Antibiotic Susceptibility Testing (AST) Reports: A Basis for Environmental/Epidemiological Surveillance and Infection Control Amongst Environmental Vibrio cholerae
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Sample Collection
2.3. Presumptive Vibrio Cholerae Numerical Density or Count
2.4. Presumptive Identification and Biochemical Reaction
2.4.1. Serological Identification and Molecular (PCR) Confirmation of Isolates
2.4.2. Extraction of Genomic DNA
2.4.3. Target-Specific Identification of V. Cholerae Using PCR and Agarose Gel Electrophoresis
2.5. Inoculum Preparation and Antibiotic Susceptibility Testing (AST) of V. Cholerae
2.5.1. Multiple Antibiotic Resistance Index (MARI) Determination and Statistical Analysis
2.5.2. Phenotypic Detection of AmpC Resistance
2.5.3. Phenotypic Detection of ESβL
The Double Disc Synergy Test (DDST)
The Combined Disc Synergy Test (CDST)
2.5.4. Phenotypic Detection of Carbapenem Resistance
2.5.5. MHT Confirmation
3. Results
3.1. Genera Specific 16SrRNA PCR Gene Detection
3.2. V. Cholerae Cell Density
3.3. Antibiotic Susceptibility Test (AST) and Profile of V. Cholerae Isolates
3.3.1. Occurrence of AmpC Resistance
3.3.2. Occurrence of ESβLs Resistance
3.3.3. Occurrence of NDM-1 Resistance
3.3.4. Antibiotic Resistance Phenotypes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hossain, M.T.; Kim, Y.R.; Kong, I.S. PCR–restriction fragment length polymorphism analysis using groEL gene to differentiate pathogenic Vibrio species. Diagn. Microbiol. Infect. Dis. 2014, 78, 9–11. [Google Scholar] [CrossRef]
- Hossain, Z.Z.; Farhana, I.; Tulsiani, S.M.; Begum, A.; Jensen, P.K. Transmission and Toxigenic Potential of Vibrio cholerae in Hilsha Fish (Tenualosa ilisha) for Human Consumption in Bangladesh. Front. Microbiol. 2018, 9, 222. [Google Scholar] [CrossRef]
- Cabral, J.P. Water microbiology. Bacterial pathogens and water. Int. J. Environ. Res. Public Health 2010, 7, 3657–3703. [Google Scholar] [CrossRef]
- Crowell, M.D. Role of serotonin in the pathophysiology of the irritable bowel syndrome. Br. J. Pharmacol. 2004, 141, 1285–1293. [Google Scholar] [CrossRef] [PubMed]
- Manaia, C.M.; Rocha, J.; Scaccia, N.; Marano, R.; Radu, E.; Biancullo, F.; Cerqueira, F.; Fortunato, G.; Iakovides, I.C.; Zammit, I.; et al. Antibiotic resistance in wastewater treatment plants: Tackling the black box. Environ. Int. 2018, 115, 312–324. [Google Scholar] [CrossRef]
- Kulková, N.; Babálová, M.; Brnová, J.; Krcméry, V. Transferable fluoroquinolone resistance in Enterobacteriaceae and Pseudomonas aeruginosa isolated from hemocultures. Cent. Eur. J. Public Health 2014, 22, 60–63. [Google Scholar] [CrossRef]
- CLSI. Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Fifth Information Supplement; M100-S25; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- Doron, S.; Melamed, S.; Ofir, G.; Leavitt, A.; Lopatina, A.; Keren, M.; Amitai, G.; Sorek, R. Systematic discovery of antiphage defense systems in the microbial pangenome. Science 2018, 359, eaar4120. [Google Scholar] [CrossRef]
- Villion, M.; Moineau, S. The double-edged sword of CRISPR-Cas systems. Cell Res. 2013, 23, 15. [Google Scholar] [CrossRef]
- Chylinski, K.; Le Rhun, A.; Charpentier, E. The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems. RNA Biol. 2013, 10, 726–737. [Google Scholar] [CrossRef] [PubMed]
- Feglo, P.K.; Sewurah, M. Characterization of highly virulent multidrug resistant Vibrio cholerae isolated from a large cholera outbreak in Ghana. BMC Res. Notes 2018, 11, 45. [Google Scholar] [CrossRef] [PubMed]
- Pal, B.B.; Nayak, S.R.; Khuntia, H.K. Epidemiology and Antibiogram Profile of Vibrio cholerae Isolates between 2004–2013 from Odisha, India. Jpn. J. Infect. Dis. 2018, 71, 99–103. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhu, Y.; Han, M.L.; Li, M.; Song, J.; Velkov, T.; Li, C.; Li, J. Comparative analysis of phosphoethanolamine transferases involved in polymyxin resistance across 10 clinically relevant Gram-negative bacteria. Int. J. Antimicrob. Agents 2018, 51, 586–593. [Google Scholar] [CrossRef]
- Henderson, J.C.; Herrera, C.M.; Trent, M.S. AlmG, responsible for polymyxin resistance in pandemic V. cholerae, is a glycyl-transferase distantly related to lipid A late acyltransferases. J. Biol. Chem. 2017, 292, 21205–21215. [Google Scholar] [CrossRef]
- Bengoechea, J.A. Vibrio cholerae amino acids go on the defense. J. Biol. Chem. 2017, 292, 21216–21217. [Google Scholar] [CrossRef] [PubMed]
- Holmes, A.H.; Moore, L.S.; Sundsfjord, A.; Steinbakk, M.; Regmi, S.; Karkey, A.; Guerin, P.J.; Piddock, L.J. Understanding the mechanisms and drivers of antimicrobial resistance. Lancet 2016, 387, 176–187. [Google Scholar] [CrossRef]
- Jiang, F.; Bi, R.; Deng, L.; Kang, H.; Gu, B.; Ma, P. Virulence-associated genes and molecular characteristics of non-O1/non-O139 Vibrio cholerae isolated from hepatitis B cirrhosis patients in China. Int. J. Infect. Dis. 2018, 74, 117–122. [Google Scholar] [CrossRef] [PubMed]
- Bwire, G.; Debes, A.K.; Orach, C.G.; Kagirita, A.; Ram, M.; Komakech, H.; Voeglein, J.B.; Buyinza, A.W.; Obala, T.; Brooks, W.A.; et al. Environmental surveillance of Vibrio cholerae O1/O139 in the five African Great Lakes and other major surface water sources in Uganda. Front. Microbiol. 2018, 9. [Google Scholar] [CrossRef]
- Hoshino, K.; Yamasaki, S.; Mukhopadhyay, A.K.; Chakraborty, S.; Basu, A.; Bhattacharya, S.K.; Nair, G.B.; Shimada, T.; Takeda, Y. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol. Med. Microbiol. 1998, 20, 201–207. [Google Scholar] [CrossRef]
- Daccord, A.; Ceccarelli, D.; Burrus, V. Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol. Microbiol. 2010, 78, 576–588. [Google Scholar] [CrossRef]
- Wang, R.; Liu, H.; Zhao, X.; Li, J.; Wan, K. IncA/C plasmids conferring high azithromycin resistance in Vibrio cholerae. Int. J. Antimicrob. Agents 2018, 51, 140–144. [Google Scholar] [CrossRef]
- Reddi, G.; Pruss, K.; Cottingham, K.L.; Taylor, R.K.; Almagro-Moreno, S. Catabolism of mucus components influences motility of Vibrio cholerae in the presence of environmental reservoirs. PLoS ONE 2018, 13, e0201383. [Google Scholar] [CrossRef] [PubMed]
- Corzett, C.H.; Elsherbini, J.; Chien, D.M.; Hehemann, J.H.; Henschel, A.; Preheim, S.P.; Yu, X.; Alm, E.J.; Polz, M.F. Evolution of a Vegetarian Vibrio: Metabolic Specialization of V. breoganii to Macroalgal Substrates. J. Bacteriol. 2018, 200, e00020-18. [Google Scholar] [CrossRef] [PubMed]
- Gupta, R.; da Costa, T.P.S.; Faou, P.; Dogovski, C.; Perugini, M.A. Comparison of untagged and his-tagged dihydrodipicolinate synthase from the enteric pathogen Vibrio cholerae. Protein Expr. Purif. 2018, 145, 85–93. [Google Scholar] [CrossRef] [PubMed]
- Pursley, B.R.; Maiden, M.M.; Hsieh, M.L.; Fernandez, N.; Severin, G.B.; Waters, C.M. Cyclic di-GMP regulates TfoY in Vibrio cholerae to control motility by both transcriptional and posttranscriptional mechanisms. J. Bacteriol. 2018, 200, e00578-17. [Google Scholar] [CrossRef]
- Uchida, T.; Funamizu, T.; Chen, M.; Tanaka, Y.; Ishimori, K. Heme Binding to Porphobilinogen Deaminase from Vibrio cholerae Decelerates the Formation of 1-Hydroxymethylbilane. ACS Chem. Biol. 2018, 13, 750–760. [Google Scholar] [CrossRef]
- Toulouse, C.; Metesch, K.; Pfannstiel, J.; Steuber, J. Metabolic reprogramming of Vibrio cholerae impaired in respiratory NADH oxidation is accompanied with increased copper sensitivity. J. Bacteriol. 2018, 200, e00761-17. [Google Scholar] [CrossRef]
- Jerbi, M.A.; Ouanes, Z.; Besbes, R.; Achour, L.; Kacem, A. Single and combined genotoxic and cytotoxic effects of two xenobiotics widely used in intensive aquaculture. Mutat. Res. Genet. Toxicol. Environ. Mutagenes. 2011, 724, 22–27. [Google Scholar] [CrossRef] [PubMed]
- Zaw, M.T.; Emran, N.A.; Ibrahim, M.Y.; Suleiman, M.; Mohd, T.A.A.; Yusuff, A.S.; Naing, K.S.; Myint, T.; Jikal, M.; Salleh, M.A.; et al. Genetic diversity of toxigenic Vibrio cholerae O1 from Sabah, Malaysia 2015. J. Microbiol. Immunol. Infect. 2019, 52, 563–570. [Google Scholar] [CrossRef]
- Mohamudha, P.R.; Harish, B.N.; Parija, S.C. AmpC beta lactamases among Gram negative clinical isolates from a tertiary hospital, South India. Braz. J. Microbiol. 2010, 41, 596–602. [Google Scholar] [CrossRef]
- Gupta, G.; Tak, V.; Mathur, P. Detection of AmpC β lactamases in gram-negative bacteria. J. Lab. Physicians 2014, 6, 1. [Google Scholar] [PubMed]
- Salamat, S.; Ejaz, H.; Zafar, A.; Javed, H. Detection of AmpC β-lactamase producing bacteria isolated in neonatal sepsis. Pak. J. Med. Sci. 2016, 32, 1512. [Google Scholar] [CrossRef] [PubMed]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Titilawo, Y.; Obi, L.; Okoh, A. Antimicrobial resistance determinants of Escherichia coli isolates recovered from some rivers in Osun State, South-Western Nigeria: Implications for public health. Sci. Total Environ. 2015, 523, 82–94. [Google Scholar] [CrossRef] [PubMed]
- Chikwendu, C.I.; Ibe, S.N.; Okpokwasili, G.C. Detection of blaSHV and blaTEM beta-lactamase genes in multi-resistant Pseudomonas isolates from environmental sources. Afr. J. Microbiol. Res. 2011, 5, 2067–2074. [Google Scholar] [CrossRef]
- Pagani, L.; Ronza, P.; Giacobone, E.; Romero, E. Extended-spectrum β-lactamases from Klebsiella pneumoniae strains isolated at an Italian hospital. Eur. J. Epidemiol. 1994, 10, 533–540. [Google Scholar] [CrossRef]
- CLSI. Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; CLSI M100-S26; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
- Matuschek, E.; Brown, D.F.J.; Kahlmeter, G. Development of the EUCAST disk diffusion antimicrobial susceptibility testing method and its implementation in routine microbiology laboratories. Clin. Microbiol. Infect. 2014, 20, O255–O266. [Google Scholar] [CrossRef]
- Rodriguez-Valera, F.; Martin-Cuadrado, A.B.; López-Pérez, M. Flexible genomic islands as drivers of genome evolution. Current Opin. Microbiol. 2016, 31, 154–160. [Google Scholar] [CrossRef]
- Spagnoletti, M.; Ceccarelli, D.; Rieux, A.; Fondi, M.; Taviani, E.; Fani, R.; Colombo, M.M.; Colwell, R.R.; Balloux, F. Acquisition and evolution of SXT-R391 integrative conjugative elements in the seventh-pandemic Vibrio cholerae lineage. MBio 2014, 5, e01356-14. [Google Scholar] [CrossRef]
- Taviani, E.; Spagnoletti, M.; Ceccarelli, D.; Haley, B.J.; Hasan, N.A.; Chen, A.; Colombo, M.M.; Huq, A.; Colwell, R.R. Genomic analysis of ICEVchBan8: An atypical genetic element in Vibrio cholerae. FEBS Lett. 2012, 586, 1617–1621. [Google Scholar] [CrossRef]
- O’Shea, Y.A.; Finnan, S.; Reen, F.J.; Morrissey, J.P.; O’Gara, F.; Boyd, E.F. The Vibrio seventh pandemic island-II is a 26·9 kb genomic island present in Vibrio cholerae El Tor and O139 serogroup isolates that shows homology to a 43·4 kb genomic island in V. vulnificus. Microbiology 2004, 150, 4053–4063. [Google Scholar] [CrossRef]
- Hochhut, B.; Lotfi, Y.; Mazel, D.; Faruque, S.M.; Woodgate, R.; Waldor, M.K. Molecular analysis of antibiotic resistance gene clusters in Vibrio cholerae O139 and O1 SXT constins. Antimicrob. Agents Chemother. 2001, 45, 2991–3000. [Google Scholar] [CrossRef]
- Perez, F.; Van Duin, D. Carbapenem-resistant Enterobacteriaceae: A menace to our most vulnerable patients. Clevel. Clin. J. Med. 2013, 80, 225. [Google Scholar] [CrossRef]
- Huq, A.; Haley, B.J.; Taviani, E.; Chen, A.; Hasan, N.A.; Colwell, R.R. Detection, isolation, and identification of Vibrio cholerae from the environment. Curr. Protoc. Microbiol. 2012, 26, 6A.5. [Google Scholar] [CrossRef] [PubMed]
- Uddin, M.E.; Akter, T.; Sultana, P.; Sultana, P.; Hasan, M.I.; Lubna, M.A.; Al Monem, H.; Parvez, M.A.K.; Nahar, S.; Khan, M.S. Isolation, Identification and Antimicrobial Susceptibility Profile Analysis of Vibrio cholerae O1 from Stool Samples of Bangladesh. Adv. Microbiol. 2018, 8, 188. [Google Scholar] [CrossRef][Green Version]
- Igbinosa, E.O.; Obi, L.C.; Okoh, A.I. Occurrence of potentially pathogenic vibrios in final effluents of a wastewater treatment facility in a rural community of the Eastern Cape Province of South Africa. Res. Microbiol. 2009, 160, 531–537. [Google Scholar] [CrossRef]
- Pfeffer, C.; Oliver, J.D. A comparison of thiosulphate-citrate-bile salts-sucrose (TCBS) agar and thiosulphate-chloride-iodide (TCI) agar for the isolation of Vibrio species from estuarine environments. Lett. Appl. Microbiol. 2003, 36, 150–151. [Google Scholar] [CrossRef] [PubMed]
- Davis Diagnostics. Available online: https://daviesdiagnostics.co.za (accessed on 10 June 2020).
- Nandi, B.; Nandy, R.K.; Mukhopadhyay, S.; Nair, G.B.; Shimada, T.; Ghose, A.C. Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein Omp, W. J. Clin. Microbiol. 2000, 38, 4145–4151. [Google Scholar] [CrossRef]
- Tejashree, A.; Deepashree, R.; Devananda, D.; Hegde, A. Detection of CTX-M and NDM-1 Gene in Clinical Isolates of E. coli. Paripex Indian J. Res. 2018, 6. [Google Scholar] [CrossRef]
- Maugeri, T.L.; Carbone, M.; Fera, M.T.; Gugliandolo, C. Detection and differentiation of Vibrio vulnificus in seawater and plankton of a coastal zone of the Mediterranean Sea. Res. Microbiol. 2006, 157, 194–200. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 26th Informational Supplement; M100-S26; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2016. [Google Scholar]
- Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. PAST-palaeontological statistics, ver. 1.89. Palaeontol. Electron. 2001, 4, 1–9. [Google Scholar]
- Gupta, P.K.; Pant, N.D.; Bhandari, R.; Shrestha, P. Cholera outbreak caused by drug resistant Vibrio cholerae serogroup O1 biotype ElTor serotype Ogawa in Nepal; a cross-sectional study. Antimicrob. Resist. Infect. Control 2016, 5, 23. [Google Scholar] [CrossRef] [PubMed]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Brown, K. Penicillin Man: Alexander Fleming and the Antibiotic Revolution; The History Press: London, UK, 2005. [Google Scholar]
- Temba, D.; Namkinga, L.; Moyo, S.; Lyimo, T.; Lugomela, C. Occurrence of pathogenic Vibrio cholerae serogroups 01 and 0139, in some estuaries of Tanzania. Tanzan. J. Sci. 2018, 44, 145–158. [Google Scholar]
- Sulca, M.A.; Orozco, R.; Alvarado, D.E. Antimicrobial resistance not related to 1, 2, 3 integrons and Superintegron in Vibrio spp. isolated from seawater sample of Lima (Peru). Mar. Pollut. Bull. 2018, 131, 370–377. [Google Scholar] [CrossRef] [PubMed]
- Uppal, B.; Mehra, B.; Panda, P.S.; Kumar, S.K. Changing epidemiology and antimicrobial resistance pattern of Vibrio cholerae isolates at a tertiary care health laboratory in North India (2011–2015). Trop. J. Med Res. 2017, 20, 132. [Google Scholar]
- Dengo-Baloi, L.C.; Semá-Baltazar, C.A.; Manhique, L.V.; Chitio, J.E.; Inguane, D.L.; Langa, J.P. Antibiotics resistance in El Tor Vibrio cholerae 01 isolated during cholera outbreaks in Mozambique from 2012, to 2015. PLoS ONE 2017, 12, e0181496. [Google Scholar] [CrossRef] [PubMed]
- Ceccarelli, D.; Chen, A.; Hasan, N.A.; Rashed, S.M.; Huq, A.; Colwell, R.R. Vibrio cholerae non-O1/non-O139 carrying multiple virulence factors and V. cholerae O1 in the Chesapeake Bay, Maryland. Appl. Environ. Microbiol. 2015, 81, 1909–1918. [Google Scholar] [CrossRef]
- Wang, R.; Li, J.; Kan, B. Sequences of a co-existing SXT element, a chromosomal integron (CI) and an IncA/C plasmid and their roles in multidrug resistance in a Vibrio cholerae O1 El Tor strain. Int. J. Antimicrob. Agents 2016, 48, 305–309. [Google Scholar] [CrossRef]
- Forsberg, K.J.; Reyes, A.; Wang, B.; Selleck, E.M.; Sommer, M.O.; Dantas, G. The shared antibiotic resistome of soil bacteria and human pathogens. Science 2012, 337, 1107–1111. [Google Scholar] [CrossRef]
- Guevara Duncan, J.; Roel Pineda, S.; Carpio Gómez, E.D. Vibrio parahaemolyticus en cebiches vendidos por ambulantes de Lima-Peru. Diagnóstico 1989, 24, 23–26. [Google Scholar]
- Ottaviani, D.; Medici, L.; Talevi, G.; Napoleoni, M.; Serratore, P.; Zavatta, E.; Bignami, G.; Masini, L.; Chierichetti, S.; Fisichella, S.; et al. Molecular characterization and drug susceptibility of non-O1/O139 V. ácholerae strains of seafood, environmental and clinical origin, Italy. Food Microbiol. 2018, 72, 82–88. [Google Scholar] [CrossRef] [PubMed]
- Carraro, N.; Sauvé, M.; Matteau, D.; Lauzon, G.; Rodrigue, S.; Burrus, V. Development of pVCR94ΔX from Vibrio cholerae, a prototype for studying multidrug resistant IncA/C conjugative plasmids. Front. Microbiol. 2014, 5, 44. [Google Scholar] [CrossRef]
- Dabanch, J.; Herrero, D.; Pavéz, C.; Veas, N.; Braun, S.; Porte, L. Bacteriemia por Vibrio parahaemolyticus: Reporte de caso y revisión de la literatura. Rev. Chil. Infectolog. 2009, 26, 360–362. [Google Scholar] [CrossRef][Green Version]
- Ramamurthy, T. Antibiotics resistance in Vibrio cholerae. In Vibrio cholerae: Genomic and Molecular Biology; Caister Academic Press: Norfolk, UK, 2008; p. 195. [Google Scholar]
- Vaseeharan, B.; Ramasamy, P.; Murugan, T.; Chen, J.C. In vitro susceptibility of antibiotics against Vibrio spp. and Aeromonas spp. isolated from Penaeus monodon hatcheries and ponds. Int. J. Antimicrob. Agents 2005, 26, 285–291. [Google Scholar] [CrossRef] [PubMed]
- Fluit, A.C.; Schmitz, F.J. Resistance integrons and super-integrons. Clin. Microbiol. Infect. 2004, 10, 272–288. [Google Scholar] [CrossRef] [PubMed]
- Cooper, P.J.; Chico, M.E.; Losonsky, G.; Sandoval, C.; Espinel, I.; Sridhara, R.; Aguilar, M.; Guevara, A.; Guderian, R.H.; Levine, M.M.; et al. Albendazole treatment of children with ascariasis enhances the vibriocidal antibody response to the live attenuated oral cholera vaccine CVD 103-HgR. J. Infect. Dis. 2000, 182, 1199–1206. [Google Scholar] [CrossRef]
- Narendrakumar, L.; Thomas, S. Vibrio cholerae O1 gaining reduced susceptibility to doxycycline, India. J. Glob. Antimicrob. Resist. 2018, 12, 141–142. [Google Scholar] [CrossRef]
- Carraro, N.; Rivard, N.; Ceccarelli, D.; Colwell, R.R.; Burrus, V. IncA/C conjugative plasmids mobilize a new family of multidrug resistance islands in clinical Vibrio cholerae non-O1/non-O139 isolates from Haiti. MBio 2016, 7, e00509-16. [Google Scholar] [CrossRef]
- Shrestha, U.T.; Adhikari, N.; Maharjan, R.; Banjara, M.R.; Rijal, K.R.; Basnyat, S.R.; Agrawal, V.P. Multidrug resistant Vibrio cholerae O1 from clinical and environmental samples in Kathmandu city. BMC Infect. Dis. 2015, 15, 104. [Google Scholar] [CrossRef]
- Yu, L.; Zhou, Y.; Wang, R.; Lou, J.; Zhang, L.; Li, J.; Bi, Z.; Kan, B. Multiple antibiotic resistance of Vibrio cholerae serogroup O139 in China from 1993 to 2009. PLoS ONE 2012, 7, e38633. [Google Scholar] [CrossRef][Green Version]
- Baron, S.; Lesne, J.; Jouy, E.; Larvor, E.; Kempf, I.; Boncy, J.; Rebaudet, S.; Piarroux, R. Antimicrobial susceptibility of autochthonous aquatic Vibrio cholerae in Haiti. Front. Microbiol. 2016, 7, 1671. [Google Scholar] [CrossRef] [PubMed]
- Torane, V.; Kuyare, S.; Nataraj, G.; Mehta, P.; Dutta, S.; Sarkar, B. Phenotypic and antibiogram pattern of V. cholerae isolates from a tertiary care hospital in Mumbai during 2004–2013: A retrospective cross-sectional study. BMJ Open 2016, 6, e012638. [Google Scholar] [CrossRef] [PubMed]
- Wei, W.J.; Yang, H.F.; Ye, Y.; Li, J.B. New Delhi metallo-β-lactamase-mediated carbapenem resistance: Origin, diagnosis, treatment and public health concern. Chin. Med. J. 2015, 128, 1969. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Yan, Z.; Zhang, Y.; Xu, W.; Kong, D.; Shan, Z.; Wang, N. Behavior of antibiotic resistance genes under extremely high-level antibiotic selection pressures in pharmaceutical wastewater treatment plants. Sci. Total. Environ. 2018, 612, 119–128. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Primer Name | Sequence 5′–3′ | Expected Band Size | Annealing Temp | Reference |
---|---|---|---|---|---|
16S rRNA | VF169 | GGA TAA CC/TA TTG GAA ACG ATG | 617 bp | 53 °C | [45] |
VR744 | CAT CTG AGT GTC AGT G/ATC TG | ||||
OmpW | V. choleF | CACCAAGAAGGTGACTTTATTGTG | 304 bp | 64 °C | [50] |
V. choler | GGTTTGTCGAATTAGCTTCACC | ||||
Vc Serogrp | Vc-O1F | GTTTCACTGAACAGATGGG | 192 bp | 55 °C | [19] |
Vc-O1R | GGTCATCTGTAAGTACAAC | ||||
Vc-O139F | AGCCTCTTTATTACGGGTGG | 449 bp | 55 °C | [19] | |
Vc-O139R | GTCAAACCCGATCGTAAAGG | ||||
TetA | TetA-F | GTAATTCTGAGCACTGTCGC | 950 bp | 55 °C | [34] |
TetA-R | CTGCCTGGACAACATTGCTT | ||||
IntI | intI-F | GCTGGATAGGTTAAGGGCGG | 521 bp | 55 °C | [43] |
intI-R | CTCTATGGGCACTGTCCACATTG | ||||
FLOR | flor F | TTATCTCCCTGTCGTTCCAGCG | 586 bp | 55 °C | [43] |
flor R | CCTATGAGCACACGGGGAGC | ||||
Sul | sul2 F | AGGGGGCAGATGTGATCGC | 625 bp | 58 °C | [43] |
sul2 R | TGTGCGGATGAAGTCAGCTCC | ||||
TMP | TMP-F | TGGGTAAGACACTCGTCATGGG | 389 bp | 60.5 °C | [43] |
TMP-R | ACTGCCGTTTTCGATAATGTGG | ||||
QNRVC | qnrVC-F | CCCTCGAGCATGGATAAAACAGACCAGTTATA | 521 bp | 62 °C | [6] |
qnrVC-R | CGGGATCCTTAGTCAGGAACTACTATTAAACCT | ||||
QEP | qepA-F | AACTGCTTGAGCCCGTAGAT | 596 bp | 59 °C | [6] |
qepA-R | GTCTACGCCATGGACCTCAC | ||||
AMPC | ampC-F | TTCTATCAAACTGGCARCC | 545 bp | 45 °C | [31,34] |
ampC-R | CCYTTTTATGTACCCAYGA | ||||
NDM | blaNDM-1-F | GGTTTGGCGATCTGGTTTTC | 621 bp | 52 °C | [51] |
blaNDM-1-R | CGGAATGGCTCATCACGATC | ||||
FQ | FQ-1-F | ATGACGCCATTACTGTATAA | 566 bp | 54 °C | [6] |
FQ-1-R | GATCGCAATGTGTGAAGTTT | ||||
QP | QP-1-F | GATAAAGTTTTTCAGCAAGAGG | 657 bp | 55 °C | [6] |
QP-2-R | ATCCAGATCGGCAAAGGTTA | ||||
Cat | catII-F | ACACTTTGCCCTTTATCGTC | 542 bp | 50 °C | [34] |
catII-R | TGAAAGCCATCACATACTGC | ||||
STR | str-F | CTTGGTGATAACGGCAATTC | 348 bp | 50 °C | [34] |
str-R | CCAATCGCAGATAGAAGGC | ||||
aadA-F | GTGGATGGCGGCCTGAAGCC | 525 bp | 50 °C | [34] | |
aadA-R | AATGCCCAGTCGGCAGCG | ||||
VIM | VIM-F | GATGGTGTTTGGTCGCATA | 390 bp | 55 °C | [33] |
VIM-R | CGAATGCGCAGCACCAG | ||||
GES | GES-F | AGTCGGCTAGACCGGAAAG | 399 bp | 57 °C | [33] |
GES-R | TTTGTCCGTGCTCAGGAT | ||||
IMP | imp-F | TTGACACTCCATTTACDG | 139 bp | 55 °C | [33] |
imp-R | GATYGAGAATTAAGCCACYCT | ||||
TEM | blaTEM-F | ATCAGCAATAAACCAGC | 515 bp | 56 °C | [34,51] |
blaTEM-R | CCCCGAAGAACGTTTTC | ||||
SHV | blaSHV-F | AGGATTGACTGCCTTTTTG | 390 bp | 55 °C | [34,51] |
blaSHV-R | ATTTGCTGATTTCGCTCG |
Location Code | Sampled Water Type | March | PCR Confirmed | April | PCR Confirmed | May | PCR Confirmed | June | PCR Confirmed | July | PCR Confirmed | August | PCR Confirmed | Total V. Cholerae CONFIRMED |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Sample H | Irrigation Canal | Nil | Nil | 15 | 0 | Nil | Nil | 8 | 0 | 6 | 0 | 5 | 0 | |
Dam | Nil | Nil | 13 | 1 | Nil | Nil | 10 | 0 | 5 | 0 | 6 | 1 | ||
River | Nil | Nil | 29 | 1 | Nil | Nil | 11 | 0 | 8 | 0 | 9 | 0 | ||
WWTP | Nil | Nil | Nil | Nil | Nil | Nil | Nil | Nil | Nil | Nil | Nil | Nil | ||
Total prespt/conf | Nil | Nil | 57 | 2 | Nil | Nil | 29 | 0 | 19 | 0 | 20 | 1 | 3 | |
Sample C | Irrigation Canal | 11 | 0 | 8 | 0 | 7 | 0 | 6 | 0 | 5 | 0 | 7 | 0 | |
Dam | 19 | 2 | 11 | 0 | 9 | 0 | 6 | 0 | 6 | 0 | 7 | 1 | ||
River | 18 | 1 | 17 | 0 | 11 | 0 | 7 | 0 | 8 | 0 | 8 | 1 | ||
WWTP | 3 | 0 | 4 | 0 | 2 | 0 | 3 | 0 | 2 | 0 | 3 | 0 | ||
Total prespt/conf | 51 | 3 | 40 | 0 | 29 | 0 | 22 | 0 | 21 | 0 | 25 | 2 | 5 | |
Sample Q | Irrigation Canal | 15 | 2 | 10 | 1 | 8 | 0 | 6 | 0 | 6 | 1 | 7 | 1 | |
Dam | 13 | 2 | 12 | 1 | 9 | 0 | 7 | 0 | 11 | 1 | 7 | 1 | ||
River | 16 | 3 | 14 | 1 | 11 | 1 | 9 | 1 | 14 | 2 | 9 | 2 | ||
WWTP | 23 | 6 | 19 | 2 | 14 | 1 | 11 | 1 | 17 | 2 | 11 | 2 | ||
Total prespt/conf | 67 | 13 | 55 | 5 | 42 | 2 | 33 | 2 | 48 | 6 | 34 | 6 | 34 | |
Sample CF | Irrigation Canal | 7 | 2 | 9 | 1 | 5 | 0 | 5 | 0 | 4 | 0 | 4 | 0 | |
Dam | 9 | 1 | 8 | 1 | 5 | 0 | 6 | 0 | 5 | 0 | 5 | 1 | ||
River | 11 | 2 | 11 | 1 | 7 | 1 | 9 | 1 | 5 | 1 | 6 | 1 | ||
WWTP | 15 | 2 | 11 | 1 | 6 | 1 | Nil | 7 | 1 | 7 | 1 | |||
Total prespt/Conf | 42 | 7 | 39 | 4 | 23 | 2 | 20 | 1 | 21 | 2 | 22 | 3 | 19 |
PLANTS | N | Mean of Count ± S.E.M | F | P |
---|---|---|---|---|
cof WWTP | 18 | 18.17 ± 8.23 | 26.78 | 0.00 * |
QT WWTP | 18 | 244.61 ± 44.86 | ||
Cath WWTP | 18 | 0.00 ± 0.00 | ||
Total | 54 | 87.59 ± 21.36 |
Antibiotic Class/Group | Antibiotic Types | Sensitive (%) | V. cholerae (N = 61) | Resistance (%) |
---|---|---|---|---|
Intermediate (%) | ||||
Penicillin | AP-25 µg | 16 (26.2) | 10 (16.4) | 34 (55.7) |
β -Lactam/β-Lactamase Inhibitor | AUG-30 µg | 25 (41.0) | 1 (1.6) | 35 (57.4 |
SAM-20 µg | 31 (50.8) | 11 (18.0) | 19 (31.2) | |
PTZ-110 µg | 59 (96.7) | 0 | 2 (3.3) | |
Cephalosporin/Cephem | CRO-30 µg | 57 (93.4) | 1 (1.6) | 3 (4.9) |
CPM-30 µg | 57 (93.4) | 3 (4.9) | 1 (1.6) | |
CXM-30 µg | 52 (85.3) | 2 (3.3) | 7 (11.5) | |
CAZ-30 µg | 59 (96.7) | 0 | 2 (3.3) | |
CZ-30 µg | 33 (54.1) | 6 (9.8) | 22 (36.1) | |
CTX-30 µg | 54 (88.5) | 0 | 7 (11.5) | |
CFX-30 µg | 7 (11.5) | 7 (11.5) | 47 (77.1) | |
KF-30 µg | 11 (18.0) | 14 (23.0) | 36 (59.0) | |
Carbapenems | IMI-10 µg | 59 (96.7) | 2 (3.3) | 0 |
MEM-10 µg | 61 (100) | 0 | 0 | |
ETP-10 µg | 53 (86.9) | 3 (4.9) | 5 (8.2) | |
DOR-10 µg | 59 (96.7) | 1 (1.6) | 1 (1.6) | |
Macrolides | ATH-15 µg | 42 (68.9) | 0 | 19 (31.2) |
E-15 µg | 15 (24.6) | 0 | 46 (75.4) | |
Phenicols | C-30 µg | 18 (29.5) | 4 (6.6) | 39 (63.9) |
Aminoglycosides | GM-10 µg | 61 (100) | 0 | 0 |
S-300 µg | 60 (98.4) | 1 (1.6) | 0 | |
AK-30 µg | 61 (100) | 0 | 0 | |
K-30 µg | 42 (68.9) | 3 (4.9) | 16 (26.2) | |
Fluoroquinolones | CIP-5 µg | 50 (81.9) | 8 (13.1) | 3 (4.9) |
LEV-5 µg | 59 (96.7) | 1 (1.6) | 1 (1.6) | |
NOR-10 µg | 56 (91.8) | 5 (8.2) | 0 | |
NA-30 µg | 44 (72.1) | 10 (16.4) | 7 (11.5) | |
Tetracycline | T-30 µg | 15 (24.6) | 3 (4.9) | 43 (70.5) |
DXT-30 µg | 15 (24.6 | 1 (1.6) | 45 (73.8) | |
Folate Pathway Inhibitor | TS-25 µg | 20 (32.8) | 1 (1.6) | 40 (65.6) |
Nitrofuran | NI-200 µg | 16 (26.2) | 2 (3.3) | 43 (70.5) |
Isolates | Resistant Markers/Phenotypes of Isolates | NO. R | NO. I | S.NO | MARI |
---|---|---|---|---|---|
21 | AP, Ni, DXT, T, TS, AUG, SAM, CTX, KF, E, CFX | 11 | 0 | 18 | 0.344 |
50 | C, NI, DXT, T, TS, AUG, SAM, KF, E, CFX, NA | 9 | 2 | 18 | 0.281 |
84 | AP, C, NI, DXT, T, TS, AUG, SAM, KF, E, CFX, NA | 12 | 2 | 15 | 0.375 |
98 | CXM, AP, CZ, C, NI, DXT, T, KF, E, CFX | 10 | 1 | 18 | 0.313 |
107 | CXM, AP, CZ, C, NI, DXT, T, TS, PTZ, AUG, SAM, KF, E, CFX | 14 | 0 | 15 | 0.438 |
108 | AP, C, NI, DXT, T, TS, PTZ, SAM, CFX, NA | 10 | 2 | 17 | 0.313 |
109 | AP, C, NI, DXT, T, TS, SAM, E, CFX | 9 | 3 | 17 | 0.281 |
110 | AP, K, C, NI, DXT, T, TS, E, ATH | 9 | 1 | 19 | 0.281 |
112 | CZ, DOR, C, NI, DXT, T, TS, AUG, KF, E, CFX, ATH | 12 | 4 | 13 | 0.375 |
166 | AP, CZ, C, NI, DXT, T, TS, AUG, KF, E, CFX | 11 | 1 | 17 | 0.344 |
129 | CXM, CAZ, CZ, ETP, C, NI, DXT, T, TS, AUG, CTX, KF, CFX | 14 | 6 | 10 | 0.438 |
127 | AP, CZ, C, NI, DXT, T, TS, AUG, SAM, CTX, KF, E, CFX | 13 | 0 | 16 | 0.406 |
126 | AP, C, NI, DXT, T, TS, AUG, E, CFX | 9 | 2 | 18 | 0.281 |
113 | AP, C, NI, DXT, T, TS, AUG, E, CFX | 9 | 3 | 17 | 0.281 |
181 | AP, CZ, C, NI, DXT, T, TS, AUG, KF, E, CFX, ATH | 12 | 0 | 17 | 0.375 |
339 | AP, NI, DXT, T, TS, AUG, SAM, KF, E, CFX, ATH | 11 | 1 | 17 | 0.344 |
411 | AP, K, C, NI, DXT, T, TS, AUG, E, CFX, ATH | 11 | 2 | 16 | 0.344 |
438 | AP, CZ, K, C, NI, DXT, T, AUG, KF, E, CFX | 11 | 0 | 18 | 0.344 |
358 | C, NI, DXT, T, TS, AUG, SAM, KF, E, CFX | 10 | 0 | 19 | 0.313 |
757 | CRO, CXM, AP, CZ, ETP, C, NI, DXT, T, TS, AUG, CTX, KF, E, CFX, ATH | 16 | 1 | 13 | 0.500 |
756 | CRO, CXM, AP, CZ, ETP, C, NI, DXT, T, TS, AUG, CTX, KF, E, CFX, ATH | 16 | 3 | 11 | 0.500 |
753 | CZ, ETP, NI, DXT, AUG, CTX, KF, E, CFX | 9 | 4 | 16 | 0.281 |
663 | AP, CZ, C, NI, DXT, T, TS, AUG, KF, E, CFX, ATH | 12 | 1 | 16 | 0.375 |
543 | CXM, AP, CZ, ETP, C, NI, T, DXT, AUG, SAM, KF, E, CFX | 13 | 2 | 14 | 0.406 |
36 | AP, K, C, NI, DXT, T, TS, AUG, E, CFX, ATH | 11 | 2 | 16 | 0.344 |
759 | AP, CZ, K, C, NI, DXT, T, TS, E, CFX | 9 | 3 | 18 | 0.281 |
573 | AP, K, C, NI, DXT, T, TS, E, ATH | 9 | 3 | 17 | 0.281 |
575 | CXM, AP, K, C, NI, DXT, T, TS, AUG, KF, E, CFX, ATH | 13 | 1 | 15 | 0.406 |
62 | AP, K, C, NI, DXT, T, TS, KF, E, CFX | 10 | 0 | 19 | 0.313 |
344 | AP, CZ, K, C, NI, DXT, T, TS, AUG, SAM, KF, E, CFX, CIP, NA | 15 | 1 | 13 | 0.469 |
338 | AP, CZ, K, C, DXT, T, TS, AUG, SAM, KF, E, CFX, ATH, CIP | 14 | 2 | 13 | 0.438 |
337 | AP, K, C, NI, DXT, T, TS, AUG, SAM, KF, E, CFX, CIP | 13 | 1 | 15 | 0.406 |
I | AP, CZ, K, C, NI, DXT, T, TS, AUG, SAM, KF, E, CFX, ATH, NA, LEV | 16 | 2 | 11 | 0.500 |
Resistant Phenotypes | Numbers of Accessed Isolates (%) | Numbers Showing Positive Phenotype (%) |
---|---|---|
AmpC | 30 (49.2) | 21 (34.4) |
ESβL | 29 (47.5) | 26 (42.6) |
NDM-1 | 19 (31.1) | 14 (23.0) |
Antibiotics Groups | Total Number of Vibrio Cholerae (%) | Resistant Genes Determined | Number/Percentage Resistance Observed (%) |
---|---|---|---|
BetaLactam/β-lactamase inhibitors/Cephalosporins | 29/61 (47.5%) | blaTEM | 25/29 (86.2) |
blaSHV | 2/29 (6.9) | ||
blaCTXM | Nil | ||
30/61 (49.2%) | AmpC | 17/30 (56.7) | |
Carbapenems | 19/61 (31.1%) | NDM-1 | 8/19 (42.1) |
GES | Nil | ||
IMP | 1/19 (5.3) | ||
VIM | Nil | ||
Phenicols | (39/61, 63.9%) | Flor | 18/39 (46.2) |
CatII | 14/39 (35.9) | ||
Fluoroquinolones | 11/61 (18.33%) | QP1 | Nil |
FQ | Nil | ||
QNRVC | 3/11 (27.3) | ||
QEP | 1/11 (9.1) | ||
Aminoglycosides | 61/61 (100) | strA | 4/61 (6.6) |
aadA | Nil | ||
Folate Pathway Inhibitor/Trimetoprime-Sulphametoxazol | 40/61, (65.6%) | TMP | 13/40 (32.5) |
Sul2 INT1 | 29/40 (72.5) 26/40 (65.0) | ||
Cyclines | 45/61 (73.8%) | tetA | 21/45 (46.7) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Igere, B.E.; Okoh, A.I.; Nwodo, U.U. Antibiotic Susceptibility Testing (AST) Reports: A Basis for Environmental/Epidemiological Surveillance and Infection Control Amongst Environmental Vibrio cholerae. Int. J. Environ. Res. Public Health 2020, 17, 5685. https://doi.org/10.3390/ijerph17165685
Igere BE, Okoh AI, Nwodo UU. Antibiotic Susceptibility Testing (AST) Reports: A Basis for Environmental/Epidemiological Surveillance and Infection Control Amongst Environmental Vibrio cholerae. International Journal of Environmental Research and Public Health. 2020; 17(16):5685. https://doi.org/10.3390/ijerph17165685
Chicago/Turabian StyleIgere, Bright E., Anthony I. Okoh, and Uchechukwu U. Nwodo. 2020. "Antibiotic Susceptibility Testing (AST) Reports: A Basis for Environmental/Epidemiological Surveillance and Infection Control Amongst Environmental Vibrio cholerae" International Journal of Environmental Research and Public Health 17, no. 16: 5685. https://doi.org/10.3390/ijerph17165685
APA StyleIgere, B. E., Okoh, A. I., & Nwodo, U. U. (2020). Antibiotic Susceptibility Testing (AST) Reports: A Basis for Environmental/Epidemiological Surveillance and Infection Control Amongst Environmental Vibrio cholerae. International Journal of Environmental Research and Public Health, 17(16), 5685. https://doi.org/10.3390/ijerph17165685