Prenatal Perfluorooctyl Sulfonate Exposure and Alu DNA Hypomethylation in Cord Blood
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Subjects and Questionnaire Data
2.2. Sample Collection
2.3. Methylation Analysis
2.4. Exposure Measurements
2.5. Statistical Analysis
3. Results
4. Discussions
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
Appendix A
| ID | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Sequencing Primer (5′ to 3′) | Sequence to Analysis |
|---|---|---|---|---|
| Global methylation analysis | ||||
| PyroMark Q96 CpG LINE-1 | Commercial kit | Commercial kit | Commercial kit | TTC/TGTGGTGC/TGTC/TGTTTTTTAAGTC/TGGTTT |
| Alu | bio-TTTTTATTAAAAATATAAAAATT | CCCAAACTAAAATACAATAA | AATAACTAAAATTACAAAC | A/GC/TA/GC/TAGCCACCA |
References
- Olsen, G.W.; Burris, J.M.; Ehresman, D.J.; Froehlich, J.W.; Seacat, A.M.; Butenhoff, J.L.; Zobel, L.R. Half-life of serum elimination of perfluorooctanesulfonate, perfluorohexanesulfonate, and perfluorooctanoate in retired fluorochemical production workers. Environ. Health Perspect. 2007, 115, 1298–1305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seacat, A.M.; Thomford, P.J.; Hansen, K.J.; Olsen, G.W.; Case, M.T.; Butenhoff, J.L. Subchronic toxicity studies on perfluorooctanesulfonate potassium salt in cynomolgus monkeys. Toxicol. Sci. 2002, 68, 249–264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seacat, A.M.; Thomford, P.J.; Hansen, K.J.; Clemen, L.A.; Eldridge, S.R.; Elcombe, C.R.; Butenhoff, J.L. Sub-chronic dietary toxicity of potassium perfluorooctanesulfonate in rats. Toxicology 2003, 183, 117–131. [Google Scholar] [CrossRef] [Scilit]
- Thibodeaux, J.R.; Hanson, R.G.; Rogers, J.M.; Grey, B.E.; Barbee, B.D.; Richards, J.H.; Butenhoff, J.L.; Stevenson, L.A.; Lau, C. Exposure to perfluorooctane sulfonate during pregnancy in rat and mouse. I: Maternal and prenatal evaluations. Toxicol. Sci. 2003, 74, 369–381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guruge, K.S.; Yeung, L.W.; Yamanaka, N.; Miyazaki, S.; Lam, P.K.; Giesy, J.P.; Jones, P.D.; Yamashita, N. Gene expression profiles in rat liver treated with perfluorooctanoic acid (PFOA). Toxicol. Sci. 2006, 89, 93–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Apelberg, B.J.; Witter, F.R.; Herbstman, J.B.; Calafat, A.M.; Halden, R.U.; Needham, L.L.; Goldman, L.R. Cord serum concentrations of perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) in relation to weight and size at birth. Environ. Health Perspect. 2007, 115, 1670–1676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yeung, L.W.; Guruge, K.S.; Taniyasu, S.; Yamashita, N.; Angus, P.W.; Herath, C.B. Profiles of perfluoroalkyl substances in the liver and serum of patients with liver cancer and cirrhosis in Australia. Ecotoxicol. Environ. Saf. 2013, 96, 139–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonefeld-Jorgensen, E.C.; Long, M.; Bossi, R.; Ayotte, P.; Asmund, G.; Kruger, T.; Ghisari, M.; Mulvad, G.; Kern, P.; Nzulumiki, P.; et al. Perfluorinated compounds are related to breast cancer risk in greenlandic inuit: A case control study. Environ. Health 2011, 10, 88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fei, C.; McLaughlin, J.K.; Tarone, R.E.; Olsen, J. Perfluorinated chemicals and fetal growth: A study within the Danish national birth cohort. Environ. Health Perspect. 2007, 115, 1677–1682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, M.H.; Ha, E.H.; Wen, T.W.; Su, Y.N.; Lien, G.W.; Chen, C.Y.; Chen, P.C.; Hsieh, W.S. Perfluorinated compounds in umbilical cord blood and adverse birth outcomes. PLoS ONE 2012, 7, e42474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, I.J.; Hsieh, W.S.; Chen, C.Y.; Fletcher, T.; Lien, G.W.; Chiang, H.L.; Chiang, C.F.; Wu, T.N.; Chen, P.C. The effect of prenatal perfluorinated chemicals exposures on pediatric atopy. Environ. Res. 2011, 111, 785–791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Q.; Franklin, J.N.; Bryan, I.; Morris, E.; Wood, A.; DeWitt, J.C. Does developmental exposure to perflurooctanoic acid (pfoa) induce immunopathologies commonly observed in neurodevelopmental disorders? Neurotoxicology 2012, 33, 1491–1498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eriksen, K.T.; Raaschou-Nielsen, O.; Sorensen, M.; Roursgaard, M.; Loft, S.; Moller, P. Genotoxic potential of the perfluorinated chemicals PFOA, PFOS, PFBS, PFNA and PFHxA in human HepG2 cells. Mutat. Res. 2010, 700, 39–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Opinion of the scientific panel on contaminants in the food chain on perfluorooctane sulfonate (PFOS), perfluorooctanoic acid (PFOA) and their salts. EFSA J. 2008, 653, 1–131.
- Luebker, D.J.; Case, M.T.; York, R.G.; Moore, J.A.; Hansen, K.J.; Butenhoff, J.L. Two-generation reproduction and cross-foster studies of perfluorooctanesulfonate (PFOS) in rats. Toxicology 2005, 215, 126–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandegehuchte, M.B.; Janssen, C.R. Epigenetics and its implications for ecotoxicology. Ecotoxicology 2011, 20, 607–624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Xu, M.; Wang, S.; Yang, X.; Zhou, S.; Zhang, J.; Liu, Q.; Sun, Y. Lead exposure suppressed alad transcription by increasing methylation level of the promoter CpG islands. Toxicol. Lett. 2011, 203, 48–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kovalenko, V.M.; Bagnyukova, T.V.; Sergienko, O.V.; Bondarenko, L.B.; Shayakhmetova, G.M.; Matvienko, A.V.; Pogribny, I.P. Epigenetic changes in the rat livers induced by pyrazinamide treatment. Toxicol. Appl. Pharmacol. 2007, 225, 293–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, E.; Bestor, T.H.; Jaenisch, R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 1992, 69, 915–926. [Google Scholar] [CrossRef] [Scilit]
- Okano, M.; Bell, D.W.; Haber, D.A.; Li, E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999, 99, 247–257. [Google Scholar] [CrossRef] [Scilit]
- Bird, A.P. CpG-rich islands and the function of DNA methylation. Nature 1986, 321, 209–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jirtle, R.L.; Skinner, M.K. Environmental epigenomics and disease susceptibility. Nat. Rev. Genet. 2007, 8, 253–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dolinoy, D.C.; Weidman, J.R.; Jirtle, R.L. Epigenetic gene regulation: Linking early developmental environment to adult disease. Reprod. Toxicol. 2007, 23, 297–307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, R.Z.; Pettersson, U.; Beard, C.; Jackson-Grusby, L.; Jaenisch, R. DNA hypomethylation leads to elevated mutation rates. Nature 1998, 395, 89–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, W.; Hernandez, R.; Zhang, X.Y.; Qu, G.Z.; Frady, A.; Varela, M.; Ehrlich, M. DNA demethylation and pericentromeric rearrangements of chromosome 1. Mutat. Res. 1997, 379, 33–41. [Google Scholar] [CrossRef] [Scilit]
- Yang, A.S.; Estecio, M.R.; Doshi, K.; Kondo, Y.; Tajara, E.H.; Issa, J.P. A simple method for estimating global DNA methylation using bisulfite pcr of repetitive DNA elements. Nucleic Acids Res. 2004, 32, e38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ostertag, E.M.; Kazazian, H.H., Jr. Biology of mammalian l1 retrotransposons. Annu. Rev. Genet. 2001, 35, 501–538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, J.S.; Szak, S.T.; Boeke, J.D. Transcriptional disruption by the l1 retrotransposon and implications for mammalian transcriptomes. Nature 2004, 429, 268–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weisenberger, D.J.; Campan, M.; Long, T.I.; Kim, M.; Woods, C.; Fiala, E.; Ehrlich, M.; Laird, P.W. Analysis of repetitive element DNA methylation by methylight. Nucleic Acids Res. 2005, 33, 6823–6836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, C.J.; Hsieh, W.S.; Su, Y.N.; Liao, H.F.; Jeng, S.F.; Taso, F.M.; Hwang, Y.H.; Wu, K.Y.; Chen, C.Y.; Guo, Y.L.; et al. The Taiwan birth panel study: A prospective cohort study for environmentally-related child health. BMC Res. Notes 2011, 4, 291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bollati, V.; Baccarelli, A.; Hou, L.; Bonzini, M.; Fustinoni, S.; Cavallo, D.; Byun, H.M.; Jiang, J.; Marinelli, B.; Pesatori, A.C.; et al. Changes in DNA methylation patterns in subjects exposed to low-dose benzene. Cancer Res. 2007, 67, 876–880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lien, G.W.; Wen, T.W.; Hsieh, W.S.; Wu, K.Y.; Chen, C.Y.; Chen, P.C. Analysis of perfluorinated chemicals in umbilical cord blood by ultra-high performance liquid chromatography/tandem mass spectrometry. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2011, 879, 641–646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, W.S.; Wu, H.C.; Jeng, S.F.; Liao, H.F.; Su, Y.N.; Lin, S.J.; Hsieh, C.J.; Chen, P.C. Nationwide singleton birth weight percentiles by gestational age in Taiwan, 1998–2002. Acta Paediatr. Taiwan 2006, 47, 25–33. [Google Scholar] [PubMed]
- Baron, R.M.; Kenny, D.A. The moderator-mediator variable distinction in social psychological research: Conceptual, strategic, and statistical considerations. J. Pers. Soc. Psychol. 1986, 51, 1173–1182. [Google Scholar] [CrossRef] [PubMed]
- Tingley, D.; Yamamoto, T.; Hirose, K.; Keele, L.; Imai, K. Mediation: R package for causal mediation analysis. J. Stat. Softw. 2014, 59, 1–38. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.J.; Ban, J.B.; Wan, Y.J.; Shen, J.; Li, Y.Y.; Huang, Q. Maternal exposure to pfos alters DNA methylation levels in offspring rats. Chin. J. Public Health 2011, 27, 322–324. [Google Scholar]
- Guerrero-Preston, R.; Goldman, L.R.; Brebi-Mieville, P.; Ili-Gangas, C.; Lebron, C.; Witter, F.R.; Apelberg, B.J.; Hernandez-Roystacher, M.; Jaffe, A.; Halden, R.U.; et al. Global DNA hypomethylation is associated with in utero exposure to cotinine and perfluorinated alkyl compounds. Epigenetics 2010, 5, 539–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, S.; Azumi, K.; Goudarzi, H.; Araki, A.; Miyashita, C.; Kobayashi, S.; Itoh, S.; Sasaki, S.; Ishizuka, M.; Nakazawa, H.; et al. Effects of prenatal perfluoroalkyl acid exposure on cord blood igf2/h19 methylation and ponderal index: The hokkaido study. J. Expo. Sci. Environ. Epidemiol. 2017, 27, 251–259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leter, G.; Consales, C.; Eleuteri, P.; Uccelli, R.; Specht, I.O.; Toft, G.; Moccia, T.; Budillon, A.; Jonsson, B.A.; Lindh, C.H.; et al. Exposure to perfluoroalkyl substances and sperm DNA global methylation in arctic and european populations. Environ. Mol. Mutagen. 2014, 55, 591–600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huen, K.; Yousefi, P.; Bradman, A.; Yan, L.; Harley, K.G.; Kogut, K.; Eskenazi, B.; Holland, N. Effects of age, sex, and persistent organic pollutants on DNA methylation in children. Environ. Mol. Mutagen. 2014, 55, 209–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Z.Z.; Hou, L.; Bollati, V.; Tarantini, L.; Marinelli, B.; Cantone, L.; Yang, A.S.; Vokonas, P.; Lissowska, J.; Fustinoni, S.; et al. Predictors of global methylation levels in blood DNA of healthy subjects: A combined analysis. Int. J. Epidemiol. 2012, 41, 126–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ade, C.; Roy-Engel, A.M.; Deininger, P.L. Alu elements: An intrinsic source of human genome instability. Curr. Opin. Virol. 2013, 3, 639–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.; Ara, T.; Gautheret, D. Using alu elements as polyadenylation sites: A case of retroposon exaptation. Mol. Biol. Evol. 2009, 26, 327–334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Characteristics a | Total (N = 486) | Included (N = 363) | Excluded (N = 123) |
|---|---|---|---|
| Maternal age at delivery (years) * | 30.8 (4.7) | 30.4 (4.7) | 32.1 (4.3) |
| Maternal BMI (kg/m2) | 20.9 (3.1) | 21 (3.3) | 20.6 (2.4) |
| Parental education level b | |||
| Not senior high school graduated (%) | 3 (0.6) | 3 (0.8) | 0 (0) |
| Senior high school graduated (%) | 24 (4.3) | 19 (5.3) | 2 (1.6) |
| Four–year college /university and above (%) | 485 (95.1) | 340 (93.9) | 121 (98.4) |
| Delivery method, vaginal (%) | 60.1 | 60.5 | 58.9 |
| Infants | |||
| Boys (%) | 50.6 | 49.5 | 54 |
| Birth weight (g) | 3157.9 (476.6) | 3141.7 (490.0) | 3204.7 (433.9) |
| Gestational age (weeks) * | 38.5 (1.7) | 38.4 (1.8) | 38.8 (1.5) |
| Low birth weight (<2500 g) (%) | 28 (5.8) | 25 (6.9) | 3 (2.4) |
| Small gestational age (%) | 32 (6.6) | 23 (6.4) | 9 (7.3) |
| Preterm birth (<37 weeks) (%) * | 42 (8.6) | 39 (10.7) | 3 (2.4) |
| Cord blood | |||
| Cotinine (ng/mL) * | 3.4 (19.2) | 4.5 (22.3) | 0.8 (5.8) |
| LINE-1 methylation (%) | 80.2 (3.99) | ||
| Alu methylation (%) | 20.7 (1.72) |
| Exposure a (ng/mL) | Detection Limit (ng/mL) | Mean | (SD) | GM | (GSD) | Min. | Median | Max. | |
|---|---|---|---|---|---|---|---|---|---|
| PFOS * | 0.066 | Total | 7.66 | (7.34) | 5.97 | (1.95) | 0.11 | 5.67 | 67.92 |
| Included | 7.80 | (7.66) | 6.07 | (1.93) | 1.08 | 5.70 | 67.92 | ||
| Excluded | 7.24 | (6.34) | 5.69 | (2.04) | 0.11 | 5.61 | 48.36 | ||
| PFOA * | 1.23 | Total | 2.57 | (2.38) | 1.84 | (2.24) | 0.75 | 1.86 | 17.40 |
| Included | 2.88 | (2.55) | 2.05 | (2.28) | 0.75 | 2.12 | 17.40 | ||
| Excluded | 1.71 | (1.52) | 1.33 | (1.93) | 0.75 | 1.02 | 9.45 | ||
| PFNA * | 0.67 | Total | 6.29 | (8.39) | 2.38 | (4.70) | 0.38 | 3.00 | 63.87 |
| Included | 7.11 | (8.98) | 2.77 | (4.74) | 0.38 | 3.86 | 63.87 | ||
| Excluded | 3.93 | (5.81) | 1.54 | (4.23) | 0.38 | 1.36 | 39.87 | ||
| PFUA * | 2.4 | Total | 16.9 | (15.88) | 10.12 | (3.11) | 1.50 | 13.50 | 102.36 |
| Included | 18.10 | (17.14) | 10.63 | (3.20) | 1.50 | 14.18 | 102.36 | ||
| Excluded | 13.45 | (10.84) | 8.77 | (2.84) | 1.50 | 10.41 | 45.75 |
| Exposure a (ng/) mL | Infant’s Sex | Mean (SD) | GM (GSD) | Min. | Median | Max. |
|---|---|---|---|---|---|---|
| PFOS | Boy | 8.44 (9.52) | 6.08 (2.09) | 1.83 | 5.60 | 67.92 |
| Girl | 7.05 (4.99) | 5.85 (1.81) | 1.08 | 5.70 | 38.85 | |
| PFOA | Boy | 2.90 (2.51) | 1.84 (2.22) | 0.75 | 2.24 | 13.86 |
| Girl | 2.87 (2.60) | 1.83 (2.27) | 0.75 | 2.10 | 17.40 | |
| PFNA | Boy | 6.87 (7.94) | 2.27 (4.83) | 0.38 | 3.95 | 34.56 |
| Girl | 7.45 (9.95) | 2.51 (4.57) | 0.38 | 3.90 | 63.87 | |
| PFUA * | Boy | 16.42 (17.33) | 8.57 (3.25) | 1.50 | 11.07 | 98.76 |
| Girl | 19.82 (16.90) | 12.08 (2.89) | 1.50 | 16.62 | 102.36 |
| DNA Methylation (% 5mC) | Exposure a | Crude Linear Regression Model | Multiple Linear Regression Model b | Crude Logistic Regression Model c | Multiple Logistic Regression Model bc | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| β | (95% CI) | p-Value | β | (95% CI) | p-Value | OR | (95% CI) | p-Value | OR | (95% CI) | p-Value | ||
| LINE-1 | PFOS | −0.76 | (−1.48, −0.05) | 0.03 | −0.67 | (−1.61, 0.26) | 0.16 | 1.19 | (0.85–1.66) | 0.31 | 1.08 | (0.69–1.70) | 0.48 |
| PFOA | 0.55 | (−0.02, 1.12) | 0.06 | 0.41 | (−0.38, 1.20) | 0.31 | 0.84 | (0.65–1.10) | 0.21 | 0.97 | (0.67–1.40) | 0.97 | |
| PFNA | 0.03 | (−0.27, 0.33) | 0.84 | −0.07 | (−0.48, 0.35) | 0.75 | 1.02 | (0.89–1.17) | 0.78 | 1.13 | (0.93–1.36) | 0.17 | |
| PFUA | −0.36 | (−0.77, 0.04) | 0.08 | −0.47 | (−1.02, 0.09) | 0.10 | 1.10 | (0.91–1.33) | 0.31 | 1.06 | (0.82–1.37) | 0.56 | |
| Alu | PFOS | −0.27 | (−0.54, −0.01) | 0.04 | −0.33 | (−0.63, −0.02) | 0.03 | 1.71 | (1.19–2.44) | 0.003 | 1.72 | (1.03–2.88) | 0.02 |
| PFOA | 0.04 | (−0.18, 0.25) | 0.73 | −0.03 | (−0.28, 0.23) | 0.82 | 0.89 | (0.68–1.17) | 0.40 | 1.10 | (0.75–1.62) | 0.48 | |
| PFNA | −0.02 | (−0.14, 0.09) | 0.68 | 0.03 | (−0.11, 0.16) | 0.68 | 0.96 | (0.83–1.11) | 0.57 | 1.01 | (0.83−1.24) | 0.88 | |
| PFUA | −0.05 | (−0.2, 0.09) | 0.47 | −0.03 | (−0.21, 0.14) | 0.90 | 1.26 | (1.04–1.52) | 0.01 | 1.13 | (0.86–1.47) | 0.26 | |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, C.-Y.; Chen, P.-C.; Lien, P.-C.; Liao, Y.-P. Prenatal Perfluorooctyl Sulfonate Exposure and Alu DNA Hypomethylation in Cord Blood. Int. J. Environ. Res. Public Health 2018, 15, 1066. https://doi.org/10.3390/ijerph15061066
Liu C-Y, Chen P-C, Lien P-C, Liao Y-P. Prenatal Perfluorooctyl Sulfonate Exposure and Alu DNA Hypomethylation in Cord Blood. International Journal of Environmental Research and Public Health. 2018; 15(6):1066. https://doi.org/10.3390/ijerph15061066
Chicago/Turabian StyleLiu, Chen-Yu, Pau-Chung Chen, Pei-Chen Lien, and Yi-Peng Liao. 2018. "Prenatal Perfluorooctyl Sulfonate Exposure and Alu DNA Hypomethylation in Cord Blood" International Journal of Environmental Research and Public Health 15, no. 6: 1066. https://doi.org/10.3390/ijerph15061066
APA StyleLiu, C.-Y., Chen, P.-C., Lien, P.-C., & Liao, Y.-P. (2018). Prenatal Perfluorooctyl Sulfonate Exposure and Alu DNA Hypomethylation in Cord Blood. International Journal of Environmental Research and Public Health, 15(6), 1066. https://doi.org/10.3390/ijerph15061066
