pitfalls in measurement and interpretation of bone mineral density. Indian J. Endocrinol. Metab. 2013, 17, 203–210. [Google Scholar] [CrossRef]
- Wallace, T.M.; Matthews, D.R. The assessment of insulin resistance in man. Diabet Med. 2002, 19, 527–534. [Google Scholar] [CrossRef]
- Ozfirat, Z.; Chowdhury, T.A. Vitamin D deficiency and type 2 diabetes. Postgrad. Med. J. 2010, 86, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.; Zhuang, Q.S.; Ji, H.F. Assessment of vitamin D levels in type 1 and type 2 diabetes patients: Results from metaanalysis. Mol. Nutr. Food Res. 2016, 60, 1059–1067. [Google Scholar] [CrossRef] [PubMed]
- Errouagui, A.; Benrahma, H.; Charoute, H.; Ghalim, N.; Barakat, A.; Kandil, M.; Rouba, H. Relationship between vitamin d receptor (VDR) gene polymorphisms and susceptibility to Type 2 diabetes mellitus in Moroccans population. Int. J. Innov. Appl. Stud. 2014, 8, 503. [Google Scholar]
- Mackawy, A.M.; Badawi, M.E. Association of vitamin D and vitamin D receptor gene polymorphisms with chronic inflammation, insulin resistance and metabolic syndrome components in type 2 diabetic Egyptian patients. Meta Gene 2014, 2, 540–556. [Google Scholar] [CrossRef] [PubMed]
- Vranić, L.; Mikolašević, I.; Milić, S. Vitamin D deficiency: Consequence or cause of obesity? Medicina 2019, 55, 541–545. [Google Scholar]
- Bid, H.K.; Konwar, R.; Aggarwal, C.G.; Gautam, S.; Saxena, M.; Nayak, V.L.; Banerjee, M. Vitamin D receptor (FokI, BsmI and TaqI) gene polymorphisms and type 2 diabetes mellitus: A North Indian study. Indian J. Med. Sci. 2009, 63, 187–194. [Google Scholar] [PubMed]
- Malecki, M.T.; Frey, J.; Moczulski, D.; Klupa, T.; Kozek, E.; Sieradzki, J. Vitamin D receptor gene polymorphisms and association with type 2 diabetes mellitus in a Polish population. Exp. Clin. Endocrinol. Diabetes 2003, 111, 505–509. [Google Scholar] [CrossRef]
- Yu, F.; Cui, L.L.; Wang, C.J.; Ba, Y.; Wang, L.; Li, J.; Li, C.; Dai, L.P.; Li, W. The genetic polymorphisms in vitamin D receptor and the risk of type 2 diabetes mellitus: An updated meta-analysis. Asia Pac. J. Clin. Nutr. 2016, 25, 614–624. [Google Scholar] [PubMed]
- El Gendy, H.I.; Sadik, N.A.; Helmy, M.Y.; Rashed, L.A. Vitamin D receptor gene polymorphisms and 25 (OH) vitamin D: Lack of association to glycemic control and metabolic parameters in type 2 diabetic Egyptian patients. J. Clin. Transl. Endocrinol. 2019, 15, 25–29. [Google Scholar] [CrossRef]
- Ortlepp, J.R.; Metrikat, J.; Albrecht, M.; von Korff, A.; Hanrath, P.; Hoffmann, R. The vitamin D receptor gene variant and physical activity predicts fasting glucose levels in healthy young men. Diabet Med. 2003, 20, 451–454. [Google Scholar] [CrossRef]
- Oh, J.-Y.; Barrett-Connor, E. Association between vitamin D receptor polymorphism and type 2 diabetes or metabolic syndrome in community-dwelling older adults: The Rancho Bernardo Study. Metab. Clin. Exp. Clin. Endocrinol. Diabetes 2002, 51, 356–359. [Google Scholar] [CrossRef]
- Arun Kumar, D.; Revathy, K.; Rajeswari, S.; Swaminathan, S.J.J.C.P.R. The diagnostic significance of calcium, phosphorus, magnesium and uric acid in type 2 diabetes mellitus and their association to HBA1C. J. Chem. Pharm. Res. 2015, 7, 390–397. [Google Scholar]
- Al-Yassin, D.A.M.H. Calcium and diabetes mellitus type Two a prospective study done on people with type 2 diabetes in Diwaniya teaching hospital. Kufa Med. J. 2009, 12, 468–475. [Google Scholar]
- Shimodaira, M.; Okaniwa, S.; Nakayama, T. Reduced Serum Phosphorus Levels Were Associated with Metabolic Syndrome in Men But Not in Women: A Cross-Sectional Study among the Japanese Population. Ann. Nutr. Metab. 2017, 71, 150–156. [Google Scholar] [CrossRef] [PubMed]
- Kalaitzidis, R.; Tsimihodimos, V.; Bairaktari, E.; Siamopoulos, K.C.; Elisaf, M. Disturbances of phosphate metabolism: Another feature of metabolic syndrome. Am. J. Kidney Dis. 2005, 45, 851–858. [Google Scholar] [CrossRef] [PubMed]
- DeFronzo, R.A.; Lang, R. Hypophosphatemia and glucose intolerance: Evidence for tissue insensitivity to insulin. N. Engl. J. Med. 1980, 303, 1259–1263. [Google Scholar] [CrossRef]
- Wittmann, I.; Nagy, J. Effectiveness of phosphate supplementation in glucose intolerant, hypophosphatemic patients. Min. Electrolyte Metab. 1997, 23, 62–63. [Google Scholar]
- Khattab, M.; Abi-Rashed, C.; Ghattas, H.; Hlais, S.; Obeid, O. Phosphorus ingestion improves oral glucose tolerance of healthy male subjects: A crossover experiment. Nutr. J. 2015, 14, 112. [Google Scholar] [CrossRef] [PubMed]
- Sheehan, J.P. Magnesium deficiency and diabetes mellitus. Magnes Trace Elem. 1991, 10, 215–219. [Google Scholar] [PubMed]
- Elamin, A.; Tuvemo, T. Magnesium and insulin-dependent diabetes mellitus. Diabetes Res. Clin. Pract. 1990, 10, 203–209. [Google Scholar] [CrossRef]
- Daousi, C.; Casson, I.F.; Gill, G.V.; MacFarlane, I.A.; Wilding, J.P.; Pinkney, J.H. Prevalence of obesity in type 2 diabetes in secondary care: Association with cardiovascular risk factors. Postgrad. Med. J. 2006, 82, 280–284. [Google Scholar] [CrossRef]
- Lawal, Y.; Bello, F.; Anumah, F.E.; Bakari, A.G. Beta-cell function and insulin resistance among First-Degree relatives of persons with type 2 diabetes in a Northwestern Nigerian Population. J. Health Res. Rev. 2019, 6, 26. [Google Scholar] [CrossRef]
- Katsuki, A.; Sumida, Y.; Gabazza, E.C.; Murashima, S.; Furuta, M.; Araki-Sasaki, R.; Hori, Y.; Yano, Y.; Adachi, Y. Homeostasis model assessment is a reliable indicator of insulin resistance during follow-up of patients with type 2 diabetes. Diabetes Care 2001, 24, 362–365. [Google Scholar] [CrossRef]
| SNPid | Primers | PCR Product Size | Restriction Enzyme | Recognition Sequences |
|---|---|---|---|---|
| (rs1544410) | Fwd: CGGGGAGTATGAAGGACAAA Rev: CCATCTCTCAGGCTCCAAAG | 348 bp (243 + 105 bp) | BSM1 | 5′…GAATGCN▼…3′ 3′…CTTAC▲GN…5′ |
| (rs2228570) | Fwd: CTGGCACTGACTCTGGCTCT Rev: TATGACCTGTGAAGGCTGCA | 183 bp (62 + 121 bp) | FOK1 | 5′…GGATG(N)9▼…3′ 3′…CCTAC(N)13▲…5′ |
| Parameters | Healthy Control (n = 63) | Good DM Control (n = 63) | Poor DM Control (n = 63) | ANOVA (F-Test) | p-Value |
|---|---|---|---|---|---|
| Age (years) | 50.33 ± 7.58 | 54.90 ± 7.77 | 53.14 ± 6.58 | 6.231 | 0.002 |
| Gender | |||||
| -Male | 11 | 25 | 20 | - | 0.022 |
| -Female | 52 | 38 | 43 | ||
| Ethnicity | - | 0.211 | |||
| -Malay | 52 (82.5%) | 58 (92%) | 59 (93.6%) | ||
| -Chinese | 10 (15.9%) | 5 (8%) | 3 (4.8%) | ||
| -Others | 1 (1.6%) | - | 1 (1.6%) | ||
| BMI (kg/m2) | 26.41 ± 4.5 | 27.87 ± 5.20 | 29.41 ± 5.912 | 5.048 | 0.007 |
| BMI categories | - | 0.135 | |||
| Normal | 25 (39.7%) | 20 (31.7%) | 18 (28.6%) | ||
| Overweight | 26 (41.3%) | 26 (41.3%) | 20 (31.7%) | ||
| Obese | 12 (19.0%) | 17 (27.0%) | 25 (39.7%) | ||
| SBP (mmHg) | 118.63 ± 5.85 | 121.67 ± 7.25 | 125.95 ± 9.39 | 14.61 (2, 186) | <0.001 |
| DBP (mmHg) | 78.71 ± 5.94 | 79.19 ± 5.95 | 82.54 ± 8.55 | 5.71 (2, 186) | 0.004 |
| TC | 5.49 ± 0.79 | 5.87 ± 1.08 | 5.94 ± 0.81 | 4.46 (2, 186) | 0.013 |
| TG | 0.96 ± 0.46 | 1.95 ± 2.22 | 1.20 ± 0.68 | 9.02 (2, 186) | <0.001 |
| HDL | 1.21 ± 0.33 | 1.30 ± 0.43 | 1.07 ± 0.27 | 6.40 (2, 186) | 0.002 |
| LDL | 4.18 ± 0.80 | 3.75 ± 1.05 | 4.20 ± 0.80 | 5.10 (2, 186) | 0.007 |
| Vitamin D (ng/mL) | 22.37 ± 8.81 | 25.48 ± 11.68 | 21.20 ± 8.33 | 3.256 | 0.041 |
| Vitamin D categories | - | 0.608 | |||
| Sufficient | 31 (49.2%) | 38 (60.3%) | 31 (49.2%) | ||
| Insufficient | 29 (46%) | 22 (34.9%) | 27 (42.9%) | ||
| Deficient | 3 (4.8%) | 3 (4.8%) | 5 (7.9%) | ||
| Calcium (mmol/L) | 2.28 ± 0.08 | 2.29 ± 0.09 | 2.33 ± 0.12 | 4.433 | 0.013 |
| Magnesium (mmol/L) | 0.92 ± 0.07 | 0.88 ± 0.07 | 0.81 ± 0.08 | 29.454 | <0.001 |
| Phosphate (mmol/L) | 1.18 ± 0.19 | 1.17 ± 0.17 | 1.16 ± 0.18 | 0.292 | 0.747 |
| HOMA-IR | 3.69 ± 2.62 | 5.99 ± 3.69 | 19.62 ± 46.72 | 6.359 | 0.002 |
| Insulin sensitive | 26 (41.3%) | 10 (15.9%) | 6 (9.5%) | - | <0.001 |
| Insulin resistant | 37 (58.7%) | 53 (84.1%) | 57 (90.5%) | ||
| Treatment | - | 8.13 (1) | 0.004 | ||
| OHA alone | 50 (79.4) | 35 (55.6) | |||
| OHA + Insulin | 13 (20.6) | 28 (44.4) |
| Genotype | Healthy Control (n = 63) | Good DM (n = 63) | Poor DM (n = 63) | Healthy Control vs. DM | Good DM vs. Poor DM | ||
|---|---|---|---|---|---|---|---|
| OR (95% CI) | p-Value | OR (95% CI) | p-Value | ||||
| FokI (VDR 228570 C > T) | |||||||
| Genotype | |||||||
| CC | 18 (28.6%) | 19 (30.2%) | 23 (36.5%) | Reference | Reference | ||
| CT | 29 (46%) | 34 (54%) | 33 (52.4%) | 0.990 (0.490–2.001) | 0.978 | 0.802 (0.370–1.738) | 0.576 |
| TT | 16 (25.4%) | 10 (15.9%) | 7 (11.1%) | 0.455 (0.189–1.096) | 0.079 | 0.578 (0.185–1.810) | 0.347 |
| Allele | |||||||
| C | 65 (51.6%) | 72 (57.1%) | 79 (62.7%) | Reference | Reference | ||
| T | 61 (48.4%) | 54 (42.9%) | 47 (37.3%) | 0.713 (0.463–1.096) | 0.123 | 0.793 (0.479–1.314) | 0.369 |
| BsmI (VDR1544410 G > A) | |||||||
| Genotype | |||||||
| GG | 45 (71.4%) | 48 (76.2%) | 44 (69.8%) | Reference | Reference | ||
| GA | 15 (23.8%) | 15 (23.8%) | 16 (25.4%) | 1.011 (0.496–2.060) | 0.976 | 1.164 (0.515–2.628) | 0.715 |
| AA | 3 (4.8%) | 0 | 3 (4.8%) | 0.489 (0.095–2.520) | 0.393 | N/A | |
| Allele | |||||||
| G | 106 (84.1%) | 111 (88.1%) | 105 (83.3%) | Reference | Reference | ||
| A | 20 (15.9%) | 15 (11.9%) | 21 (16.7%) | 0.883 (0.488–1.600) | 0.682 | 1.480 (0.725–3.023) | 0.282 |
| Group | FokI (VDR 2228570 C > T) | BsmI (VDR1544410 G > A) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Healthy control | Genotype | Insulin Sensitive (n = 26) | Insulin Resistance (n = 37) | OR (CI 95%) | p-Value | Genotype | Insulin Sensitive (n = 26) | Insulin Resistance (n = 37) | OR (CI 95%) | p-Value |
| CC | 7 (26.9%) | 11 (29.7%) | Reference | GG | 21 (80.8%) | 24 (64.9%) | Reference | |||
| CT | 10 (38.5%) | 19 (51.4%) | 1.209 (0.358–4.089) | 0.760 | GA | 4 (15.4%) | 11 (29.7%) | 2.406 (0.665–8.702) | 0.181 | |
| TT | 9 (34.6%) | 7 (18.9%) | 0.495 (0.126–1.945) | 0.314 | AA | 1 (3.8%) | 2 (5.4%) | 1.750 (0.148–20.707) | 0.657 | |
| Allele | Allele | |||||||||
| C | 24 (46.2%) | 41 (55.4%) | Reference | G | 47 (90.4%) | 59 (79.7%) | Reference | |||
| T | 28 (53.8%) | 33 (44.6%) | 0.690 (0.338–1.406) | 0.307 | A | 5 (9.6%) | 15 (20.3%) | 2.390 (0.810–7.053) | 0.115 | |
| Good DM | Genotype | Insulin Sensitive (n = 10) | Insulin Resistance (n = 53) | OR (95% CI) | p-Value | Genotype | Insulin Sensitive (n = 10) | Insulin Resistance (n = 53) | OR (95% CI) | p-Value |
| CC | 3 (30%) | 16 (30.2%) | Reference | GG | 6 (60%) | 42 (79.2%) | Reference | |||
| CT | 4 (40%) | 30 (56.6%) | 1.406 (0.280–7.072) | 0.679 | G | 4 (40%) | 11 (20.8%) | 0.393 (0.094–1.640) | 0.200 | |
| TT | 3 (30%) | 7 (13.2%) | 0.438 (0.070–2.728) | 0.376 | AA | 0 | 0 | N/A | ||
| Allele | Allele | |||||||||
| C | 10 (50%) | 62 (58.5%) | Reference | G | 16 (80%) | 95 (89.6%) | Reference | |||
| T | 10 (50%) | 44 (41.5%) | 0.710 (0.272–1.850) | 0.483 | A | 4 (20%) | 11 (10.4%) | 0.463 (0.131–1.634) | 0.232 | |
| Poor DM | Genotype | Insulin Sensitive (n = 6) | Insulin Resistance (n = 57) | OR (95% CI) | p-Value | Genotype | Insulin Sensitive (n = 6) | Insulin Resistance (n = 57) | OR (95% CI) | p-Value |
| CC | 2 (33.3%) | 21 (36.8%) | Reference | GG | 4 (66.7%) | 40 (70.2%) | Reference | |||
| CT | 3 (50%) | 30 (52.6%) | 0.952 (0.146–6.205) | 0.959 | GA | 0 (0.0%) | 16 (28.1%) | N/A | ||
| TT | 1 (16.7%) | 6 (10.5%) | 0.571 (0.044–7.438) | 0.669 | AA | 2 (33.3%) | 1 (1.8%) | 0.050 (0.004–0.681) | 0.025 | |
| Allele | Allele | |||||||||
| C | 6 (60%) | 73 (62.9%) | Reference | G | 6 (60%) | 99 (85.3%) | Reference | |||
| T | 4 (40%) | 43 (37.1%) | 0.884 (0.236–3.308) | 0.854 | A | 4 (40%) | 17 (14.7%) | 0.258 (0.066–1.009) | 0.052 | |
| Group | FokI (VDR 2228570 C > T) | BsmI (VDR1544410 G > A) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Healthy control | Genotype | Vitamin D Sufficiency (n = 31) | Vitamin D Deficiency (n = 3) | OR (95% CI) | p-Value | Genotype | Vitamin D Sufficiency (n = 31) | Vitamin D Deficiency (n = 3) | OR (95% CI) | p-Value |
| CC | 9 (29%) | 1 (33.3%) | Reference | GG | 25 (80.6%) | 2 (66.7%) | Reference | |||
| CT | 13 (41.9%) | 1 (33.3%) | 0.692 (0.038–12.572) | 0.804 | GA | 5 (16.1%) | 1 (33.3%) | 2.500 (0.188–33.170) | 0.487 | |
| TT | 9 (29%) | 1 (33.3%) | 1.000 (0.054–18.574) | >0.95 | AA | 1 (3.2%) | 0 | N/A | >0.95 | |
| Allele | Allelle | |||||||||
| C | 31 (50%) | 3 (50%) | Reference | G | 56 (90.3%) | 5 (83.3%) | Reference | |||
| T | 31 (50%) | 3 (50%) | 1.000 (0.187–5.344) | >0.95 | A | 6 (9.7%) | 1 (16.7%) | 1.867 (0.186–18.734) | 0.596 | |
| Good DM | Genotype | Vitamin D Sufficiency (n = 38) | Vitamin D Deficiency (n = 3) | OR (95%CI) | p-Value | Genotype | Vitamin D Sufficiency (n = 38) | Vitamin D Deficiency (n = 3) | OR (95%CI) | p-Value |
| CC | 13 (34.2%) | 1 (33.3%) | Reference | GG | 33 (86.8%) | 2 (66.7%) | Reference | |||
| CT | 20 (52.6%) | 2 (66.7%) | 1.300 (0.107–15.836) | 0.837 | GA | 5 (13.2%) | 1 (33.3%) | 3.300 (0.251–43.470) | 0.364 | |
| TT | 5 (13.2%) | 0 | N/A | 0.999 | AA | 0 | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 46 (60.5%) | 4 (66.7%) | Reference | G | 71 (93.4%) | 5 (83.3%) | Reference | |||
| T | 30 (39.5%) | 2 (33.3%) | 0.767 (0.132–4.450) | 0.767 | A | 5 (6.6%) | 1 (16.7%) | 2.840 (0.276–29.210) | 0.380 | |
| Poor DM | Genotype | Vitamin D Sufficiency (n = 31) | Vitamin D Deficiency (n = 6) | OR (95% CI) | p-Value | Genotype | Vitamin D Sufficiency (n = 31) | Vitamin D Deficiency (n = 5) | OR (95% CI) | p-Value |
| CC | 13 (41.9%) | 1 (16.7%) | Reference | GG | 19 (61.3%) | 4 (66.7%) | Reference | |||
| CT | 14 (45.2%) | 4 (66.7%) | 3.714 (0.366–37.708) | 0.267 | GA | 10 (32.3%) | 1 (16.7%) | 0.475 (0.047–4.839) | 0.530 | |
| TT | 4 (12.9%) | 1 (16.7%) | 3.250 (0.163–64.614) | 0.440 | AA | 2 (6.4%) | 1 (16.7%) | 2.375 (0.171–32.999) | 0.519 | |
| Allele | Allele | |||||||||
| C | 40 (64.5%) | 6 (50%) | Reference | G | 49 (79%) | 9 (75%) | Reference | |||
| T | 22 (35.5%) | 6 (50%) | 1.818 (0.523–6.317) | 0.347 | A | 13 (21%) | 3 (25%) | 1.256 (0.297–5.317) | 0.756 | |
| Group | FokI (VDR 2228570 C > T | BsmI (VDR1544410 G > A) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Healthy control | Genotype | Normal (n = 63) | Hypo Magnesemia (n = 0) | OR (95% CI) | p-Value | Genotype | Normal (n = 63) | Hypo Magnesemia (n = 0) | OR (95% CI) | p-Value |
| CC | 18 (28.6%) | 0 | Reference | GG | 45 (71.4%) | 0 | Reference | |||
| CT | 29 (46%) | 0 | N/A | N/A | GA | 15 (23.8%) | 0 | N/A | N/A | |
| TT | 16 (25.4%) | 0 | N/A | N/A | AA | 3 (4.8%) | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 65 (51.6%) | 0 | Reference | G | 106 (84.1%) | 0 | Reference | |||
| T | 61 (48.4%) | 0 | N/A | N/A | A | 20 (15.9%) | 0 | N/A | N/A | |
| Good DM | Genotype | Normal (n = 63) | Hypo Magnesemia (n = 0) | OR (95% CI) | p-Value | Genotype | Normal (n = 63) | Hypo Magnesemia (n = 0) | OR (95% CI) | p-Value |
| CC | 19 (30.2%) | 0 | Reference | GG | 48 (76.2%) | 0 | Reference | |||
| CT | 34 (54%) | 0 | N/A | N/A | GA | 15 (23.8%) | 0 | N/A | N/A | |
| TT | 10 (15.9%) | 0 | N/A | N/A | AA | 0 (0%) | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 72 (57.1%) | 0 | Reference | G | 111 (88.1%) | 0 | Reference | |||
| T | 54 (42.9%) | 0 | N/A | N/A | A | 15 (11.9%) | 0 | N/A | N/A | |
| Poor DM | Genotype | Normal (n = 50) | Hypo Magnesemia (n = 13) | OR (95% CI) | p-Value | Genotype | Normal (n = 50) | Hypo Magnesemia (n = 13) | OR (95% CI) | p-Value |
| CC | 20 (40%) | 3 (23.1%) | Reference | GG | 34 (68%) | 10 (76.9%) | Reference | |||
| CT | 24 (48%) | 9 (69.2%) | 2.500 (0.595–10.500) | 0.211 | GA | 14 (28%) | 2 (15.4%) | 0.486 (0.094–2.506) | 0.388 | |
| TT | 6 (12%) | 1 (7.7%) | 1.111 (0.097–12.750) | 0.933 | AA | 2 (4%) | 1 (7.7%) | 1.700 (0.139–20.749) | 0.678 | |
| Allele | Allele | |||||||||
| C | 64 (64%) | 15 (57.7%) | Reference | G | 83 (83%) | 22 (84.6%) | Reference | |||
| T | 36 (36%) | 11 (42.3%) | 1.304 (0.541–3.139) | 0.554 | A | 17 (17%) | 4 (15.4%) | 0.888 (0.271–2.907) | 0.844 | |
| Group | FokI (VDR 2228570 C > T) | BsmI (VDR1544410 G > A) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Healthy control | Genotype | Normal (n = 62) | Hypocalcemia (n = 1) | OR (95% CI) | p-Value | Genotype | Normal (n = 62) | Hypocalcemia (n = 1) | OR (95% CI) | p-Value |
| CC | 18 (29%) | 0 | Reference | GG | 44 (71%) | 1 (100%) | Reference | |||
| CT | 29 (46.8%) | 0 | N/A | N/A | GA | 15 (24.2%) | 0 | N/A | N/A | |
| TT | 15 (24.2%) | 1 (100%) | N/A | N/A | AA | 3 (4.8%) | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 65 (52.4%) | 0 | Reference | G | 104 (83.9%) | 2 (100%) | Reference | |||
| T | 59 (47.6%) | 2 (100%) | N/A | 0.997 | A | 20 (16.1%) | 0 | N/A | 0.998 | |
| Good DM | Genotype | Normal (n = 63) | Hypocalcemia (n = 0) | OR (95% CI) | p-Value | Genotype | Normal (n = 63) | Hypocalcemia (n = 0) | OR (95% CI) | p-Value |
| CC | 19 (30.2%) | 0 | Reference | GG | 48 (76.2%) | 0 | Reference | |||
| CT | 34 (54%) | 0 | N/A | N/A | GA | 15 (23.8%) | 0 | N/A | N/A | |
| TT | 10 (15.9%) | 0 | N/A | N/A | AA | 0 | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 72 (57.1%) | 0 | Reference | G | 111 (88.1%) | 0 | Reference | |||
| T | 54 (42.9%) | 0 | N/A | N/A | A | 15 (11.9%) | 0 | N/A | N/A | |
| Poor DM | Genotype | Normal (n = 63) | Hypocalcemia (n = 0) | OR (95% CI) | p-Value | Genotype | Normal (n = 63) | Hypocalcemia (n = 0) | OR (95% CI) | p-Value |
| CC | 23 (36.5%) | 0 | Reference | GG | 44 (69.8%) | 0 | Reference | |||
| CT | 33 (52.4%) | 0 | N/A | N/A | GA | 16 (25.4%) | 0 | N/A | N/A | |
| TT | 7 (11%) | 0 | N/A | N/A | AA | 3 (4.8%) | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 79 (62.7%) | 0 | Reference | G | 105 (83.3%) | 0 | Reference | |||
| T | 47 (37.3%) | 0 | N/A | N/A | A | 21 (16.7%) | 0 | N/A | N/A | |
| Group | FokI (VDR 2228570 C > T) | BsmI (VDR1544410 G > A) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Healthy control | Genotype | Normal (n = 60) | Hypophosphatemia (n = 3) | OR (95%CI) | p-Value | Genotype | Normal (n = 60) | Hypophos Phatemia (n = 3) | OR (95%CI) | p-Value |
| CC | 17 (28.3%) | 1 (33.3%) | Reference | GG | 44 (73.3%) | 1 (33.3%) | Reference | |||
| CT | 29 (48.3%) | 0 (0%) | N/A | N/A | GA | 13 (21.7%) | 2 (66.7%) | 6.769 (0.567–80.745) | 0.131 | |
| TT | 14 (23.3%) | 2 (66.7%) | 2.429 (0.199–29.660) | 0.487 | AA | 3 (5%) | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 63 (52.5%) | 2 (33.3%) | Reference | G | 101 (84.2%) | 5 (83.3%) | Reference | |||
| T | 57 (47.5%) | 4 (66.7%) | 2.211 (0.390–12.529) | 0.370 | A | 19 (15.8%) | 1 (16.7%) | 1.063 (0.118–9.617) | 0.957 | |
| Good DM | Genotype | Normal (n = 62) | Hypophosphatemia (n = 1) | OR (95% CI) | p-Value | Genotype | Normal (n = 62) | Hypophos Phatemia (n = 1) | OR (95% CI) | p-Value |
| CC | 18 (29%) | 1 (100%) | Reference | GG | 47 (75.8%) | 1 (100%) | Reference | |||
| CT | 34 (54.8%) | 0 | N/A | 0.998 | GA | 15 (24.2%) | 0 | N/A | 0.999 | |
| TT | 10 (16.1%) | 0 | N/A | 0.999 | AA | 0 | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 70 (56.5%) | 2 (100%) | Reference | G | 109 (87.9%) | 2 (100%) | Reference | |||
| T | 54 (43.5%) | 0 | N/A | 0.997 | A | 15 (12.1%) | 0 | N/A | 0.999 | |
| Poor DM | Genotype | Normal (n = 61) | Hypophosphatemia (n = 2) | OR (95% CI) | p-Value | Genotype | Normal (n = 61) | Hypophos Phatemia (n = 2) | OR (95% CI) | p-Value |
| CC | 23 (37.7%) | 0 (0%) | Reference | GG | 42 (68.9%) | 2 (100%) | Reference | |||
| CT | 32 (52.5%) | 1 (50%) | N/A | 0.998 | GA | 16 (26.2%) | 0 | N/A | N/A | |
| TT | 6 (9.8%) | 1 (50%) | N/A | 0.998 | AA | 3 (4.9%) | 0 | N/A | N/A | |
| Allele | Allele | |||||||||
| C | 78 (63.9%) | 1 (25%) | Reference | G | 101 (82.8%) | 4 (100%) | Reference | |||
| T | 44 (36.1%) | 3 (75%) | 5.318 (0.537–52.682) | 0.153 | A | 21 (17.2%) | 0 | N/A | 0.998 | |
| Group | FokI (VDR 2228570 C > T) | BsmI (VDR1544410 G > A) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Healthy control | Genotype | Normal (n = 25) | Obese (n = 12) | OR (95% CI) | p-Value | Genotype | Normal (n = 25) | Obese (n = 12) | OR (95% CI) | p-Value |
| CC | 6 (24%) | 5 (41.7%) | Reference | GG | 19 (76%) | 7 (58.3%) | Reference | |||
| CT | 15 (60%) | 1 (8.3%) | 0.080 (0.008–0.836) | 0.035 | GA | 5 (20%) | 4 (33.3%) | 2.171 (0.450–10.486) | 0.334 | |
| TT | 4 (16%) | 6 (50%) | 1.800 (0.318–10.201) | 0.507 | AA | 1 (4%) | 1 (8.3%) | 2.714 (0.149–49.533) | 0.500 | |
| Allele | Allele | |||||||||
| C | 27 (54%) | 11 (45.8%) | Reference | G | 43 (86%) | 19 (79.2%) | Reference | |||
| T | 23 (46%) | 13 (54.2%) | 1.387 (0.522–3.684) | 0.511 | A | 7 (14%) | 5 (20.8%) | 1.617 (0.455–5.746) | 0.458 | |
| Good DM | Genotype | Normal (n = 20) | Obese (n = 17) | OR (95% CI) | p-Value | Genotype | Normal (n = 20) | Obese (n = 17) | OR (95% CI) | p-Value |
| CC | 4 (20%) | 5 (29.4%) | Reference | GG | 16 (80%) | 11 (64.7%) | Reference | |||
| CT | 11 (55%) | 10 (58.8%) | 0.727 (0.151–3.493) | 0.691 | GA | 4 (20%) | 6 (35.3%) | 2.182 (0.497–9.583) | 0.301 | |
| TT | 5 (25%) | 2 (11.8%) | 0.320 (0.039–2.618) | 0.288 | AA | 0 | 0 | N/A | ||
| Allele | Allele | |||||||||
| C | 19 (47.5%) | 20 (58.8%) | Reference | G | 36 (90%) | 28 (82.4%) | Reference | |||
| T | 21 (52.5%) | 14 (41.2%) | 0.633 (0.252–1.594) | 0.332 | A | 4 (10%) | 6 (17.6%) | 1.929 (0.496–7.500) | 0.343 | |
| Poor DM | Genotype | Normal (n = 18) | Obese (n = 25) | OR (95% CI) | p-Value | Genotype | Normal (n = 18) | Obese (n = 25) | OR (95% CI) | p-Value |
| CC | 6 (33.3%) | 10 (40%) | Reference | GG | 12 (66.7%) | 19 (76%) | Reference | |||
| CT | 11(61.1%) | 13 (52%) | 0.709 (0.195–2.581) | 0.602 | GA | 4 (22.2%) | 6 (24%) | 0.947 (0.221–4.067) | 0.942 | |
| TT | 1 (5.6%) | 2 (8%) | 1.200 (0.089–16.239) | 0.891 | AA | 2 (11.1%) | 0 (0%) | N/A | 0.999 | |
| Allele | Allele | |||||||||
| C | 24 (66.7%) | 32 (64%) | Reference | G | 27 (75%) | 45 (90%) | Reference | |||
| T | 12 (33.3%) | 18 (36%) | 1.125 (0.456–2.773) | 0.798 | A | 9 (25%) | 5 (10%) | 0.333 (0.101–1.099) | 0.071 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zakaria, W.N.A.; Mohd Yunus, N.; Yaacob, N.M.; Omar, J.; Wan Mohamed, W.M.I.; Sirajudeen, K.N.S.; Tuan Ismail, T.S. Association between Vitamin D Receptor Polymorphisms (BsmI and FokI) and Glycemic Control among Patients with Type 2 Diabetes. Int. J. Environ. Res. Public Health 2021, 18, 1595. https://doi.org/10.3390/ijerph18041595
Zakaria WNA, Mohd Yunus N, Yaacob NM, Omar J, Wan Mohamed WMI, Sirajudeen KNS, Tuan Ismail TS. Association between Vitamin D Receptor Polymorphisms (BsmI and FokI) and Glycemic Control among Patients with Type 2 Diabetes. International Journal of Environmental Research and Public Health. 2021; 18(4):1595. https://doi.org/10.3390/ijerph18041595
Chicago/Turabian StyleZakaria, Wan Nur Amalina, Nazihah Mohd Yunus, Najib Majdi Yaacob, Julia Omar, Wan Mohd Izani Wan Mohamed, K. N. S. Sirajudeen, and Tuan Salwani Tuan Ismail. 2021. "Association between Vitamin D Receptor Polymorphisms (BsmI and FokI) and Glycemic Control among Patients with Type 2 Diabetes" International Journal of Environmental Research and Public Health 18, no. 4: 1595. https://doi.org/10.3390/ijerph18041595
APA StyleZakaria, W. N. A., Mohd Yunus, N., Yaacob, N. M., Omar, J., Wan Mohamed, W. M. I., Sirajudeen, K. N. S., & Tuan Ismail, T. S. (2021). Association between Vitamin D Receptor Polymorphisms (BsmI and FokI) and Glycemic Control among Patients with Type 2 Diabetes. International Journal of Environmental Research and Public Health, 18(4), 1595. https://doi.org/10.3390/ijerph18041595

