Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1
Abstract
:1. Introduction
2. Results and Discussion
2.1. Structural Elucidation
2.2. Anti-Pulmonary Fibrosis Activity
3. Materials and Methods
3.1. General Experimental Procedures
3.2. Fungal Material
3.3. Fermentation, Extraction, and Isolation
3.4. Anti-Pulmonary Fibrosis Activity Analysis
3.4.1. Cell Culture and Treatment
3.4.2. Quantitative Real-Time PCR (qRT-PCR) Assay
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Kong, F.-D.; Zhang, S.-L.; Zhou, S.-Q.; Ma, Q.-Y.; Xie, Q.-Y.; Chen, J.-P.; Li, J.-H.; Zhou, L.-M.; Yuan, J.-Z.; Hu, Z.; et al. Quinazoline-Containing Indole Alkaloids from the Marine-Derived Fungus Aspergillus sp. HNMF114. J. Nat. Prod. 2019, 82, 3456–3463. [Google Scholar] [CrossRef] [PubMed]
- Liao, L.; You, M.; Chung, B.K.; Oh, D.-C.; Oh, K.-B.; Shin, J. Alkaloidal Metabolites from a Marine-Derived Aspergillus sp. Fungus. J. Nat. Prod. 2015, 78, 349–354. [Google Scholar] [CrossRef] [PubMed]
- Zain Ul Arifeen, M.; Ma, Y.-N.; Xue, Y.-R.; Liu, C.-H. Deep-Sea Fungi Could Be the New Arsenal for Bioactive Molecules. Mar. Drugs 2019, 18, 9. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Mudassir, S.; Zhang, Z.; Feng, Y.; Chang, Y.; Che, Q.; Gu, Q.; Zhu, T.; Zhang, G.; Li, D. Secondary Metabolites from Deep-Sea Derived Microorganisms. Curr. Med. Chem. 2020, 27, 6244–6273. [Google Scholar] [CrossRef]
- Wang, W.; Yu, Y.; Keller, N.P.; Wang, P. Presence, Mode of Action, and Application of Pathway Specific Transcription Factors in Aspergillus Biosynthetic Gene Clusters. Int. J. Mol. Sci. 2021, 22, 8709. [Google Scholar] [CrossRef]
- Youssef, F.S.; Simal-Gandara, J. Comprehensive Overview on the Chemistry and Biological Activities of Selected Alkaloid Producing Marine-Derived Fungi as a Valuable Reservoir of Drug Entities. Biomedicines 2021, 9, 485. [Google Scholar] [CrossRef]
- Zhu, J.; Song, L.; Shen, S.; Fu, W.; Zhu, Y.; Liu, L. Bioactive Alkaloids as Secondary Metabolites from Plant Endophytic Aspergillus Genus. Molecules 2023, 28, 7789. [Google Scholar] [CrossRef]
- Li, S.-G.; Wang, K.-B.; Gong, C.; Bao, Y.; Qin, N.-B.; Li, D.-H.; Li, Z.-L.; Bai, J.; Hua, H.-M. Cytotoxic Quinazoline Alkaloids from the Seeds of Peganum harmala. Bioorganic Med. Chem. Lett. 2018, 28, 103–106. [Google Scholar] [CrossRef]
- Buttachon, S.; Chandrapatya, A.; Manoch, L.; Silva, A.; Gales, L.; Bruyère, C.; Kiss, R.; Kijjoa, A. Sartorymensin, a New Indole Alkaloid, and New Analogues of Tryptoquivaline and Fiscalins Produced by Neosartorya siamensis (KUFC 6349). Tetrahedron 2012, 68, 3253–3262. [Google Scholar] [CrossRef]
- Long, S.; Duarte, D.; Carvalho, C.; Oliveira, R.; Santarém, N.; Palmeira, A.; Resende, D.I.S.P.; Silva, A.M.S.; Moreira, R.; Kijjoa, A.; et al. Indole-Containing Pyrazino[2,1-b]Quinazoline-3,6-Diones Active against Plasmodium and Trypanosomatids. ACS Med. Chem. Lett. 2022, 13, 225–235. [Google Scholar] [CrossRef]
- Numata, A.; Takahashi, C.; Matsushita, T.; Miyamoto, T.; Kawai, K.; Usami, Y.; Matsumura, E.; Inoue, M.; Ohishi, H.; Shingu, T. Fumiquinazolines, Novel Metabolites of a Fungus Isolated from a Saltfish. Tetrahedron Lett. 1992, 33, 1621–1624. [Google Scholar] [CrossRef]
- Takahashi, C.; Matsushita, T.; Doi, M.; Minoura, K.; Shingu, T.; Kumeda, Y.; Numata, A. Fumiquinazolines A–G, Novel Metabolites of a Fungus Separated from a Pseudolabrus Marine Fish. J. Chem. Soc. Perkin Trans. 1995, 1, 2345–2353. [Google Scholar] [CrossRef]
- Liu, R.; Li, H.; Yang, J.; An, Z. Quinazolinones Isolated from Aspergillus sp., an Endophytic Fungus of Astragalus membranaceus. Chem. Nat. Compd. 2018, 54, 808–810. [Google Scholar] [CrossRef]
- Liu, Y.; Cui, Y.; Lu, L.; Gong, Y.; Han, W.; Piao, G. Natural Indole-containing Alkaloids and Their Antibacterial Activities. Arch. Pharm. 2020, 353, 2000120. [Google Scholar] [CrossRef]
- Hu, Y.; Chen, S.; Yang, F.; Dong, S. Marine Indole Alkaloids—Isolation, Structure and Bioactivities. Mar. Drugs 2021, 19, 658. [Google Scholar] [CrossRef]
- Islam, F.; Dehbia, Z.; Zehravi, M.; Das, R.; Sivakumar, M.; Krishnan, K.; Billah, A.A.M.; Bose, B.; Ghosh, A.; Paul, S.; et al. Indole Alkaloids from Marine Resources: Understandings from Therapeutic Point of View to Treat Cancers. Chem. Biol. Interact. 2023, 383, 110682. [Google Scholar] [CrossRef]
- Alrajhi, N.N. Post-COVID-19 Pulmonary Fibrosis: An Ongoing Concern. Ann. Thorac. Med. 2023, 18, 173–181. [Google Scholar] [CrossRef]
- Perez-Favila, A.; Garza-Veloz, I. Antifibrotic Drugs against Idiopathic Pulmonary Fibrosis and Pulmonary Fibrosis Induced by COVID-19: Therapeutic Approaches and Potential Diagnostic Biomarkers. Int. J. Mol. Sci. 2024, 25, 1562. [Google Scholar] [CrossRef]
- Qin, R.; Zhao, Q.; Han, B.; Zhu, H.-P.; Peng, C.; Zhan, G.; Huang, W. Indole-Based Small Molecules as Potential Therapeutic Agents for the Treatment of Fibrosis. Front. Pharmacol. 2022, 13, 845892. [Google Scholar] [CrossRef]
- Cheng, Z.; Lou, L.; Liu, D.; Li, X.; Proksch, P.; Yin, S.; Lin, W. Versiquinazolines A–K, Fumiquinazoline-Type Alkaloids from the Gorgonian-Derived Fungus Aspergillus versicolor LZD-14-1. J. Nat. Prod. 2016, 79, 2941–2952. [Google Scholar] [CrossRef]
- Guo, Y.-W.; Liu, X.-J.; Yuan, J.; Li, H.-J.; Mahmud, T.; Hong, M.-J.; Yu, J.-C.; Lan, W.-J. l-Tryptophan Induces a Marine-Derived Fusarium sp. to Produce Indole Alkaloids with Activity against the Zika Virus. J. Nat. Prod. 2020, 83, 3372–3380. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.-H.; Xu, M.-Y.; Li, H.-J.; Li, J.-Q.; Chen, Y.-X.; Ma, W.-Z.; Li, Y.-P.; Xu, J.; Yang, D.-P.; Lan, W.-J. Amino Acid-Directed Strategy for Inducing the Marine-Derived Fungus Scedosporium apiospermum F41–1 to Maximize Alkaloid Diversity. Org. Lett. 2017, 19, 4888–4891. [Google Scholar] [CrossRef] [PubMed]
- Kirby, G.W.; Robins, D.J.; Sefton, M.A.; Talekar, R.R. Biosynthesis of Bisdethiobis(Methylthio)Gliotoxin, a New Metabolite of Gliocladium deliquescens. J. Chem. Soc. Perkin Trans. 1980, 1, 119. [Google Scholar] [CrossRef]
- Li, X.; Kim, S.-K.; Nam, K.W.; Kang, J.S.; Choi, H.D.; Son, B.W. A New Antibacterial Dioxopiperazine Alkaloid Related to Gliotoxin from a Marine Isolate of the Fungus Pseudallescheria. J. Antibiot. 2006, 59, 248–250. [Google Scholar] [CrossRef]
- Afiyatullov, S.S.; Kalinovskii, A.I.; Pivkin, M.V.; Dmitrenok, P.S.; Kuznetsova, T.A. Alkaloids from the Marine Isolate of the Fungus Aspergillus fumigatus. Chem. Nat. Compd. 2005, 41, 236–238. [Google Scholar] [CrossRef]
- Barrow, C.J.; Sun, H.H. Spiroquinazoline, a Novel Substance P Inhibitor with a New Carbon Skeleton, Isolated from Aspergillus flavipes. J. Nat. Prod. 1994, 57, 471–476. [Google Scholar] [CrossRef]
- Zhang, W.; Li, J.; Wei, C.; Deng, X.; Xu, J. Chemical Epigenetic Modifiers Enhance the Production of Immunosuppressants from the Endophytic Fungus Aspergillus fumigatus Isolated from Cynodon dactylon. Nat. Prod. Res. 2022, 36, 4481–4485. [Google Scholar] [CrossRef]
- Larsen, T.O.; Frydenvang, K.; Frisvad, J.C.; Christophersen, C. UV-Guided Isolation of Alantrypinone, a Novel Penicillium Alkaloid. J. Nat. Prod. 1998, 61, 1154–1157. [Google Scholar] [CrossRef]
- Limbadri, S.; Luo, X.; Lin, X.; Liao, S.; Wang, J.; Zhou, X.; Yang, B.; Liu, Y. Bioactive Novel Indole Alkaloids and Steroids from Deep Sea-Derived Fungus Aspergillus fumigatus SCSIO 41012. Molecules 2018, 23, 2379. [Google Scholar] [CrossRef]
- Jiao, R.H.; Xu, S.; Liu, J.Y.; Ge, H.M.; Ding, H.; Xu, C.; Zhu, H.L.; Tan, R.X. Chaetominine, a Cytotoxic Alkaloid Produced by Endophytic Chaetomium sp. IFB-E015. Org. Lett. 2006, 8, 5709–5712. [Google Scholar] [CrossRef]
- Sun, J.-H.; Yang, Z.-D.; Zhang, Y.-F. Chemical Constituents and Bioactivity of a Fungal Endophyte from Lamium amplexicaule. Chem. Nat. Compd. 2019, 55, 775–778. [Google Scholar] [CrossRef]
- Afiyatullov, S.S.; Kalinovskii, A.I.; Pivkin, M.V.; Dmitrenok, P.S.; Kuznetsova, T.A. Fumitremorgins from the Marine Isolate of the Fungus Aspergillus fumigatus. Chem. Nat. Compd. 2004, 40, 615–617. [Google Scholar] [CrossRef]
- Çetinel Aksoy, S.; Küçüksolak, M.; Uze, A.; Bedir, E. Benzodiazepine Derivatives from Marine-Derived Streptomyces cacaoi 14CM034. Rec. Nat. Prod. 2021, 15, 602–607. [Google Scholar] [CrossRef]
- Peng, Q.; Cai, J.; Long, J.; Yang, B.; Lin, X.; Wang, J.; Xiao, J.; Liu, Y.; Zhou, X. New Azaphthalide and Phthalide Derivatives from the Marine Coral-Derived Fungus Aspergillus sp. SCSIO41405. Phytochem. Lett. 2021, 43, 94–97. [Google Scholar] [CrossRef]
- Cha, X.-J.; Pu, G.; Xiong, R.-F.; Ma, Y.-Y.; Zhang, G.-H.; Yao, H.; Kong, G.-H.; Bao, M.-F.; Hu, Q.-F.; Li, Y.-K.; et al. Carboline Alkaloids from the Cigar Tobacco-Derived Fungi Aspergillus sp. and Their Anti-TMV Activity. Chem. Nat. Compd. 2023, 59, 881–885. [Google Scholar] [CrossRef]
- Kwon, H.C.; Lee, B.G.; Kim, S.H.; Jung, C.M.; Hong, S.Y.; Han, J.W.; Lee, H.W.; Zee, O.P.; Lee, K.R. Inducible Nitric Oxide Synthase Inhibitors from Melia azedarach var. Japonica. Arch. Pharm. Res. 1999, 22, 410–413. [Google Scholar] [CrossRef]
- Wang, J.; Jiang, M.; Xiong, A.; Zhang, L.; Luo, L.; Liu, Y.; Liu, S.; Ran, Q.; Wu, D.; Xiong, Y.; et al. Integrated Analysis of Single-Cell and Bulk RNA Sequencing Reveals pro-Fibrotic PLA2G7 High Macrophages in Pulmonary Fibrosis. Pharmacol. Res. 2022, 182, 106286. [Google Scholar] [CrossRef]
- Al-Habeeb, F.; Aloufi, N.; Traboulsi, H.; Liu, X.; Nair, P.; Haston, C.; Azuelos, I.; Huang, S.K.; White, E.S.; Gallouzi, I.E.; et al. Human Antigen R Promotes Lung Fibroblast Differentiation to Myofibroblasts and Increases Extracellular Matrix Production. J. Cell Physiol. 2021, 236, 6836–6851. [Google Scholar] [CrossRef]
- Cárdenes, N.; Sembrat, J.; Noda, K.; Lovelace, T.; Álvarez, D.; Bittar, H.E.T.; Philips, B.J.; Nouraie, M.; Benos, P.V.; Sánchez, P.G.; et al. Human Ex Vivo Lung Perfusion: A Novel Model to Study Human Lung Diseases. Sci. Rep. 2021, 11, 490. [Google Scholar] [CrossRef]
Position | δC, Type | δH, Mult (J in Hz) |
---|---|---|
1 | 165.2, C | |
2 | N | |
3 | 72.8, C | |
4 | 166.3, C | |
5 | N | |
6 | 69.0, CH | 4.82, d (14.0) |
7 | 73.7, CH | 4.72, d (14.0) |
7-NH | 5.47, m | |
8 | 130.6, CH | 5.64, d (9.5) |
9 | 123.5, CH | 5.90, m |
10 | 119.3, CH | 6.00, m |
11 | 133.1, C | |
12 | 38.4, CH2 | 2.85, m; 3.12, m |
13 | 71.52, C | |
14 | 14.7, CH3 | 2.19, s |
15 | 28.3, CH3 | 2.99, s |
16 | 12.8, CH3 | 2.20, s |
17 | 63.0, CH2 | 3.73, dd (11.0, 3.0); 4.06, d (11.0) |
17-OH | 5.47, d (3.0) | |
18 | 129.3, CH | 7.31, d (7.0) |
19 | 128.2, CH | 7.25, dd (7.5, 7.0) |
20 | 126.3, CH | 7.20, dd (7.5, 7.5) |
21 | 128.2, CH | 7.25, dd (7.5, 7.0) |
22 | 129.3, CH | 7.31, d (7.0) |
23 | 137.9, C | |
24 | 33.3, CH2 | 2.81, m; 3.12, m |
25 | 53.9, CH | 3.89, dt (11.0, 6.5) |
26 | NH | 8.51, brd (6.5) |
27 | 167.7, C | |
28 | 126.3, C | |
29 | 130.3, CH | 7.66, dd (7.5, 1.5) |
30 | 124.0, CH | 7.20, dd (7.5, 7.5) |
31 | 132.2, CH | 7.50, ddd (8.0, 7.5, 1.5) |
32 | 121.0, CH | 7.10, d (8.0) |
33 | 136.8, C | |
34 | 171.3, C | |
34-OH | 10.41, brs |
Position | δC, Type | δH, Mult (J in Hz) |
---|---|---|
1 | 162.8, C | |
2 | N | |
3 | 151.9, C | |
4 | N | |
5 | 147.7, C | |
6 | 127.0, CH | 7.77, m |
7 | 134.7, C | 7.77, m |
8 | 127.3, C | 7.50, m |
9 | 126.9, C | 8.34, d (8.0) |
10 | 120.6, C | |
11 | 42.0, CH2 | 4.55, t (7.6) |
12 | 33.2, C | 2.71, t (7.6) |
13 | 171.4, C | |
14 | 51.9, OCH3 | 3.54, s |
15 | 119.9, CH | 7.66, d (8.0) |
16 | 119.9, C | 7.22, dd (8.0, 7.5) |
17 | 121.7, C | 7.26, dd (8.0, 7.5) |
18 | 123.5, C | 7.39, d (8.0) |
19 | 135.8, C | |
20 | NH | 9.07, s |
21 | 125.8, C | 7.52, s |
22 | 111.2, C | |
23 | 126.2, C |
Position | 3 | 4 | 5 |
---|---|---|---|
δH, Mult (J in Hz) | |||
1 | 11.94, s | 11.02, s | 10.99, s |
2 | 7.86, s | 7.18, s | 7.14, dd (2.0) |
3 | |||
4a | |||
4 | 8.15, d (7.0) | 7.35, d (8.0) | 7.33, dd (8.0, 7.0) |
5 | 7.17, dd (7.5, 7.0) | 6.93, dd (8.0, 7.0) | 6.91, dd (8.0, 7.0) |
6 | 7.21, dd (7.5, 7.0) | 7.06, dd (8.0, 7.0) | 7.04, dd (8.0, 7.0) |
7 | 7.50, d (7.5) | 7.35, d (8.0) | 7.33, dd (8.0, 7.0) |
7a | |||
8 | 5.12, s | 5.01, s | |
9 | |||
10 | 8.36, s | 7.71, s | 7.73, d (2.0) |
11 | |||
12 | 6.96, dd (8.0, 2.0) | ||
13 | 6.71, d (7.5) | 6.66, d (8.0) | 6.44, d (8.0) |
14 | 7.63, d (7.5) | 7.23, d (8.0) | |
15 | |||
16 | |||
17 | 3.66, s | 3.62, s |
Position | 3 | 4 | 5 |
---|---|---|---|
δC, Type | |||
1 | NH | NH | NH |
2 | 133.2, CH | 123.5, CH | 123.4, CH |
3 | 115.1, C | 112.7, C | 113.2, C |
4a | 126.7, C | 126.2, C | 126.4, C |
4 | 121.4, CH | 118.6, CH | 111.6, CH |
5 | 121.1, CH | 118.7, CH | 118.6, CH |
6 | 122.6, CH | 121.3, CH | 121.2, CH |
7 | 112.0, CH | 111.6, CH | 118.7, CH |
7a | 136.4, C | 136.3, C | 136.3, C |
8 | 188.2, C | 47.1, CH | 47.6, CH |
9 | 126.1, C | 125.0, C | 124.0, C |
10 | 134.0, CH | 130.8, CH | 131.6, CH |
11 | 126.1, C | 110.1, C | 120.1, C |
12 | 153.8, C | 150.5, C | 129.9, CH |
13 | 115.2, CH | 116.4, CH | 115.2, CH |
14 | 132.2, CH | 133.8, CH | 149.3, C |
15 | 171.0, C | 169.8, C | 149.3, C |
16 | NH | 173.4, C | 173.7, C |
17 | 57.0, OCH3 | 51.8, CH3 |
Primer Name | Primer Sequence (5′-3′) |
---|---|
FN1-F | CGGTGGCTGTCAGTCAAAG |
FN1-R | AAACCTCGGCTTCCTCCATAA |
α-SMA-F | GTGTTGCCCCTGAAGAGCAT |
α-SMA-R | GCTGGGACATTGAAAGTCTCA |
COL1A1-F | GTGCGATGACGTGATCTGTGA |
COL1A1-R | CGGTGGTTTCTTGGTCGGT |
GADPH-F | ACCCAGAAGACTGTGGATGG |
GADPH-R | TGCTGTAGCCAAATTCGTTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dai, L.-H.; Zhang, G.-R.; Ou, Y.-H.; Liu, X.-J.; Yao, H.-L.; Hu, W.-H.; Li, H.-J.; Lan, W.-J. Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1. Mar. Drugs 2025, 23, 4. https://doi.org/10.3390/md23010004
Dai L-H, Zhang G-R, Ou Y-H, Liu X-J, Yao H-L, Hu W-H, Li H-J, Lan W-J. Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1. Marine Drugs. 2025; 23(1):4. https://doi.org/10.3390/md23010004
Chicago/Turabian StyleDai, Lai-Hui, Gao-Rong Zhang, Yang-Hui Ou, Xiao-Jing Liu, Hong-Liang Yao, Wen-Hao Hu, Hou-Jin Li, and Wen-Jian Lan. 2025. "Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1" Marine Drugs 23, no. 1: 4. https://doi.org/10.3390/md23010004
APA StyleDai, L.-H., Zhang, G.-R., Ou, Y.-H., Liu, X.-J., Yao, H.-L., Hu, W.-H., Li, H.-J., & Lan, W.-J. (2025). Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1. Marine Drugs, 23(1), 4. https://doi.org/10.3390/md23010004