Presence of Roe Deer Affects the Occurrence of Anaplasma phagocytophilum Ecotypes in Questing Ixodes ricinus in Different Habitat Types of Central Europe
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Sites
- A1.
- The southern part of Englischer Garten is a city center park in Munich under strong anthropogenic influence, highly visited by citizens and dogs, maintained by gardening. Interaction between domestic and free-living animals is limited to mice, hedgehogs, foxes, and birds.
- A2.
- Nymphenburger Schlosspark is a city park in Munich, surrounded by walls. Several forest-like structures with higher tree density, scrub, and free-living animals such as roe deer are present in this park. Grassy areas are extensively used and less frequently mowed.
- A3.
- Dörnbergpark is situated in the city center of Regensburg. It is a small park, surrounded by walls, with strong anthropogenic influence, which is expressed by a high frequency of visitors spending their leisure time there. The site is a well-tended park with mostly grassy landscape and only a few old trees such as oaks and maples. Large free-living mammals like roe deer and wild boar are not present.
- A4.
- Schlosspark Berg is a forest-like park on the eastern shore of Lake Starnberg with scrub and walkways. Deciduous trees and bushes, large free-living mammals such as roe deer and foxes exist and hunting is practiced.
- A5.
- Kerschlach is an agricultural site formed by two fenced pastures, which are used for stock breeding of cattle, and is surrounded by a forest area. Contact between wild animals (also roe deer) and domestic cattle exists because animals from the forest can enter the pasture.
- A6.
- Tussenhausen (Angelberger Forst) is a large mixed forest with low anthropogenic influence. This forest is mainly dominated by beech, oak, and spruce. Different free-living animal species are present, and the frequency of visitors is low.
- B1.
- Valtice is an enclosed, fenced urban park in the castle grounds, where vegetation is periodically adjusted. The fauna is represented by birds, small mammals, and roe deer, the vegetation by broad-leaved deciduous trees and mown grass.
- B2.
- Pohansko is a natural floodplain forest. The fauna consists of birds, various small and large mammals such as roe, red and fallow deer, and wild boar, the vegetation of deciduous forests.
- B3.
- Suchovské mlýny is a pasture area; ticks were sampled along a sheep fence. The fauna is represented by birds, small mammals, and sheep, the vegetation by some trees and shrubs.
- B4.
- Proskovice is a natural ecosystem outside the town of Ostrava. This mixed forest with dominant broad-leaved trees is rarely visited by people. The fauna consists of small and medium-sized mammals, roe deer, birds, and occasionally wild boar.
- B5.
- Bělský les is an urban park in Ostrava. The local fauna is represented by birds and small mammals, and the vegetation by broad-leaved deciduous trees and grass. The park is surrounded by housing estates and used for leisure activities and dog-walking.
- C1.
- The campus of the Slovak Academy of Sciences (SAS) is an enclosed urban area, within the built-up plots there are patches of broad-leaved forest vegetation, shrubby plots, mown and unmown grassy plots. The fauna consists mainly of birds, feral cats, hedgehogs, and roe deer. The density of rodents is very low.
- C2.
- Mokrohájska street is an urban area situated along fences of gardens and cottages in the vicinity of the SAS campus. The fauna is represented by birds, small mammals, and lizards.
- C3.
- Železná studienka is part of Bratislava Forest Park, located on the foothills of the Small Carpathians Mountains in the northern part of Bratislava. The vegetation is represented by broad-leaved trees, the fauna by birds, small and medium-sized mammals, deer, and wild boar. Železná studienka serves for relaxation of inhabitants of Bratislava and dog walking.
- C4.
- Fúgelka is a natural forest site visited by tourists, rangers, and hunters. The vegetation is represented by a mixed forest, the fauna by various small, medium-sized, and large free-living mammals such as roe, red and fallow deer, mouflon, and wild boar.
2.2. Tick Sampling, DNA Extraction, and PCR Amplification
2.3. Sequence Analysis
2.4. Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Woldehiwet, Z. The natural history of Anaplasma phagocytophilum. Vet. Parasitol. 2010, 167, 108–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stuen, S.; Granquist, E.G.; Silaghi, C. Anaplasma phagocytophilum—A widespread multihost pathogen with highly adaptive strategies. Front. Cell. Infect. Microbiol. 2013, 3, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jahfari, S.; Coipan, C.; Fonville, M.; van Leeuwen, A.D.; Hengeveld, P.; Heylen, D.; Heyman, P.; van Maanen, C.; Butler, C.M.; Földvári, G.; et al. Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasit. Vectors 2014, 7, 365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dugat, T.; Lagrée, A.-C.; Maillard, R.; Boulouis, H.-J.; Haddad, N. Opening the black box of Anaplasma phagocytophilum diversity: Current situation and future perspectives. Front. Cell. Infect. Microbiol. 2015, 5, 61. [Google Scholar] [CrossRef] [Scilit]
- Jaarsma, R.I.; Sprong, H.; Takumi, K.; Kazimirova, M.; Silaghi, C.; Mysterud, A.; Rudolf, I.; Beck, R.; Földvári, G.; Tomassone, L.; et al. Anaplasma phagocytophilum evolves in geographical and biotic niches of vertebrates and ticks. Parasit. Vectors 2019, 12, 328. [Google Scholar] [CrossRef] [Scilit]
- Stuen, S. Anaplasma phagocytophilum - the most widespread tick-borne infection in animals in Europe. Vet. Res. Commun. 2007, 31 (Suppl. 1), 79–84. [Google Scholar] [CrossRef] [Scilit]
- Stuen, S.; Pettersen, K.S.; Granquist, E.G.; Bergström, K.; Bown, K.J.; Birtles, R.J. Anaplasma phagocytophilum variants in sympatric red deer (Cervus elaphus) and sheep in southern Norway. Ticks Tick Borne Dis. 2013, 4, 197–201. [Google Scholar] [CrossRef] [Scilit]
- Víchová, B.; Majláthová, V.; Nováková, M.; Stanko, M.; Hviščová, I.; Pangrácová, L.; Chrudimský, T.; Čurlík, J.; Peťko, B. Anaplasma infections in ticks and reservoir host in Slovakia. Infect. Genet. Evol. 2014, 22, 265–272. [Google Scholar] [CrossRef] [Scilit]
- Baráková, I.; Derdáková, M.; Carpi, G.; Rosso, F.; Collini, M.; Tagliapietra, V.; Ramponi, C.; Hauffe, H.-C.; Rizzoli, A. Genetic and ecologic variability among Anaplasma phagocytophilum strains in Northern Italy. Emerg. Infect. Dis. 2014, 20, 1082–1084. [Google Scholar] [CrossRef] [Scilit]
- Battilani, M.; De Arcangeli, S.; Balboni, A.; Dondi, F. Genetic diversity and molecular epidemiology of Anaplasma. Infect. Genet. Evol. 2017, 49, 195–211. [Google Scholar] [CrossRef] [Scilit]
- Petrovec, M.; Bidovec, A.; Sumner, J.W.; Nicholson, W.L.; Childs, J.E.; Avsic-Zupanc, T. Infection with Anaplasma phagocytophila in cervids from Slovenia: Evidence of two genotypic lineages. Wien. Klin. Wochenschr. 2002, 114, 641–647. [Google Scholar] [PubMed]
- Huhn, C.; Winter, C.; Wolfsperger, T.; Wüppenhorst, N.; Strašek Smrdel, K.; Skuballa, J.; Pfäffle, M.; Petney, T.; Silaghi, C.; Dyachenko, V.; et al. Analysis of the population structure of Anaplasma phagocytophilum using multilocus sequence typing. PLoS ONE 2014, 9, e93725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dugat, T.; Chastagner, A.; Lagrée, A.-C.; Petit, E.; Durand, B.; Thierry, S.; Corbière, F.; Verheyden, H.; Chabanne, L.; Bailly, X.; et al. A new multiple-locus variable-number tandem repeat analysis reveals different clusters for Anaplasma phagocytophilum circulating in domestic and wild ruminants. Parasit. Vectors 2014, 7, 439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langenwalder, D.B.; Schmidt, S.; Gilli, U.; Pantche, N.; Ganter, M.; Silaghi, C.; Aardema, M.L.; von Loewenich, F.D. Genetic characterization of Anaplasma phagocytophilum strains from goats (Capra aegagrus hircus) and water buffalo (Bubalus bubalis) by 16S rRNA gene, ankA gene and multilocus sequence typing. Ticks Tick Borne Dis. 2019, 10, 101267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jouglin, M.; Chagneau, S.; Faille, F.; Verheyden, H.; Bastian, S.; Malandrin, L. Detecting and characterizing mixed infections with genetic variants of Anaplasma phagocytophilum in roe deer (Capreolus capreolus) by developing an ankA cluster-specific nested PCR. Parasit. Vectors 2017, 10, 377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strasek Smrdel, K.; Bidovec, A.; Malovrh, T.; Petrovec, M.; Duh, D.; Avsic Zupanc, T. Detection of Anaplasma phagocytophilum in wild boar in Slovenia. Clin. Microbiol. Infect. 2009, 15 (Suppl. 2), 50–52. [Google Scholar] [CrossRef] [Scilit]
- Michalik, J.; Stańczak, J.; Cieniuch, S.; Racewicz, M.; Sikora, B.; Dabert, M. Wild boars as hosts of human-pathogenic Anaplasma phagocytophilum variants. Emerg. Infect. Dis. 2012, 18, 2094–2095. [Google Scholar] [CrossRef] [Scilit]
- Santos, A.S.; de Bruin, A.; Veloso, A.R.; Marques, C.; da Fonseca, I.P.; de Sousa, R.; Sprong, H.; Santos-Silva, M.M. Detection of Anaplasma phagocytophilum, Candidatus Neoehrlichia sp., Coxiella burnetii and Rickettsia spp. in questing ticks from a recreational park, Portugal. Ticks Tick Borne Dis. 2018, 9, 1555–1564. [Google Scholar] [CrossRef] [Scilit]
- Silaghi, C.; Woll, D.; Hamel, D.; Pfister, K.; Mahling, M.; Pfeffer, M. Babesia spp. and Anaplasma phagocytophilum in questing ticks, ticks parasitizing rodents and the parasitized rodents – Analyzing the host pathogen-vector interface in a metropolitan area. Parasit. Vectors 2012, 5, 191. [Google Scholar] [CrossRef] [Scilit]
- Overzier, E.; Pfister, K.; Thiel, C.; Herb, I.; Mahling, M.; Silaghi, C. Anaplasma phagocytophilum in questing Ixodes ricinus ticks: A comparison of the prevalence and partial 16S rRNA gene variants in urban, pasture and natural habitats. Appl. Environ. Microbiol. 2013, 79, 1730–1734. [Google Scholar] [CrossRef] [Scilit]
- Overzier, E.; Pfister, K.; Thiel, C.; Herb, I.; Mahling, M.; Silaghi, C. Diversity of Babesia and Rickettsia species in questing Ixodes ricinus: A longitudinal study in urban, pasture and natural habitats. Vector Borne Zoonot. Dis. 2013, 13, 559–564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venclikova, K.; Rudolf, I.; Mendel, J.; Betasova, L.; Hubalek, Z. Rickettsiae in questing Ixodes ricinus ticks in the Czech Republic. Ticks Tick Borne Dis. 2014, 5, 135–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venclíková, K.; Mendel, J.; Betášová, L.; Blažejová, H.; Jedličková, P.; Straková, P.; Hubálek, Z.; Rudolf, I. Neglected tick-borne pathogens in the Czech Republic, 2011–2014. Ticks Tick Borne Dis. 2016, 7, 107–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Svitálková, Z.; Haruštiaková, D.; Mahríková, L.; Berthová, L.; Slovák, M.; Kocianová, E.; Kazimírová, M. Anaplasma phagocytophilum prevalence in ticks and rodents in an urban and natural habitat in South-Western Slovakia. Parasit. Vectors 2015, 8, 276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kazimírová, M.; Hamšíková, Z.; Kocianová, E.; Marini, G.; Mojšová, M.; Mahríková, L.; Berthová, L.; Slovák, M.; Rosá, R. Relative density of host-seeking ticks in different habitat types of south-western Slovakia. Exp. Appl. Acarol. 2016, 69, 205–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Courtney, J.W.; Kostelnik, L.M.; Zeidner, N.S.; Massung, R.F. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 2004, 42, 3164–3168. [Google Scholar] [CrossRef] [Scilit]
- Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.L.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 1998, 36, 1090–1095. [Google Scholar]
- Alberti, A.; Zobba, R.; Chessa, B.; Addis, M.F.; Sparagano, O.; Pinna Parpaglia, M.L.; Cubeddu, T.; Pintori, G.; Pittau, M. Equine and canine Anaplasma phagocytophilum strains isolated on the island of Sardinia (Italy) are phylogenetically related to pathogenic strains from the United States. Appl. Environ. Microbiol. 2005, 71, 6418–6422. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Scilit]
- Schorn, S.; Pfister, K.; Reulen, H.; Mahling, M.; Manitz, J.; Thiel, C.; Silaghi, C. Prevalence of Anaplasma phagocytophilum in Ixodes ricinus in Bavarian public parks, Germany. Ticks Tick Borne Dis. 2011, 2, 196–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silaghi, C.; Hamel, D.; Thiel, C.; Pfister, K.; Passos, L.M.; Rehbein, S. Genetic variants of Anaplasma phagocytophilum in wild caprine and cervid ungulates from the Alps in Tyrol, Austria. Vector Borne Zoonot. Dis. 2011, 11, 355–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2016. [Google Scholar]
- Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 2001, 4, 9. [Google Scholar]
- Rizzoli, A.; Silaghi, C.; Obiegala, A.; Rudolf, I.; Hubálek, Z.; Földvári, G.; Plantard, O.; Vayssier-Taussat, M.; Bonnet, S.; Špitalská, E.; et al. Ixodes ricinus and its transmitted pathogens in urban and peri-urban areas in Europe: New hazards and relevance for public health. Front. Public Health. 2014, 2, 251. [Google Scholar] [CrossRef] [Scilit]
- Scharf, W.; Schauer, S.; Freyburger, F.; Petrovec, M.; Schaarschmidt-Kiener, D.; Liebisch, G.; Runge, M.; Ganter, M.; Kehl, A.; Dumler, J.S.; et al. Distinct host species correlate with Anaplasma phagocytophilum ankA gene clusters. J. Clin. Microbiol. 2011, 49, 790–796. [Google Scholar] [CrossRef] [Scilit]
- Overzier, E.; Pfister, K.; Herb, I.; Mahling, M.; Bock, G. Jr.; Silaghi, C. Detection of tick-borne pathogens in roe deer (Capreolus capreolus), in questing ticks (Ixodes ricinus), and in ticks infesting roe deer in southern Germany. Ticks Tick Borne Dis. 2013, 4, 320–328. [Google Scholar] [CrossRef] [Scilit]
- Kauffmann, M.; Rehbein, S.; Hamel, D.; Lutz, W.; Heddergott, M.; Pfister, K.; Silaghi, C. Anaplasma phagocytophilum and Babesia spp. in roe deer (Capreolus capreolus), fallow deer (Dama dama) and mouflon (Ovis musimon) in Germany. Mol. Cell. Probes 2017, 31, 46–54. [Google Scholar] [CrossRef] [Scilit]
- Kazimírová, M.; Hamšíková, Z.; Špitalská, E.; Minichová, L.; Mahríková, L.; Caban, R.; Sprong, H.; Fonville, M.; Schnittger, L.; Kocianová, E. Diverse tick-borne microorganisms identified in free-living ungulates in Slovakia. Parasit. Vectors 2018, 11, 495. [Google Scholar] [CrossRef] [Scilit]
- Stigum, V.M.; Jaarsma, R.I.; Sprong, H.; Rolandsen, C.M.; Mysterud, A. Infection prevalence and ecotypes of Anaplasma phagocytophilum in moose Alces alces, red deer Cervus elaphus, roe deer Capreolus capreolus and Ixodes ricinus ticks from Norway. Parasit. Vectors 2019, 12, 1. [Google Scholar] [CrossRef] [Scilit]
- Telford, S.R.; Dawson, J.E.; Katavlos, P.; Warner, C.C.; Kolbert, K.P.; Persing, D.H. Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proc. Natl. Acad. Sci. USA 1996, 93, 6209–6214. [Google Scholar] [CrossRef] [Scilit]
- Ogden, N.H.; Casey, A.N.J.; Woldehiwet, Z.; French, N.P. Transmission of Anaplasma phagocytophilum to Ixodes ricinus ticks from sheep in the acute and post-acute phases of infection. Infect. Immun. 2003, 71, 2071–2078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chastagner, A.; Pion, A.; Verheyden, H.; Lourtet, B.; Cargnelutti, B.; Picot, D.; Poux, V.; Bard, É.; Plantard, O.; McCoy, K.D.; et al. Host specificity, pathogen exposure, and superinfections impact the distribution of Anaplasma phagocytophilum genotypes in ticks, roe deer, and livestock in a fragmented agricultural landscape. Infect. Genet. Evol. 2017, 55, 31–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tegtmeyer, P.; Ganter, M.; von Loewenich, F.D. Simultaneous infection of cattle with different Anaplasma phagocytophilum variants. Ticks Tick Borne Dis. 2019, 10, 1051–1056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majazki, J.; Wüppenhorst, N.; Hartelt, K.; Birtles, R.; von Loewenich, F.D. Anaplasma phagocytophilum strains from small mammals exhibit specific ankA gene sequences. BMC Vet. Res. 2013, 9, 235. [Google Scholar] [CrossRef] [Scilit]
- Silaghi, C.; Gilles, J.; Hohle, M.; Fingerle, V.; Just, F.T.; Pfister, K. Anaplasma phagocytophilum infection in Ixodes ricinus, Bavaria, Germany. Emerg. Infect. Dis. 2008, 14, 972–974. [Google Scholar] [CrossRef] [Scilit]
- Silaghi, C.; Kohn, B.; Chirek, A.; Thiel, C.; Nolte, I.; Liebisch, G.; Pfister, K. Relationship of molecular and clinical findings on Anaplasma phagocytophilum involved in natural infections of dogs. J. Clin. Microbiol. 2011, 49, 4413–4414. [Google Scholar] [CrossRef] [Scilit]
- Silaghi, C.; Liebisch, G.; Pfister, K. Genetic variants of Anaplasma phagocytophilum from 14 equine granulocytic anaplasmosis cases. Parasit. Vectors 2011, 4, 161. [Google Scholar] [CrossRef] [Scilit]
| Country | Acronym | Name of the Site | Landscape | Geographic Coordinates | |
|---|---|---|---|---|---|
| Germany | A1 | Englischer Garten | Urban park | 48°09′01.73″ N | 11°35′24.19″ E |
| A2 | Nymphenburger Schlosspark | Urban park | 48°09′38.93″ N | 11°29′33.31″ E | |
| A3 | Dörnbergpark | Urban park | 49°00′55.72″ N | 12°05′08.89″ E | |
| A4 | Schlosspark Berg | Forest park | 47°57′43.85″ N | 11°20′53.35″ E | |
| A5 | Kerschlach | Agricultural | 47°54′57.18″ N | 11°12′44.04″ E | |
| A6 | Tussenhausen | Natural | 48°06′36.42″ N | 10°34′33.40″ E | |
| Czech Republic | B1 | Valtice | Urban park | 48°44′05.68″ N | 16°45′11.31″ E |
| B2 | Pohansko | Natural | 48°43′37.68″ N | 16°53′08.35″ E | |
| B3 | Suchovské mlýny | Pastureland | 48°53′50.79″ N | 17°34′54.94″ E | |
| B4 | Proskovice | Natural | 49°44′51.73″ N | 18°12′23.45″ E | |
| B5 | Bělský les | Urban park | 49°47′5.65″ N | 18°14′28.29″ E | |
| Slovakia | C1 | SAS campus | Urban park | 48°10′14.58″ N | 17°04′1.15″ E |
| C2 | Mokrohájska street | Urban | 48°10′34.71″ N | 17°04′3.15″ E | |
| C3 | Železná studienka | Forest park | 48°12′14.16″ N | 17°05′47.05″ E | |
| C4 | Fúgelka | Natural | 48°22′44.14″ N | 17°18′52.86″ E | |
| Gene | Primers and Probes (P) | Sequences (5′-3′) | Ref. |
|---|---|---|---|
| msp2 | ApMSP2f | ATGGAAGGTAGTGTTGGTTATGGTATT | [26] |
| ApMSP2r | TTGGTCTTGAAGCGCTCGTA | ||
| ApMSP2p (P) | HEX-TGGTGCCAGGGTTGAGCTTGAGATTG-TAMRA | ||
| 16S rRNA | 1st amplification: | [27] | |
| ge3a | CACATGCAAGTCGAACGGATTATTC | ||
| ge10r | TTCCGTTAAGAAGGATCTAATCTCC | ||
| 2nd amplification: | |||
| ge9f | AACGGATTATTCTTTATAGCTTGCT | ||
| ge2 | GGCAGTATTAAAAGCAGCTCCAGG | ||
| groEL | EphplgroEL-A.phago-F | ATGGTATGCAGTTTGATCGC | [28] |
| EphgroEL-A.phago-R | TTGAGTACAGCAACACCACCGGAA |
| Roe Deer | Tick Stage | Country | Site | Landscape | Ecotype I | Ecotype II | Ecotype I & II |
|---|---|---|---|---|---|---|---|
| Absent | A | Germany | A1 | UP | 14 | ||
| A3 | UP | 47 | |||||
| Czech | B3 | A | 1 | 2 | |||
| Republic | B5 | UP | 1 | 1 | |||
| Slovakia | C2 | U | 12 | 1 | |||
| N | Germany | A1 | UP | 3 | |||
| A3 | UP | 5 | |||||
| Czech | B3 | A | 1 | 4 | |||
| Republic | B5 | UP | 4 | 1 | |||
| SUBTOTAL | 87 | 3 | 7 | ||||
| % | 89.7 | 3.1 | 7.2 | ||||
| Present | A | Germany | A2 | UP | 8 | 8 | |
| A4 | FP | 5 | |||||
| A5 | A | 2 | 6 | ||||
| A6 | N | 1 | 10 | ||||
| Czech | B1 | UP | 5 | ||||
| Republic | B2 | N | 2 | 1 | |||
| B4 | N | 5 | |||||
| Slovakia | C1 | U | 13 | 6 | 1 | ||
| C3 | FP | 15 | 9 | 1 | |||
| C4 | N | 19 | 5 | 7 | |||
| N | Germany | A2 | UP | 1 | |||
| A6 | N | 2 | |||||
| Czech | B1 | UP | 2 | 1 | 1 | ||
| Republic | B4 | N | 3 | 2 | |||
| Slovakia | C1 | U | 7 | ||||
| C3 | FP | 7 | 9 | 2 | |||
| C4 | N | 5 | 5 | 1 | |||
| SUBTOTAL | 88 | 75 | 14 | ||||
| % | 49.7 | 42.4 | 7.9 | ||||
| TOTAL | 175 | 78 | 21 | ||||
| % | 63.9 | 28.5 | 7.7 |
| Roe Deer | Tick Stage | Country | Site | Landscape | 16S rRNA Gene Variant | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | B | I | J | N | O | P | S | V | W | X | Y | Z | |||||
| Absent | A | Germany | A1 | UP | 13 | 1 | |||||||||||
| A3 | UP | 48 | |||||||||||||||
| Czech | B3 | A | 1 | 2 | 1 | ||||||||||||
| Republic | B5 | UP | 4 | ||||||||||||||
| Slovakia | C2 | U | 13 | 1 | |||||||||||||
| N | Germany | A1 | UP | 3 | |||||||||||||
| A3 | UP | 6 | |||||||||||||||
| Czech | B3 | A | 1 | 4 | |||||||||||||
| Republic | B5 | UP | 4 | 1 | |||||||||||||
| SUBTOTAL | 93 | 1 | 1 | 6 | 1 | 1 | |||||||||||
| % | 90.3 | 1.0 | 1.0 | 5.8 | 1.0 | 1.0 | |||||||||||
| Present | A | Germany | A2 | UP | 8 | 1 | 7 | 1 | |||||||||
| A4 | FP | 3 | 2 | ||||||||||||||
| A5 | A | 2 | 1 | 2 | 3 | ||||||||||||
| A6 | N | 1 | 1 | 2 | 3 | 4 | |||||||||||
| Czech | B1 | UP | 5 | ||||||||||||||
| Republic | B2 | N | 1 | 1 | 1 | ||||||||||||
| B4 | N | 6 | |||||||||||||||
| Slovakia | C1 | U | 14 | 1 | 5 | ||||||||||||
| C3 | FP | 15 | 1 | 1 | 2 | 6 | 1 | ||||||||||
| C4 | N | 13 | 1 | 1 | 9 | 1 | 7 | 3 | |||||||||
| N | Germany | A2 | UP | 1 | |||||||||||||
| A6 | N | 2 | |||||||||||||||
| Czech | B1 | UP | 2 | 1 | 1 | ||||||||||||
| Republic | B4 | N | 4 | 1 | |||||||||||||
| Slovakia | C1 | U | 4 | 4 | 1 | ||||||||||||
| C3 | FP | 7 | 2 | 9 | |||||||||||||
| C4 | N | 4 | 1 | 2 | 4 | 1 | |||||||||||
| SUBTOTAL | 79 | 6 | 2 | 2 | 1 | 1 | 11 | 9 | 15 | 38 | 23 | 1 | |||||
| % | 42.0 | 3.2 | 1.1 | 1.1 | 0.5 | 0.5 | 5.8 | 4.8 | 8.0 | 20.2 | 12.2 | 0.5 | |||||
| TOTAL | 172 | 6 | 2 | 2 | 1 | 1 | 1 | 11 | 10 | 21 | 39 | 24 | 1 | ||||
| % | 59.1 | 2.1 | 0.7 | 0.7 | 0.3 | 0.3 | 0.3 | 3.8 | 3.4 | 7.2 | 13.4 | 8.2 | 0.3 | ||||
| Roe | Adults | Nymphs | TOTAL | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Country | Site | Landscape | Deer | Positive/Total | % | Positive/Total | % | Positive/Total | % |
| Germany | A1 | UP | - | 29/480 | 6.0 | 6/238 | 2.5 | 35/718 | 4.9 |
| A2 | UP | + | 24/491 | 4.9 | 2/260 | 0.8 | 26/751 | 3.5 | |
| A3 | UP | - | 93/475 | 19.6 | 9/240 | 3.7 | 102/715 | 14.3 | |
| A4 | FP | + | 8/390 | 2.0 | 1/226 | 0.4 | 9/606 | 1.5 | |
| A5 | A | + | 14/459 | 3.0 | 0/260 | 0 | 14/719 | 1.9 | |
| A6 | N | + | 24/305 | 7.9 | 4/240 | 0.8 | 28/545 | 5.1 | |
| Czech | B1 | UP | + | 11/178 | 6.2 | 6/237 | 2.5 | 17/415 | 4.1 |
| Republic | B2 | N | + | 3/37 | 8.1 | 0/170 | 0 | 3/207 | 1.4 |
| B3 | A | - | 5/86 | 5.8 | 7/456 | 1.5 | 12/542 | 2.2 | |
| B4 | N | + | 11/83 | 13.3 | 12/1114 | 1.1 | 23/1197 | 1.9 | |
| B5 | UP | - | 13/96 | 13.5 | 13/180 | 7.2 | 26/276 | 9.4 | |
| Slovakia | C1 | UP | + | 139/397 | 35.0 | 70/663 | 10.6 | 209/1060 | 19.7 |
| C2 | U | - | 23/193 | 11.9 | 0/13 | 0 | 23/206 | 11.2 | |
| C3 | FP | + | 47/344 | 13.7 | 32/404 | 7.9 | 79/748 | 10.6 | |
| C4 | N | + | 30/520 | 5.8 | 20/1362 | 1.5 | 50/1882 | 2.7 | |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hamšíková, Z.; Silaghi, C.; Takumi, K.; Rudolf, I.; Gunár, K.; Sprong, H.; Kazimírová, M. Presence of Roe Deer Affects the Occurrence of Anaplasma phagocytophilum Ecotypes in Questing Ixodes ricinus in Different Habitat Types of Central Europe. Int. J. Environ. Res. Public Health 2019, 16, 4725. https://doi.org/10.3390/ijerph16234725
Hamšíková Z, Silaghi C, Takumi K, Rudolf I, Gunár K, Sprong H, Kazimírová M. Presence of Roe Deer Affects the Occurrence of Anaplasma phagocytophilum Ecotypes in Questing Ixodes ricinus in Different Habitat Types of Central Europe. International Journal of Environmental Research and Public Health. 2019; 16(23):4725. https://doi.org/10.3390/ijerph16234725
Chicago/Turabian StyleHamšíková, Zuzana, Cornelia Silaghi, Katsuhisa Takumi, Ivo Rudolf, Kristyna Gunár, Hein Sprong, and Mária Kazimírová. 2019. "Presence of Roe Deer Affects the Occurrence of Anaplasma phagocytophilum Ecotypes in Questing Ixodes ricinus in Different Habitat Types of Central Europe" International Journal of Environmental Research and Public Health 16, no. 23: 4725. https://doi.org/10.3390/ijerph16234725
APA StyleHamšíková, Z., Silaghi, C., Takumi, K., Rudolf, I., Gunár, K., Sprong, H., & Kazimírová, M. (2019). Presence of Roe Deer Affects the Occurrence of Anaplasma phagocytophilum Ecotypes in Questing Ixodes ricinus in Different Habitat Types of Central Europe. International Journal of Environmental Research and Public Health, 16(23), 4725. https://doi.org/10.3390/ijerph16234725

