Determination of the Microbial and Chemical Loads in Rivers from the Quito Capital Province of Ecuador (Pichincha)—A Preliminary Analysis of Microbial and Chemical Quality of the Main Rivers
Abstract
:1. Introduction
2. Methods
2.1. Sample Site and Collection
2.2. Sample Preparation for Microbiological Analysis
2.3. Cultivation of Microorganisms from River Samples
2.4. DNA Extraction
2.5. Molecular Identification of the Microbial Load
2.5.1. Bacterial Genera and Candida Albicans
2.5.2. Cryptosporidium and Giardia spp.
2.5.3. Escherichia coli Pathotypes
2.6. PCR Product Analysis
PCR Product Sequencing
2.7. Analytical Methods
2.8. Quality Assurance/Quality Control
2.9. Statistical Analysis
3. Results
3.1. Growth of Microbial Genera and Escherichia coli/Total Coliforms Counts
3.2. Detection of Microbial Genera, Candida Albicans, and Escherichia coli Pathotypes
3.3. Analysis of Physical Parameters and Chemical Elements
3.4. Analysis of Metallic Trace Elements
3.5. Statistical Analysis
4. Discussion
4.1. Fecal Coliform Bacteria in River Water Resources
4.2. E. coli Pathotypes Detection
4.3. Analysis of Commensal and Parasitic Microorganisms
4.4. Evaluation of Physico-Chemical Parameters in Water Samples
4.5. Determination of Minor and Major Elements in Water Samples
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kora, A.J.; Rastogi, L.; Kumar, S.J.; Jagatap, B.N. Physico-chemical and bacteriological screening of Hussain Sagar lake: An urban wetland. Water Sci. 2017, 31, 24–33. [Google Scholar] [CrossRef] [Green Version]
- Noorhosseini, S.A.; Allahyari, M.S.; Damalas, C.A.; Moghaddam, S.S. Public environmental awareness of water pollution from urban growth: The case of Zarjub and Goharrud rivers in Rasht, Iran. Sci. Total Environ. 2017, 599–600, 2019–2025. [Google Scholar] [CrossRef] [PubMed]
- Olguín, E.J.; González-portela, R.E.; Sánchez-galván, G.; Zamora-, J.E. Contaminación de ríos urbanos: El caso de la subcuenca del río Sordo en Xalapa, Veracruz, México. Rev. Lat. Biotecnol. Amb. Algal 2010, 1, 178–190. [Google Scholar]
- Zhang, X.; Wu, Y.; Gu, B. Urban rivers as hotspots of regional nitrogen pollution. Environ. Pollut. 2015, 205, 139–144. [Google Scholar] [CrossRef]
- Paul, D. Research on heavy metal pollution of river Ganga: A review. Ann. Agrar. Sci. 2017, 15, 278–286. [Google Scholar] [CrossRef]
- Staley, C.; Gould, T.J.; Wang, P.; Phillips, J.; Cotner, J.B.; Sadowsky, M.J. Bacterial community structure is indicative of chemical inputs in the Upper Mississippi River. Front. Microbiol. 2014, 5, 1–13. [Google Scholar] [CrossRef] [Green Version]
- WHO. Water Quality Monitoring: A Practical Guide to the Design and Implementation of Freshwater Quality Studies and Monitoring Programmes; WHO: Geneva, Switzerland, 1996; ISBN 9781107671812. [Google Scholar]
- Ramírez Castillo, F.Y.; Avelar González, F.J.; Garneau, P.; Díaz, F.M.; Guerrero Barrera, A.L.; Harel, J. Presence of multi-drug resistant pathogenic Escherichia coli in the San Pedro River located in the State of Aguascalientes, Mexico. Front. Microbiol. 2013, 4, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Valencia, R.; Ortiz, E.; Gomez, J.L. La contaminación de los ríos, otro punto de vista. Cienc. Front. 2014, 7. [Google Scholar]
- UNESCO. Informe Mundial de las Naciones Unidas sobre el Desarrollo de los Recursos Hídricos 2017. Aguas residuales: El recurso Desaprovechado; UNESCO: Paris, France, 2017; ISBN 978-92-3-300058-2. [Google Scholar]
- WHO. Waterborne Disease Related to Unsafe Water and Sanitation; WHO: Geneva, Switzerland, 2018; pp. 9–10. [Google Scholar]
- Fretes, V.; Giugale, M.; López, J. Ecuador: An Economic and Social Agenda in the New Millenium; The World Bank: Washington, DC, USA, 2003; ISBN 0821355457. [Google Scholar]
- Vasco, G.; Trueba, G.; Atherton, R.; Calvopiña, M.; Cevallos, W.; Andrade, T.; Eguiguren, M.; Eisenberg, J.N.S. Identifying etiological agents causing diarrhea in low income Ecuadorian communities. Am. J. Trop. Med. Hyg. 2014, 91, 563–569. [Google Scholar] [CrossRef] [Green Version]
- INEC. Resultados del Censo 2010 de Población y Vivienda en el Ecuador. Fascículo Provincial Pichincha; INEC: Quito, Republic of Ecuador, 2010. [Google Scholar]
- Sistema Nacional de Información Quito, Pichincha. 2010. Republic of Ecuador, National Information. Available online: https://sni.gob.ec/inicio (accessed on 22 June 2020).
- Gomez, L.; Torres, M.; Landazuri, A.; Mayorga, L. Programa para la descontaminación de los ríos de Quito, PDRQ. In Proceedings of the VI International Conference of Una Perspectiva Internacional sobre Recursos Hídricos y Medio Ambiente, Quito, Ecuador, 7–9 January 2014; p. 9. [Google Scholar]
- EPMAPS. Estudio De Impacto Ambiental: Construcción y Operación-Mantenimiento de la Planta de Recuperación de agua en el sector Quitumbe. Calid. Ambient. 2013, 2–26. [Google Scholar]
- Unidad de Noticias. El proyecto Vindobona arranca para la descontaminación de los ríos de Quito. El Comercio 2019, 1–3. [Google Scholar]
- Perez Naranjo, C.; Maurice, L.; Ochoa-Herrera, V.; Lopez, F.; Egas, D.; Lagane, C.; Besson, P. Determinación de elementos mayores en sedimentos provenientes de zonas afectadas por actividades petroleras en Ecuador. ACI Avances Ciencias Ingenierías. 2015, 7, C95–C115. [Google Scholar] [CrossRef]
- Vizcaíno, P.; Carrera, E.V.; Sanroman, M.; Rojo-Alvarez, J.L. Spatio-Temporal Analysis of Water Quality Parameters in Machángara River with Nonuniform Interpolation Methods Spatio-Temporal Analysis of Water Quality Parameters in Machángara River with Nonuniform Interpolation Methods. Water 2016, 8, 507. [Google Scholar] [CrossRef]
- Voloshenko, A.; Cumbal, L.; Lev, O. Emerging pollutants in the Esmeraldas watershed in Ecuador: Discharge and attenuation of emerging organic pollutants along. Environmental Science Processes & Impacts Emerging pollutants in the Esmeraldas watershed in Ecuador: Discharge and attenuati. Environ. Sci. Process. Impacts 2014, 1–13. [Google Scholar] [CrossRef]
- Campaña, A.; Gualoto, E.; Chiluisa-Utreras, V. Evaluación físico-química y microbiológica de la calidad del agua de los ríos Machángara y Monjas de la red hídrica del distrito metropolitano de Quito. Bionatura 2017, 2, 305–310. [Google Scholar] [CrossRef] [Green Version]
- Benítez, M.B.; Champagne, P.; Ramos, A.; Torres, A.F.; Ochoa-Herrera, V. Wastewater treatment for nutrient removal with Ecuadorian native microalgae. Environ. Technol. (United Kingdom) 2018, 3330, 1–9. [Google Scholar] [CrossRef]
- Liang, X.; Liao, C.; Thompson, M.L.; Soupir, M.L.; Jarboe, L.R.; Dixon, P.M.E. coli surface properties differ between stream water and sediment environments. Front. Microbiol. 2016, 7, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Dobrowsky, P.H.; De Kwaadsteniet, M.; Cloete, T.E.; Khan, W. Distribution of indigenous bacterial pathogens and potential pathogens associated with roof-harvested rainwater. Appl. Environ. Microbiol. 2014, 80, 2307–2316. [Google Scholar] [CrossRef] [Green Version]
- Dobrowsky, P.H.; van Deventer, A.; De Kwaadsteniet, M.; Ndlovu, T.; Khan, S.; Cloete, T.E.; Khan, W. Prevalence of virulence genes associated with pathogenic Escherichia coli strains isolated from domestically harvested rainwater during low- and high-rainfall periods. Appl. Environ. Microbiol. 2014, 80, 1633–1638. [Google Scholar] [CrossRef] [Green Version]
- Gallas-Lindemann, C.; Sotiriadou, I.; Plutzer, J.; Noack, M.J.; Mahmoudi, M.R.; Karanis, P. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP). Acta Trop. 2016, 158, 43–51. [Google Scholar] [CrossRef]
- Law, J.W.-F.; Ab Mutalib, N.-S.; Chan, K.-G.; Lee, L.-H. Rapid methods for the detection of foodborne bacterial pathogens: Principles, applications, advantages and limitations. Front. Microbiol. 2014, 5, 770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reyes, J.; Vergara, I.; Torres, O.; Díaz, M.; González, E. Contaminación por metales pesados: Implicaciones en salud, ambiente y seguridad alimentaria. Rev. Ing. Investig. Desarro. 2016, 16, 66–77. [Google Scholar] [CrossRef]
- Ahmed, W.; Sidhu, J.P.S.; Toze, S. An Attempt to Identify the Likely Sources of Escherichia coli Harboring Toxin Genes in Rainwater Tanks. Environ. Sci. Technol. 2012, 46, 5193–5197. [Google Scholar] [CrossRef] [PubMed]
- Stanwell-Smith, R.; Zinnser, H.; Brundtland, G.H.; Satcher, D.; Wilson, M.E. Emerging Issues in Water and Infectious Disease; WHO: Geneva, Switzerland, 2003; Volume 1, pp. 1–24. [Google Scholar]
- Museo Ecuatoriano de Ciencias Naturales (MECN). Ecosistemas del Distrito Metropolitano de Quito DMQ; Editorial Fondo Ambiental del Municipio del Distrito Metropolitano de Quito: Quito, Ecuador, 2009; ISBN 9789978996713. [Google Scholar]
- APHA. Standard Methods for the Examination of Water and Wastewater; APHA: Washington, DC, USA, 2012; Volume 22, ISBN 9780875530130. [Google Scholar]
- Luo, G.; Mitchell, T.G. Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR. J. Bacteriol. 2002, 40, 2860. [Google Scholar] [CrossRef]
- Salza, S. Ricerca e Caratterizzazione di Protozoi Zoonosici in Mitili Allevati e Commercializzati Nella Regione Sardegna; Università degli Studi di Sassari: Sassari, Italy, 2014. [Google Scholar]
- Yu, J.R.; Lee, S.U.; Park, W.Y. Comparative sensitivity of PCR primer sets for detection of Cryptosporidium parvum. Korean J. Parasitol. 2009, 47, 293–297. [Google Scholar] [CrossRef] [Green Version]
- Grube, A.M.; Stewart, J.R.; Ochoa-Herrera, V. The challenge of achieving safely managed drinking water supply on San Cristobal island, Galápagos. Int. J. Hyg. Environ. Health 2020, 228, 113547. [Google Scholar] [CrossRef]
- Recreational Water Quality Criteria. 2012. Available online: http://www.adeq.state.ar.us/regs/drafts/reg02/13-003-R/comments/reg_2_comments_bwd_attachment_8.pdf (accessed on 22 June 2020).
- FAO. TULSMA Norma De Calidad Ambiental Y De Descarga De Efluentes: Recurso Agua; FAO: Rome, Italy, 2015. [Google Scholar]
- Costa, C.F.M.; Monteiro Neto, V.; de Santos, B.R.C.; Costa, B.R.R.; Azevedo, A.; Serra, J.L.; Mendes, H.B.R.; Nascimento, A.R.; Mendes, M.B.P.; Kuppinger, O. Enterobacteria identification and detection of diarrheagenic Escherichia coli in a Port Complex. Braz. J. Microbiol. 2014, 45, 945–952. [Google Scholar] [CrossRef] [Green Version]
- Ndlovu, T.; Le Roux, M.; Khan, W.; Khan, S. Co-detection of virulent escherichia coli genes in surface water sources. PLoS ONE 2015, 10, 1–12. [Google Scholar] [CrossRef]
- Gorchev, H.G.; Ozolins, G. WHO guidelines for drinking-water quality. WHO Chron. 2011, 38, 104–108. [Google Scholar] [CrossRef]
- Mukaka, M.M. Statistics corner: A guide to appropriate use of correlation coefficient in medical research. Malawi Med. J. 2012, 24, 69–71. [Google Scholar]
- Carvalho, C.D.F.; Stapelfeldt, F. Qualidade das águas do ribeirão Ubá-MG. Geociencias 2004, 57, 165–172. [Google Scholar] [CrossRef] [Green Version]
- Rivera, N.R.; Encina, F.; Mejias, A.M.P. La Calidad de las Aguas en los Ríos Cautín e Imperial, IX Región- Chile Water Quality in the Cautín and Imperial Rivers, IX Region-Chile. Inf. Tecnológica 2004, 15, 89–101. [Google Scholar]
- Khan, F.; Husain, T.; Lumb, A. Water quality evaluation and trend analysis in selected watersheds of the Atlantic region of Canada. Environ. Monit. Assess. 2003, 88, 221–242. [Google Scholar] [CrossRef] [PubMed]
- Lenart-Boroń, A.; Wolanin, A.; Jelonkiewicz, E.; Żelazny, M. The effect of anthropogenic pressure shown by microbiological and chemical water quality indicators on the main rivers of Podhale, southern Poland. Environ. Sci. Pollut. Res. 2017, 24, 12938–12948. [Google Scholar] [CrossRef] [Green Version]
- Ferronato, C.; Modesto, M.; Stefanini, I.; Vianello, G.; Biavati, B.; Antisari, L.V. Chemical and Microbiological Parameters in Fresh Water and Sediments to Evaluate the Pollution Risk in the Reno River Watershed (North Italy). J. Water Resour. Prot. 2013, 5, 458–468. [Google Scholar] [CrossRef] [Green Version]
- Dragun, Z.; Kapetanovic, D.; Raspor, B.; Teskeredžic, E. Water quality of medium size watercourse under baseflow conditions: The case study of river Sutla in Croatia. Ambio 2011, 40, 391–407. [Google Scholar] [CrossRef] [Green Version]
- Doherty, M.; Yager, P.L.; Moran, M.A.; Coles, V.J.; Fortunato, C.S.; Krusche, A.V.; Medeiros, P.M.; Payet, J.P.; Richey, J.E.; Satinsky, B.M.; et al. Bacterial biogeography across the Amazon River-ocean continuum. Front. Microbiol. 2017, 8, 1–17. [Google Scholar] [CrossRef]
- Mainville, N.; Webb, J.; Lucotte, M.; Davidson, R.; Betancourt, O.; Cueva, E.; Mergler, D. Decrease of soil fertility and release of mercury following deforestation in the Andean Amazon, Napo River Valley, Ecuador. Sci. Total Environ. 2006, 368, 88–98. [Google Scholar] [CrossRef]
- Barraza, F.; Maurice, L.; Uzu, G.; Becerra, S.; López, F.; Ochoa-Herrera, V.; Ruales, J.; Schreck, E. Distribution, contents and health risk assessment of metal(loid)s in small-scale farms in the Ecuadorian Amazon: An insight into impacts of oil activities. Sci. Total Environ. 2018, 622–623, 106–120. [Google Scholar] [CrossRef]
- Vargas-solano, S.V.; Rodríguez-gonzález, F.; Arenas-ocampo, M.L.; Martínez-velarde, R.; Sujitha, S.B.; Jonathan, M.P. Heavy metals in the volcanic and peri-urban terrain watershed of the River Yautepec, Mexico. Environ. Monit. Assess. 2019, 191. [Google Scholar] [CrossRef]
- Kaushik, R.; Balasubramanian, R.; Dunstan, H. Microbial quality and phylogenetic diversity of fresh rainwater and tropical freshwater reservoir. PLoS ONE 2014, 9. [Google Scholar] [CrossRef] [PubMed]
- Merz, J.; Dangol, P.M.; Dhakal, M.P.; Dongol, B.S.; Nakarmi, G.; Weingartner, R. Rainfall-runoff events in a middle mountain catchment of Nepal. J. Hydrol. 2006, 331, 446–458. [Google Scholar] [CrossRef]
- Nikiema, J.; Figoli, A.; Weissenbacher, N.; Langergraber, G.; Marrot, B.; Moulin, P. Wastewater treatment practices in Africa-experiences from seven countries. Sustain. Sanit. Pr. 2013, 14, 16–24. [Google Scholar]
- Panswad, T.; Polprasert, C.; Yamamoto, K. Water Pollution Control in Asia. In Proceedings of the International Association of Water Pollution Research and Control, Bangkok, Thailand, 9–11 November 1988; Elsevier: Amsterdam, The Netherlands, 1988. [Google Scholar]
- Proaño, R.G.S.; Gualoto, K.J.G. Wastewater treatment of industrial loads with advanced oxidation in conventional systems. La Granja J. Life Sci. 2018, 27, 103–111. [Google Scholar] [CrossRef]
- Montero, C.; Castañeda, K.; Oña, M.; Flores, D.; De La Rosa, A. Catalyst based on sludge derived from wastewater treatment of textile industry. Chem. Eng. Trans. 2018, 70, 931–936. [Google Scholar] [CrossRef]
- Jacoby, R.; Peukert, M.; Succurro, A.; Koprivova, A. The Role of Soil Microorganisms in Plant Mineral Nutrition—Current Knowledge and Future Directions. Front. Plant Sci. 2017, 8, 1–19. [Google Scholar] [CrossRef] [Green Version]
- Vadde, K.; Wang, J.; Cao, L.; Yuan, T.; McCarthy, A.J.; Sekar, R. Assessment of Water Quality and Identification of Pollution Risk Locations in Tiaoxi River. Water 2018, 10, 183. [Google Scholar] [CrossRef] [Green Version]
- Vrzel, J.; Vukovi, B.; Kolarevi, S.; Ga, Z.; Kra, M.; Kosti, J.; Aborgiba, M.; Farnleitner, A.; Reischer, G.; Linke, R.; et al. Science of the Total Environment Determination of the sources of nitrate and the microbiological sources of pollution in the Sava River Basin. Sci. Total Environ. 2016, 573, 1460–1471. [Google Scholar] [CrossRef] [Green Version]
- Sandoval Villasana, A.M.; Pulido-Flores, G.; Monks, S.; Gordillo Martinez, A.J.; Villegas Villareal, E.C. Physicochemical, microbiological and toxicological evaluation of the environmental degradation of the Atoyac river, Mexico. Interciencia 2009, 34, 880–887. [Google Scholar]
- Gowrisankar, G.; Chelliah, R.; Ramakrishnan, S.R.; Elumalai, V.; Dhanamadhavan, S.; Brindha, K.; Antony, U.; Elango, L. Data Descriptor: Chemical, microbial and antibiotic susceptibility analyses of groundwater after a major flood event in Chennai. Sci. Data 2017, 4, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Islam, M.S.; Tusher, T.R.; Mustafa, M.; Mahmud, S. Effects of Solid Waste and Industrial Effluents on Water Quality of Turag River at Konabari Industrial Area, Gazipur, Bangladesh. J. Environ. Sci. Nat. Resour. 2013, 5, 213–218. [Google Scholar] [CrossRef]
- Al-Badaii, F.; Shuhaimi-Othman, M.; Barzan, M. Water Quality Assessment of the Semenyih River, Selangor, Malaysia. J. Chem. 2013, 2013, 31–34. [Google Scholar] [CrossRef] [Green Version]
- Onyekuru, S.O.; Okereke, C.N.; Ibeneme, S.I.; Nnaji, A.O. An Evaluation of the Spatial Distributions of the Physico-Chemical and Microbial Contents of Nworie River in Owerri, Southeastern Nigeria. Br. J. Appl. Sci. Technol. 2014, 4, 3687–3700. [Google Scholar] [CrossRef]
- Karikari, A.Y.; Ansa-Asare, O.D. Physico-Chemical and Microbial Water Quality Assessment of Densu River of Ghana. West Afr. J. Appl. Ecol. 2006, 10, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Rawway, M.; Kamel, M.S.; Abdul-raouf, U.M. Microbial and Physico-Chemical Assessment of Water Quality of the River Nile at Assiut Governorate (Upper Egypt) Microbial and Physico-Chemical Assessment of Water Quality of the River Nile at Assiut Governorate (Upper Egypt). J. Heal. Ecol. 2016, 1, 7–14. [Google Scholar] [CrossRef]
- Nontongana, N.; Sibanda, T.; Ngwenya, E.; Okoh, A.I. Prevalence and antibiogram profiling of Escherichia coli pathotypes isolated from the kat river and the fort beaufort abstraction water. Int. J. Environ. Res. Public Health 2014, 11, 8213–8227. [Google Scholar] [CrossRef] [Green Version]
- Sidhu, J.P.S.; Ahmed, W.; Hodgers, L.; Toze, S. Occurrence of virulence genes associated with diarrheagenic pathotypes in Escherichia coli isolates from surface water. Appl. Environ. Microbiol. 2013, 79, 328–335. [Google Scholar] [CrossRef] [Green Version]
- Titilawo, Y.; Obi, L.; Okoh, A. Occurrence of virulence gene signatures associated with diarrhoeagenic and non-diarrhoeagenic pathovars of Escherichia coli isolates from some selected rivers in South-Western Nigeria. BMC Microbiol. 2015, 15, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Islam, M.Z.; Musekiwa, A.; Islam, K.; Ahmed, S.; Chowdhury, S.; Ahad, A.; Biswas, P.K. Regional variation in the prevalence of E. coli O157 in cattle: A meta-analysis and meta-regression. PLoS ONE 2014, 9. [Google Scholar] [CrossRef] [Green Version]
- Okeke, I.N.; Lamikanra, A.; Steinrück, H.; Kaper, J.B. Characterization of Escherichia coli strains from cases of childhood diarrhea in provincial southwestern Nigeria. J. Clin. Microbiol. 2000, 38, 7–12. [Google Scholar]
- Ebomah, K.E.; Adefisoye, M.A.; Okoh, A.I. Pathogenic Escherichia coli strains recovered from selected aquatic resources in the eastern cape, South Africa, and its significance to public health. Int. J. Environ. Res. Public Health 2018, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Opinion, S. Public health risks associated with Enteroaggregative Escherichia coli (EAEC) as a food-borne pathogen. EFSA J. 2015, 13, 1–88. [Google Scholar] [CrossRef] [Green Version]
- Weintraub, A. Enteroaggregative Escherichia coli: Epidemiology, virulence and detection. J. Med. Microbiol. 2007, 56, 4–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gomi, R.; Matsuda, T.; Fujimori, Y.; Harada, H.; Matsui, Y.; Yoneda, M. Characterization of pathogenic Escherichia coli in river water by simultaneous detection and sequencing of 14 virulence genes. Environ. Sci. Technol. 2015, 49, 6800–6817. [Google Scholar] [CrossRef] [PubMed]
- Stange, C.; Sidhu, J.P.S.; Tiehm, A.; Toze, S. Antibiotic resistance and virulence genes in coliform water isolates. Int. J. Hyg. Environ. Health 2016, 219, 823–831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bouzari, S.; Jafari, A.; Aslani, M.M. Escherichia coli: A brief review of diarrheagenic pathotypes and their role in diarrheal diseases in Iran. Iran. J. Microbiol. 2012, 4, 102–117. [Google Scholar]
- Ochoa, T.J.; Barletta, F.; Contreras, C.; Mercado, E. New insights into the epidemiology of enteropathogenic Escherichia coli infection. Trans Soc. Trop. Med. Hyg. 2008, 102, 852–856. [Google Scholar] [CrossRef] [Green Version]
- Van Den Beld, M.J.C.; Warmelink, E.; Friedrich, A.W.; Reubsaet, F.A.G.; Schipper, M.; De Boer, R.F.; Notermans, D.W.; Petrignani, M.W.F.; Van Zanten, E.; Rossen, J.W.A.; et al. Incidence, clinical implications and impact on public health of infections with Shigella spp. and entero-invasive Escherichia coli (EIEC): Results of a multicenter cross-sectional study in the Netherlands during 2016–2017. BMC Infect. Dis. 2019, 19, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Troeger, C.; Forouzanfar, M.; Rao, P.C.; Khalil, I.; Brown, A.; Reiner, R.C.; Fullman, N.; Thompson, R.L.; Abajobir, A.; Ahmed, M.; et al. Estimates of global, regional, and national morbidity, mortality, and aetiologies of diarrhoeal diseases: A systematic analysis for the Global Burden of Disease Study 2015. Lancet Infect. Dis. 2017, 17, 909–948. [Google Scholar] [CrossRef] [Green Version]
- Newitt, S.; MacGregor, V.; Robbins, V.; Bayliss, L.; Anne Chattaway, M.; Dallman, T.; Ready, D.; Aird, H.; Puleston, R.; Hawker, J. Two linked enteroinvasive Escherichia coli outbreaks, Nottingham, UK, June 2014. Emerg. Infect. Dis. 2016, 22, 1178–1184. [Google Scholar] [CrossRef] [Green Version]
- Escher, M.; Scavia, G.; Morabito, S.; Tozzoli, R.; Maugliani, A.; Cantoni, S.; Fracchia, S.; Bettati, A.; Casa, R.; Gesu, G.P.; et al. A severe foodborne outbreak of diarrhoea linked to a canteen in Italy caused by enteroinvasive Escherichia coli, an uncommon agent. Epidemiol. Infect. 2014, 142, 2559–2566. [Google Scholar] [CrossRef] [PubMed]
- Barcina, I.; Arana, I.; Iriberri, J.; Egea, L. Factors affecting the survival of E. coli in a river. Hydrobiologia 1986, 141, 249–253. [Google Scholar] [CrossRef]
- Pandey, P.K.; Kass, P.H.; Soupir, M.L.; Biswas, S.; Singh, V.P. Contamination of water resources by pathogenic bacteria. AMB Express 2014, 4, 51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bakhiet, S.; Ahmed, W.; Mohammed, W. Significance of Fungal Species Isolated from Blue Nile River and Tuti Island on Drinking Water Quality Significance of Fungal Species Isolated from Blue Nile River and Tuti Island on Drinking Water Quality. J. Appl. Life Sci. Int. 2016. [Google Scholar] [CrossRef] [PubMed]
- Olorode, O.A.; Bamigbola, E.A.; Ogba, O.M. Comparative Studies of some River Waters in Port Harcourt based on Their Physico-Chemical and Microbiological analysis, Niger Delta Region of Nigeria. Int. J. Basic Appl. Sci. 2015, 3, 29–37. [Google Scholar]
- Cook, W.L.; Schlitzer, R.L. Isolation of Candida albicans from freshwater and sewage. Appl. Environ. Microbiol. 1981, 41, 840–842. [Google Scholar] [CrossRef] [Green Version]
- Medeiros, A.O.; Missagia, B.S.; Brandão, L.R.; Callisto, M.; Barbosa, F.A.R.; Rosa, C.A. Water quality and diversity of yeasts from tropical lakes and rivers from the Rio Doce basin in Southeastern Brazil. Braz. J. Microbiol. 2012, 43, 1582–1594. [Google Scholar] [CrossRef] [Green Version]
- Huck, P.; Emelko, M.; Coffe, B.; Maurizio, D.; Omelia, C. Filter Operation Effects on Pathogen Passage; FAO: Rome, Italy, 2001. [Google Scholar]
- Meybeck, M.; Helmer, R. The quality of rivers: From pristine stage to global pollution. Palaeogeogr. Palaeoclim. Palaeoecol. 1989, 75, 283–309. [Google Scholar] [CrossRef]
- Minnesota Pollution Control Agency. Low Dissolved Oxygen in Water—Causes, Impact on Aquatic Life—An Overview; Minnesota Pollution Control Agency: Duluth, MN, USA, 2009. [Google Scholar]
- Hem, I.D. Study and Interpretation the Chemical of Natural of Characteristics Water; USGS: Reston, VA, USA, 1985. [Google Scholar]
- Quishpe Ballagán, Á.M. Tratamiento de Efluentes Líquidos de la Industria de Curtido, Mediante Precipitación Química, Adsorción con Carbón Activado y Rizofiltración. Esc. Politécnica Nac. 2010, 145. [Google Scholar] [CrossRef] [Green Version]
- Medina, M.; Pozo, P. Determinación de Cromo Hexavalente en Descargas de Aguas Residuales De Una Curtiembre, Ubicada En El Sector De Izamba, Ambato En La Provincia De Tungurahua. InfoAnálitica 2016, 1, 83–101. [Google Scholar]
- Roberts, T.L. Cadmium and phosphorous fertilizers: The issues and the science. Procedia Eng. 2014, 83, 52–59. [Google Scholar] [CrossRef] [Green Version]
- Tarras-Walhberg, N.H.; Flachier, A.; Lane, S.; Sangfors, O. Environmental impacts and metal exposure of aquatic ecosystems in rivers contaminated by small scale gold mining: The Puyango River basin, southern Ecuador. Sci. Total Environ. 2001, 278, 239–261. [Google Scholar] [CrossRef]
- Betancourt, Ó.; Tapia, M.; Méndez, I. Decline of General Intelligence in Children Exposed to Manganese from Mining Contamination in Puyango River Basin, Southern Ecuador. Ecohealth 2015, 12, 453–460. [Google Scholar] [CrossRef]
- González-Merizalde, M.V.; Menezes-Filho, J.A.; Cruz-Erazo, C.T.; Bermeo-Flores, S.A.; Sánchez-Castillo, M.O.; Hernández-Bonilla, D.; Mora, A. Manganese and Mercury Levels in Water, Sediments, and Children Living Near Gold-Mining Areas of the Nangaritza River Basin, Ecuadorian Amazon. Arch. Environ. Contam. Toxicol. 2016, 71, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Guibaud, G.; Gauthier, C. Study of aluminium concentration and speciation of surface water in four catchments in the Limousin region (France). J. Inorg. Biochem. 2003, 97, 16–25. [Google Scholar] [CrossRef]
- Gurmendi, A.; Szczesniak, P.; Torres, I.; Velasco, P.; Wilburn, D. The Mineral Industries of Latin America and Canada. U.S. Geol. Surv. Min. Yearb. 2003, 85, 1140–1146. [Google Scholar]
- Cisneros, E.; Machuca, R. Estructuración De Un Modelo De Encadenamiento Productivo Para La Producción Y Comercialización De Los Productos Derivados De La Leche En La Provincia De Pichincha, Cantón Mejía. Bachelor’s Thesis, Salesian Polytechnic University, Quito, Ecuador, 2014. [Google Scholar]
Organism | Primer Name | Primer Sequence (5′–3′) | PCR Cycling Parameters | Gene (Size [bp]) | References |
---|---|---|---|---|---|
Universal | Forward: fDD2 | CCGGATCCGTCGACAGAGTTTGATCITGGCTCAG | 3 min at 94 °C; 30 cycles of 94 °C for 30 s, 53 °C for 30 s, 72 °C for 1.5 min | 16S rRNA (1600) | [25,26] |
Reverse: rPP2 | CCAAGCTTCTAGACGGITACCTTGTTACGACTT | ||||
Shigella spp. | Forward: IpaH-F | CCTTGACCGCCTTTCCGATA | 2 min at 95 °C; 35 cycles of 94 °C for 1 min, 62 °C for 1 min, 72 °C for 2.5 min, 72 °C for 3 min | Invasion plasmid antigen H (606) | [25,26] |
Reverse: IpaH-R | CAGCCACCCTCTGAGGTACT | ||||
Legionella spp. | Forward: JFP | AGGGTTGATAGGTTAAGAGC | 5 min at 95 °C; 40 cycles of 94 °C for 1 min, 57 °C for 1.5 min, 72 °C for 1 min, 72 °C for 5 min. | Attachment invasion locus gene (386) | [25,26] |
Reverse: JRP | CCAACAGCTAGTTGACATCG | ||||
Salmonella spp. | Forward: IpaB-F | GGACTTTTTAAAAGCGGCGG | 2 min at 95 °C; 35 cycles of 94 °C for 1 min, 62 °C for 1 min, 72 °C for 2.5 min, 72 °C for 5 min. | Invasion plasmid antigen B (314) | [25,26] |
Reverse: IpaB-R | GCCTCTCCCAGAGCCGTCTGG | ||||
Pseudomonas spp. | Forward: PA-GS-F | GACGGGTGAGTAATGCCTA | 2 min at 95 °C; 35 cycles of 94 °C for 20 s, 54 °C for 20 s, 72 °C for 40 s, 72 °C for 5 min | 16S rRNA (618) | [25,26] |
Reverse: PA-GS-R | CACTGGTGTTCCTTCCTATA | ||||
Candida albicans | Forward: CALB1 | TTTATCAACTTGTCACACCAGA | 5 min at 95 °C; 35 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, 72 °C for 10 min. | ITS-1, ITS-2 (278) | [34] |
Reverse: CALB2 | ATCCCGCCTTACCACTACCG |
Organism | Primer Name | Primer Sequence (5′–3′) | PCR Cycling Parameters | Gene (Size [bp]) | References |
---|---|---|---|---|---|
Cryptosporidium spp. | Forward: Cry 15 | GTAGATAATGGAAGAGATTGTG | 10 min at 95 °C; 45 cycles of 94 °C for 30 s, 52 °C for 30 s, 72 °C for 50 s. | COWP (550) | [35,36] |
Reverse: Cry 9 | GGACTGAAATACAGGCATTATCTT | ||||
Forward: Cowpnest F | TGTGTTCAATCAGACACAGC | 10 min at 95 °C; 32 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 50 s. | COWP (311) | ||
Reverse: Cowpnest R | TCTGTATATCCTGGTGGG | ||||
Giardia spp. | Forward: AL3543 | AAATTATGCCTGCTCGTCG | 5 min at 94 °C; 35 cycles of 94 °C for 45 s, 50 °C for 45 s, 72 °C for 1 min. | TPI (605) | [35] |
Reverse: AL3546 | CAAACCTTTTCCGCAAACC | ||||
Forward: AL3544 | CCCTTCATCGGTGGTAACTT | 5 min at 94 °C; 35 cycles of 94 °C for 45 s, 55 °C for 30 s, 72 °C for 1 min. | TPI (530) | ||
Reverse: AL3545 | GTGGCCACCACTCCCGTGCC |
Organism. | Primer Name | Primer Sequence (5′–3′) | PCR Cycling Parameters | Gene (Size [bp]) |
---|---|---|---|---|
EAEC | Forward: AggRKs1 | GTATACACAAAAGAAGGAAGC | Stage 1, initial denaturing at 95 °C for 2 min; stage 2, denaturing at 95 °C for 1 min, primer annealing at 54 °C for 1 min, and elongation at 72 °C for 1 min; for 30 cycles, and stage 3, final elongation step at 72 °C for 10 min. | aggR (254) |
Reverse: AggRkas2 | ACAGAATCGTCAGCATCAGC | |||
EHEC | Forward: VTcomU | GAGCGAAATAATTTATATGTG | stx (518) | |
Reverse: VTcomd | TGATGATGGCAATTCAGTAT | |||
EPEC | Forward: SK1 | CCCGAATTCGGCACAAGCATAAGC | eae (881) | |
Reverse: SK2 | CCCGGATCCGTCTCGCCAGTATTCG | |||
EIEC | Forward: IpaIII | GTTCCTTGACCGCCTTTCCGATACCGTC | ipaH (619) | |
Reverse: IpaIV | GCCGGTCAGCCACCCTCTGAGAGTAC |
River | Escherichia Coli (CFU/ml ± SD) 1.26 CFU Per ml a | Total Coliforms (CFU/ml ± SD) 2.00 CFU Per ml b |
---|---|---|
Machángara | 2.25 × 102 ± 17.67 | 3.25 × 102 ± 35.35 |
Guayllabamba | 1.25 × 102 ± 35.35 | 3.13 × 102 ± 88.38 |
SAN Pedro | 9.60 × 101 ± 5.89 | 2.25 × 102 ± 23.57 |
Pita | 1.00 × 102 ± 82.49 | 3.50 × 102 ± 29.46 |
Monjas | 9.18 × 102 ± 417.40 | 5.15 × 103 ± 2474.87 |
Blanco | 1.83 × 100 ± 0.00 | 4.25 × 100 ± 2.23 |
Mindo | 1.72 × 101 ± 22.8 | 6.78 × 101 ± 92.50 |
Cinto | 2.98 × 101 ± 40.42 | 7.30 × 101 ± 97.10 |
Pisque | 1.71 × 101 ± 1.77 | 4.00 × 101 ± 1.18 |
Chiche | 1.25 × 102 ± 70.71 | 3.68 × 102 ± 70.71 |
Pilatón | 1.79 × 100 ± 0.29 | 4.88 × 100 ± 0.17 |
Pachijal | 7.75 × 100 ± 9.07 | 2.32 × 101 ± 27.28 |
Alambi | 7.08 × 100 ± 1.76 | 2.58 × 101 ± 2.35 |
Caoní | 1.17 × 100 ± 0.23 | 3.95 × 100 ± 2.29 |
Mashpi | 2.58 × 101 ± 34.35 | 7.35 × 101 ± 96.52 |
Guachalá | 1.29 × 102 ± 76.60 | 2.98 × 102 ± 64.81 |
Granobles | 1.67 × 101 ± 2.36 | 2.46 × 101 ± 1.77 |
Pedregales | 1.17 × 101 ± 0.00 | 2.29 × 101 ± 4.12 |
River MCL | pH 6.5–9 a | Conductivity (μS/cm) N/A | DO (mg/L) N/A | Turbidity (NTU) N/A | ORP (mV) N/A | T (°C) N/A | CODTotal (mg/L) 40 a | TS (mg/L) 1600 b | TSS (mg/L) 130 b | Cl− (mg/L) 1000 b | NH4+N (mg/L) N/A | NO3−N (mg/L) 13 a | PO43−P (mg/L) 10 b | SO4− (mg/L) 1000 b | Fluoride (mg/L) 1.0 b |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Machángara | 9.11 * ± 0.03 | 297.97 ± 1.38 | 6.77 ± 0.24 | 881.33 ± 12.66 | 362.70 ± 3.61 | 15.20 ± 0.30 | 692.00 * ± 6.13 | 1359.00 ± 4.24 | 520.00 * ± 18.86 | 37.27 ± 1.04 | 20.36 ± 0.87 | 6.40 ± 0.07 | 0.17 ± 0.01 | 29.00 ± 0.00 | 0.14 ± 0.00 |
Guayllabamba | 7.90 ± 0.03 | 365.00 ± 5.81 | 7.42 ± 0.23 | 56.50 ± 0.66 | 402.23 ± 0.15 | 18.20 ± 0.00 | 33.00 2.27 | 397.00 ± 7.07 | 90.00 ± 9.43 | 26.51 ± 2.01 | 2.54 ± 0.29 | 5.13 ± 0.03 | 1.17 ± 0.01 | 11.50 ± 0.50 | 0.03 ± 0.00 |
San Pedro | 8.00 ± 0.01 | 529.77 ± 0.06 | 8.23 ± 0.20 | 22.17 ± 3.30 | 297.13 ± 3.45 | 13.43 ± 0.06 | 20.00 ± 2.36 | 470.00 ± 14.14 | 52.00 8.49 | 23.78 ± 0.54 | 7.16 ± 0.18 | 6.95 ± 0.00 | 1.19 ± 0.14 | 65.85 ± 6.59 | 0.17 ± 0.00 |
Pita | 8.41 ± 0.01 | 221.80 ± 0.00 | 8.10 ± 0.05 | 10.73 ± 0.76 | 346.70 ± 1.55 | 13.80 ± 0.10 | 8.00 ± 4.71 | 280.00 ± 14.14 | 45.00 ± 28.28 | 4.45 ± 0.51 | 0.23 ± 0.05 | 1.93 ± 0.00 | 0.50 ± 0.19 | 71.62 ± 4.12 | 0.13 ± 0.00 |
Monjas | 8.04 ± 0.05 | 616.00 ± 0.10 | 5.36 ± 0.03 | 136.00 ± 15.10 | 323.17 ± 0.55 | 19.60 ± 0.10 | 318.00 * ± 0.00 | 632.50 ± 10.61 | 153.50 * ± 4.95 | 40.32 ± 1.44 | 27.48 ± 1.47 | 3.43 ± 0.00 | 3.93 ± 0.56 | 103.72 ± 9.88 | 0.15 ± 0.00 |
Blanco | 7.32 ± 0.09 | 53.53 ± 0.08 | 8.76 ± 0.22 | 1.23 ± 0.03 | 310.00 ± 10.41 | 20.97 ± 0.06 | 20.00 ± 2.12 | 470.00 ± 14.14 | 6.67 ± 4.71 | 1.11 ± 0.23 | 4.19 ± 1.54 | 0.63 ± 0.03 | 0.05 ± 0.01 | 3.50 ± 0.50 | 0.04 ± 0.00 |
Mindo | 8.37 ± 0.16 | 139.67 ± 0.15 | 8.27 ± 0.26 | 1.76 ± 0.11 | 323.70 ± 0.53 | 17.87 ± 0.15 | 2.00 ± 2.12 | 280.00 ± 14.14 | 8.33 ± 2.36 | 9.31 ± 0.04 | 0.19 ± 0.01 | 0.70 ± 0.00 | 0.11 ± 0.01 | 6.00 ± 0.00 | 0.04 ± 0.00 |
Cinto | 7.20 ± 0.01 | 232.93 ± 0.64 | 8.06 ± 0.18 | 5.34 ± 0.15 | 306.00 ± 0.95 | 20.37 ± 0.29 | 2.00 ± 2.12 | 632.00 ± 10.61 | 6.67 ± 0.00 | 21.39 ± 0.07 | 0.39 ± 0.01 | 0.57 ± 0.00 | 0.05 ± 0.01 | 29.00 ± 0.00 | 0.05 ± 0.01 |
Pisque | 9.55 * ± 0.17 | 273.43 ± 0.40 | 8.02 ± 0.08 | 306.67 ± 4.62 | 408.20 ± 2.18 | 16.63 ± 0.12 | 180.00 * ± 1.53 | 806.00 ± 28.28 | 236.67 * ± 33.00 | 14.04 ± 0.73 | 0.27 ± 0.02 | 10.98 ± 0.09 | 0.11 ± 0.00 | 6.00 ± 0.00 | 0.14 ± 0.01 |
Chiche | 7.15 ± 0.01 | 44.80 ± 0.02 | 10.32 ± 0.31 | 5.89 ± 0.21 | 412.23 ± 11.52 | 21.40 ± 0.00 | 206.00 * ± 4.59 | 597.00 ± 24.04 | 300.00 * ± 0.00 | 28.17 ± 1.37 | 1.01 ± 0.01 | 6.31 ± 0.09 | 0.18 ± 0.01 | 3.50 ± 0.50 | 0.15 ± 0.00 |
Pilatón | 8.15 ± 0.01 | 101.67 ± 0.12 | 8.77 ± 0.20 | 56.10 ± 3.12 | 372.23 ± 1.31 | 17.23 ± 0.06 | 2.16 ± 2.12 | 182.00 ± 14.14 | 54.00 ± 14.14 | 3.93 ± 0.00 | 0.22 ± 0.01 | 0.95 ± 0.03 | 0.12 ± 0.01 | 11.00 ± 0.00 | 0.05 ± 0.00 |
Pachijal | 7.15 ± 0.01 | 44.80 ± 0.02 | 10.32 ± 0.31 | 5.89 ± 0.21 | 412.23 ± 11.52 | 21.40 ± 0.00 | 2.00 ± 0.00 | 61.00 ± 9.90 | 3.33 ± 0.00 | 1.24 ± 0.03 | 0.22 ± 0.02 | 0.86 ± 0.03 | 0.11 ± 0.01 | 2.00 ± 0.00 | 0.03 ± 0.00 |
Alambi | 8.15 ± 0.14 | 72.07 ± 0.12 | 8.92 ± 0.17 | 251.33 ± 11.50 | 489.53 ± 1.12 | 18.50 ± 0.00 | 65.00 * ± 2.27 | 521.00 ± 1.41 | 366.67 * ± 0.00 | 3.42 ± 0.15 | 0.24 ± 0.05 | 1.25 ± 0.03 | 0.21 ± 0.02 | 3.00 ± 0.00 | 0.04 ± 0.00 |
Caoní | 7.33 ± 0.15 | 19.87 ± 0.04 | 9.35 ± 0.33 | 25.93 ± 1.99 | 397.07 ± 9.02 | 22.30 ± 0.00 | 7.00 ± 2.27 | 45.00 ± 7.07 | 20.00 ± 7.07 | 2.31 ± 0.00 | 0.21 ± 0.04 | 11.66 ± 0.06 | 0.09 ± 0.02 | 3.50 ± 0.50 | 0.05 ± 0.00 |
Mashpi | 8.15 ± 0.01 | 33.72 ± 0.12 | 9.87 ± 0.50 | 11.07 ± 1.01 | 435.40 ± 3.65 | N/A | 9.00 ± 0.00 | 36.00 ± 11.31 | 8.33 ± 7.07 | 1.06 ± 0.04 | 0.22 ± 0.03 | 1.19 ± 0.00 | 0.06 ± 0.00 | 4.00 ± 0.00 | 0.03 ± 0.00 |
Guachalá | 8.11 ± 0.02 | 147.00 ± 0.69 | 7.78 ± 0.62 | 7.60 ± 0.27 | 381.40 ± 0.00 | 12.40 ± 0.00 | 2.00 ± 0.00 | 407.50 ± 10.61 | 21.67 ± 2.36 | 2.53 ± 0.03 | 0.29 ± 0.02 | 2.60 ± 0.00 | 0.27 ± 0.01 | 14.00 ± 0.00 | 0.07 ± 0.00 |
Granobles | 7.78 ± 0.00 | 159.00 ± 0.15 | 6.91 ± 0.07 | 16.70 ± 0.46 | 424.23 ± 0.93 | 13.80 ± 0.00 | 13.00 ± 2.27 | 182.50 ± 10.61 | 28.33 ± 2.36 | 4.69 ± 0.37 | 0.29 ± 0.01 | 4.97 ± 0.06 | 0.59 ± 0.01 | 6.50 ± 0.50 | 0.04 ± 0.00 |
Pedregales | 7.67 ± 0.26 | 194.00 ± 0.61 | 6.72 ± 0.08 | 11.60 ± 0.26 | 328.83 ± 0.64 | 13.53 ± 0.23 | 2.00 ± 0.00 | 222.00 ± 5.66 | 18.33 ± 2.36 | 13.26 ± 0.64 | 0.13 ± 0.00 | 1.56 ± 0.09 | 0.30 ± 0.01 | 6.00 ± 0.00 | 0.06 ± 0.00 |
River | Trace Elements | Major Elements | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MCL | Copper (µg/L) 5 a | Lead (µg/L) 1 a | Chromium (µg/L) 32 a | Manganese (µg/L) 100 a | Barium (µg/L) 1000 a | Cadmium (µg/L) 1 ª | Nickel (µg/L) 25 a | Vanadium (µg/L) 100 b | Zinc (µg/L) 30 a | Aluminium (mg/L) 0.1 a | Iron (mg/L) 0.3 a | Calcium (mg/L) N/A | Sodium (mg/L) N/A | Magnesium (mg/L) N/A |
Machángara | 38.95 * ± 0.00 | 59.7 ± 0.00 | 58.03 ± 0.00 | 165.52 ± 0.00 | 541.88 ± 0.00 | 4.17 * ± 0.22 | 54.92 * ± 0.00 | 50.76 ± 0.00 | 437.37 * ± 0.00 | 18.05 * ± 0.00 | 5.39 * ± 0.00 | 21.2 ± 1.65 | 31.76 ± 1.03 | 6.05 ± 0.07 |
Guayllabamba | 10.17 * ± 0.00 | <LQ | 2.86 ± 0.00 | 75.50 ± 0.00 | 340.90 ± 0.00 | <LQ | 17.92 ± 0.00 | 28.49 ± 0.00 | 104.84 * ± 0.00 | 0.49 * ± 0.00 | 0.46 * ± 0.00 | 17.86 ± 2.13 | 30.71 ± 1.43 | 13.33 ± 0.43 |
San Pedro | 8.57 * ± 0.00 | <LQ | 1.64 ± 0.00 | 48.95 ± 0.00 | 773.21 ± 0.00 | <LQ | <LQ | 56.89 ± 0.00 | 53.44 * ± 0.00 | 0.03 ± 0.00 | 0.28 ± 0.00 | 29.32 ± 2.79 | 73.15 ± 1.26 | 34.21 ± 2.87 |
Pita | <LQ | <LQ | <LQ | 44.02 ± 0.00 | 38.45 ± 0.00 | <LQ | <LQ | 21.80 ± 0.00 | 5.22 ± 0.00 | 0.16 * ± 0.00 | 0.31 * ± 0.00 | 16.07 ± 1.52 | 17.73 ± 0.55 | 10.73 ± 0.43 |
Monjas | 10.65 * ± 0.00 | <LQ | 2.27 ± 0.00 | 208.13 ± 0.00 | 256.91 ± 0.00 | <LQ | 3.77 ± 0.00 | 17.80 ± 0.00 | 149.67 * ± 0.00 | 0.18 * ± 0.00 | 0.26 ± 0.00 | 24.09 ± 2.97 | 58.19 ± 1.90 | 9.28 ± 0.63 |
Blanco | 15.23 * ± 0.00 | <LQ | 35.18 ± 0.00 | 10.13 ± 0.00 | 477.14 ± 0.00 | <LQ | 36.86 * ± 0.00 | 18.51 ± 0.00 | 181.80 * ± 0.00 | 5.07 * ± 0.00 | 0.84 * ± 0.00 | 7.92 ± 0.34 | 8.46 ± 0.99 | 2.72 ± 0.27 |
Mindo | 15.68 * ± 0.00 | <LQ | 36.26 ± 0.00 | 13.86 ± 0.00 | 440.11 ± 0.00 | <LQ | 37.31 * ± 0.00 | 26.23 ± 0.00 | 76.77 * ± 0.00 | 17.66 * ± 0.00 | 0.43 * ± 0.00 | 15.96 ± 0.94 | 12.01 ± 0.40 | 4.91 ± 0.09 |
Cinto | 10.76 * ± 0.00 | <LQ | 36.25 ± 0.00 | 69.92 ± 0.00 | 427.05 ± 0.00 | <LQ | 35.33 * ± 0.00 | 27.15 ± 0.00 | 68.75 * ± 0.00 | 17.30 * ± 0.00 | 0.57 * ± 0.00 | 17.74 ± 1.75 | 16.76 ± 0.78 | 9.00 ± 0.53 |
Pisque | 23.11 * ± 0.00 | <LQ | 41.58 ± 0.00 | 27.89 ± 0.00 | 389.50 ± 0.00 | <LQ | 42.78 * ± 0.00 | 47.23 ± 0.00 | 83.62 * ± 0.00 | 17.53 * ± 0.00 | 2.37 * ± 0.00 | 46.16 ± 3.71 | 28.62 ± 1.92 | 12.39 ± 0.78 |
Chiche | 18.07 * ± 0.00 | <LQ | 41.78 ± 0.00 | 30.13 ± 0.00 | 388.95 ± 0.00 | <LQ | 37.09 * ± 0.00 | 46.02 ± 0.00 | 87.70 * ± 0.00 | 18.08 * ± 0.00 | 3.95 * ± 0.00 | 12.71 ± 1.94 | 20.15 ± 0.74 | 7.08 ± 0.84 |
Pilatón | 14.88 * ± 0.00 | <LQ | 42.83 ± 0.00 | 23.31 ± 0.00 | 308.75 ± 0.00 | 2.31 * ± 0.01 | 39.96 * ± 0.00 | 26.02 ± 0.00 | 101.74 * ± 0.00 | 13.12 * ± 0.00 | 0.59 * ± 0.00 | 11.67 ± 1.73 | 8.78 ± 0.76 | 4.42 ± 0.49 |
Pachijal | 7.89 * ± 0.00 | <LQ | 2.03 ± 0.00 | 1.72 ± 0.00 | 229.62 ± 0.00 | <LQ | <LQ | 2.43 ± 0.00 | 76.32 * ± 0.00 | <LOQ | 0.04 ± 0.00 | 5.82 ± 0.01 | 4.82 ± 0.06 | 3.28 ± 0.22 |
Alambi | 8.82 * ± 0.00 | 88.9 ± 0.00 | 3.01 ± 0.00 | 41.32 ± 0.00 | 348.04 ± 0.00 | 1.02 ± 0.00 | 3.15 ± 0.00 | 9.16 ± 0.00 | 103.90 * ± 0.00 | 2.06 * ± 0.00 | 1.15 * ± 0.00 | 10.98 ± 0.00 | 8.90 ± 1.32 | 4.40 ± 0.19 |
Caoní | 5.39 * ± 0.00 | <LQ | 2.07 ± 0.00 | 1.13 ± 0.00 | 253.81 ± 0.00 | <LQ | 35.33 * ± 0.00 | <LQ | 58.55 * ± 0.00 | 0.08 ± 0.00 | 0.11 ± 0.00 | 3.70 ± 0.08 | 4.59 ± 0.21 | 2.37 ± 0.08 |
Mashpi | <LQ | <LQ | 1.84 ± 0.00 | 4.11 ± 0.00 | 82.75 ± 0.00 | <LQ | <LQ | <LQ | 75.86 * ± 0.00 | <LQ | 0.02 ± 0.00 | 5.82 ± 0.08 | 4.99 ± 0.16 | 3.22 ± 0.01 |
Guachalá | 12.28 * ± 0.00 | 12.4 ± 0.00 | 42.63 ± 0.00 | 22.26 ± 0.00 | 248.71 ± 0.00 | 1.16 * ± 0.03 | 89.94 * ± 0.00 | 28.48 ± 0.00 | 98.91 * ± 0.00 | 18.25 * ± 0.00 | 0.88 * ± 0.00 | 15.23 ± 2.03 | 14.57 ± 0.94 | 6.66 ± 0.86 |
Granobles | 17.61 * ± 0.00 | <LQ | 44.60 ± 0.00 | 54.99 ± 0.00 | 389.02 ± 0.00 | <LQ | 41.37 * ± 0.00 | 33.65 ± 0.00 | 146.93 * ± 0.00 | 18.12 * ± 0.00 | 0.93 * ± 0.00 | 13.77 ± 0.81 | 14.61 ± 0.42 | 6.63 ± 0.54 |
Pedregales | 11.53 * ± 0.00 | 86.0 ± 0.00 | 4.49 ± 0.00 | 140 * ± 0.00 | 333.81 ± 0.00 | 1.49 * ± 0.17 | 100.11 * ± 0.00 | 24.50 ± 0.00 | 3711.6 * ± 168.48 | 0.39 * ± 0.00 | 0.87 * ± 0.00 | 170.26 ± 2.51 | 17.81 ± 1.02 | 10.62 ± 0.35 |
Parameters | E. coli (CFU/mL) | Total Coliforms (CFU/mL) | Correlation Category (for E. coli/Total Coliforms) |
---|---|---|---|
Conductivity (µS/cm) | 0.702 | 0.649 | High/Moderate |
DO (mg/L) | −0.599 | −0.555 | Negligible/Negligible |
CODTotal (mg/L) | 0.506 | 0.376 | Moderate/Low |
Cl− (mg/L) | 0.674 | 0.578 | Moderate/Moderate |
NH4+N (mg/L) | 0.870 | 0.801 | High/High |
PO43−P (mg/L) | 0.924 | 0.938 | Very high/Very high |
SO42− (mg/L) | 0.770 | 0.726 | High/High |
Manganese (mg/L) | 0.742 | 0.675 | High/Moderate |
Fluoride (mg/L) | 0.499 | 0.402 | Low/Low |
Sodium (mg/L) | 0.607 | 0.547 | Moderate/Moderate |
N° | Country | Study Group (n) | Counting | Physico-Chemical Parameters | Major and Trace Elements | References | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
E. coli (CFU/mL) | Total Coliforms (CFU/mL) | pH | DO (mg/L) | CODT (mg/L) | TSS (mg/L) | Iron (mg/L) | Aluminum (mg/L) | Zinc (μg/L) | Copper (μg/L) | Sodium (mg/L) | Magnesium (mg/L) | ||||
1 | Ecuador | 18 | 1.17– 9.18 × 102 | 3.95– 5.15 × 103 | 7.15–9.55 | 5.36– 10.32 | 2.0–692.0 | 3.33– 520.00 | 0.21– 13.88 | 0.03– 18.05 | 5.22– 3712 | 5.39– 38.95 | 4.59– 58.19 | 2.37– 32.21 | This study |
2 | Brazil * | 1 | 4.20– 2.40 × 102 | 4.60 × 10– 2.40 × 102 | 5.48–7.30 | 0.90– 7.80 | <10.0– 9324.0 | 56.00– 608.00 | 0.03– 24.09 | 0.10– 0.37 | 30.00– 3880 | NA | NA | NA | [44] |
3 | Chile * | 2 | 2.00 × 10−2– 7.90 | 1.70– 5.40 × 10 | 7.00–8.50 | 8.0–12.70 | 2.0– 406.0 | 10.87– 260.00 | 0.21– 0.56 | 0.002– 0.06 | 20.00– 140.00 | 170.00– 630.00 | 1.60– 8.43 | 0.95– 1.69 | [45] |
4 | Mexico * | 1 | 2.20 × 10– 3.08 × 105 | NA | 7.00–8.00 | 1.70– 8.60 | 22.0– 1841.0 | 8.00– 343.00 | 0.51– 0.53 | <5.0 | <100.00 | <50.00 | NA | NA | [63] |
5 | USA | 1 | 5.00 × 10−2– 3.00 | NA | 6.89–8.10 | NA | NA | 13.13– 139.42 | 0.04– 1.59 | 0.08– 1.18 | 20.00– 210.00 | 10.00– 570.00 | 1.63– 21.39 | 3.63– 55.54 | [6] |
6 | Canada | 3 | NA | 3.70 × 10– 7.40 × 102 | 3.20–9.00 | 9.20– 14.70 | NA | NA | 0.01– 4.20 | 0.00– 21.00 | 0.00– 1000.00 | 1.00– 110.00 | 0.30– 17.30 | NA | [46] |
7 | Poland | 5 | 1.58– 1.18 × 102 | 3.80– 2.98 × 102 | 7.40–7.70 | NA | NA | 223.00– 518.00 | 0.08– 4.40 | NA | NA | NA | 4.00– 33.50 | 0.80– 5.40 | [47] |
8 | Italy | 4 | 3.00 × 10−2– 4.10 × 102 | 0– 1.30 × 102 | 6.90–8.80 | 1.70– 18.40 | 4.0– 87.0 | 4.00– 64632.00 | 0.001– 0.053 | 0.0003– 0.28 | 0.10– 441.00 | 1.00– 16.30 | NA | NA | [48] |
9 | Croatia * | 3 | 1.00 × 10−1– 2.97 × 102 | 1.01 × 10– 6.67 × 103 | 7.82–8.24 | NA | NA | NA | 0.02– 0.52 | 0.01– 0.07 | NA | 0.10– 1.27 | 2.12– 88.30 | 9.30– 27.10 | [49] |
10 | India | 2 | 3.16 × 102– 7.94 × 102 | 6.30 × 102– 6.31 × 106 | 7.10–8.00 | NA | NA | 172.00– 1820.00 | 0.25– 0.53 | 0.00– 0.27 | 48.60– 102.00 | 0.00– 406.6 | 18.00– 406.00 | 8.00– 55.00 | [64] |
11 | Bangladesh | 1 | NA | NA | 7.24–7.61 | 1.22– 3.66 | NA | 239.00– 1349.00 | 1.40– 3.29 | NA | 80.00– 190.00 | 50.00– 100.00 | NA | NA | [65] |
12 | Malaysia | 1 | 4.33– 2.73 × 103 | NA | 5.23–8.41 | 4.13– 7.44 | 8.6– 63.0 | 17.66– 80.00 | NA | NA | NA | NA | NA | NA | [66] |
13 | Nigeria | 1 | 2.50 × 10– 6.40 × 102 | NR– 1.60 × 102 | 6.84–7.20 | NA | NA | 8.63– 11.36 | 2.97– 4.80 | NA | NA | 6.00– 130.00 | 2.77– 4.10 | 6.06– 8.66 | [67] |
14 | Ghana | 1 | 3.36– 7.39 | 1.13 × 10– 1.88 × 10 | 7.20–7.48 | 6.60– 7. 16 | NA | 142.00– 225.00 | 0.61– 1.19 | NA | 14.00– 100.00 | 28.00– 274.00 | NA | NA | [68] |
15 | Egypt* | 1 | 3.79– 7.03 | 7.13– 1.42 × 10 | 7.60– 8.70 | NA | 4.9– 21.2 | NA | NA | NA | NA | NA | NA | 32.00– 56.00 | [69] |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Borja-Serrano, P.; Ochoa-Herrera, V.; Maurice, L.; Morales, G.; Quilumbaqui, C.; Tejera, E.; Machado, A. Determination of the Microbial and Chemical Loads in Rivers from the Quito Capital Province of Ecuador (Pichincha)—A Preliminary Analysis of Microbial and Chemical Quality of the Main Rivers. Int. J. Environ. Res. Public Health 2020, 17, 5048. https://doi.org/10.3390/ijerph17145048
Borja-Serrano P, Ochoa-Herrera V, Maurice L, Morales G, Quilumbaqui C, Tejera E, Machado A. Determination of the Microbial and Chemical Loads in Rivers from the Quito Capital Province of Ecuador (Pichincha)—A Preliminary Analysis of Microbial and Chemical Quality of the Main Rivers. International Journal of Environmental Research and Public Health. 2020; 17(14):5048. https://doi.org/10.3390/ijerph17145048
Chicago/Turabian StyleBorja-Serrano, Pamela, Valeria Ochoa-Herrera, Laurence Maurice, Gabriela Morales, Cristian Quilumbaqui, Eduardo Tejera, and António Machado. 2020. "Determination of the Microbial and Chemical Loads in Rivers from the Quito Capital Province of Ecuador (Pichincha)—A Preliminary Analysis of Microbial and Chemical Quality of the Main Rivers" International Journal of Environmental Research and Public Health 17, no. 14: 5048. https://doi.org/10.3390/ijerph17145048
APA StyleBorja-Serrano, P., Ochoa-Herrera, V., Maurice, L., Morales, G., Quilumbaqui, C., Tejera, E., & Machado, A. (2020). Determination of the Microbial and Chemical Loads in Rivers from the Quito Capital Province of Ecuador (Pichincha)—A Preliminary Analysis of Microbial and Chemical Quality of the Main Rivers. International Journal of Environmental Research and Public Health, 17(14), 5048. https://doi.org/10.3390/ijerph17145048