Next Article in Journal
Compounds of Marine Origin with Possible Applications as Healing Agents
Next Article in Special Issue
Novel Insights into the Nobilamide Family from a Deep-Sea Bacillus: Chemical Diversity, Biosynthesis and Antimicrobial Activity Towards Multidrug-Resistant Bacteria
Previous Article in Journal
Structure Diversity and Properties of Some Bola-like Natural Products
Previous Article in Special Issue
Eremophilane- and Acorane-Type Sesquiterpenes from the Deep-Sea Cold-Seep-Derived Fungus Furcasterigmium furcatum CS-280 Cultured in the Presence of Autoclaved Pseudomonas aeruginosa QDIO-4
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1

1
School of Pharmaceutical Sciences, GBRCE for Functional Molecular Engineering, Sun Yat-sen University, Guangzhou 510006, China
2
Guangxi Collaborative Innovation Center of Modern Sericulture and Silk, Hechi University, Hechi 546300, China
3
Guangdong Key Laboratory of Animal Conservation and Resource Utilization, Guangdong Public Laboratory of Wild Animal Conservation and Utilization Institute of Zoology, Guangdong Academy of Sciences, Guangzhou 510260, China
4
School of Chemistry, Sun Yat-sen University, Guangzhou 510006, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work and should be considered co-first authors.
Mar. Drugs 2025, 23(1), 4; https://doi.org/10.3390/md23010004
Submission received: 7 December 2024 / Revised: 22 December 2024 / Accepted: 23 December 2024 / Published: 25 December 2024
(This article belongs to the Special Issue Bioactive Natural Products from the Deep-Sea-Sourced Microbes)

Abstract

One new gliotoxin derivative fumianthrogliotoxin (1), one new indoquizoline alkaloid N3-(methyl propionate) indoquizoline (2), and three novel indole alkaloids, anthroxyindole (3), (±)-asperfumiindole A (4), and (±)-asperfumiindole B (5), together with 16 known compounds (621), were isolated from the culture of deep-sea derived fungus Aspergillus fumigatus AF1. Their chemical structures and absolute configurations were determined through the analysis of NMR data in combination with electronic circular dichroism (ECD) calculations and other spectroscopic analyses. Compounds 211 and 1321 were evaluated for anti-pulmonary fibrosis activity. Compounds 8 and 13 displayed significant downregulation of the mRNA expression levels of all three molecular markers (COL1A1, α-SMA and FN1), with compound 13 exhibiting the best performance among all the tested compounds.

Graphical Abstract

1. Introduction

The deep-sea environment accounts for 95% of the ocean, which covers 71% of the Earth’s surface area. Thus, the deep-sea is an important part of the marine system. Marine fungi are important components of marine microorganisms and have been recognized as important sources of structurally novel and biologically active metabolites [1,2]. Compared with other source microorganisms, deep-sea-derived fungi possess unique genetic backgrounds and metabolic pathways due to their living environments characterized by high salinity, high pressure, and low temperature [3]. Therefore, deep-sea-derived fungi have a greater potential to produce compounds with distinctive chemical structures and valuable pharmaceutical activities [4]. The investigation of the secondary metabolites from deep-sea-derived fungi may lead to the discovery of structurally novel compounds with pharmaceutical activity.
The genus Aspergillus is widely distributed and has drawn attention because of significant biological activities and novel metabolite structures [5,6,7]. It has been reported that alkaloids are also among the major classes of metabolites produced by Aspergillus species, possessing a variety of pharmaceutical activities, such as anti-inflammatory, antimicrobial, and cytotoxic properties [6,7,8]. The alkaloids from marine-derived fungi of Aspergillus are classified into diketopiperazine, quinazoline, quinoline, and indole alkaloids based on their structural features [7,9]. Fumiquinazoline is a type of indole quinazoline alkaloid featuring a pyrazino [2,1-b] quinazoline-3,6-dione core binding with an indole system [10] and it was first obtained from the marine-derived fungus Aspergillus fumigatus [11,12,13]. Indole alkaloids contain an indole nucleus, which is considered a “privileged structure” in pharmaceutical activities. It plays an important role in antimicrobial treatment [14,15,16]. Thus, this type of alkaloids has attracted attention among researchers.
Pulmonary fibrosis (PF), a chronic, progressive, and predominantly fatal disease, has become a significant health concern in the post-pandemic recovery period following COVID-19 [17]. Despite the multidisciplinary approaches employed in the treatment of PF, no definitive therapy for post-inflammatory pulmonary fibrosis following COVID-19 infection has been identified [18]. Studies have shown that indole alkaloids can moderate the TGF-β signaling pathway and exhibit excellent anti-pulmonary fibrosis activity, making them as potential lead drugs for the treatment of pulmonary fibrosis [19].
Biogenetically, alkaloids are derived from amino acids, which undergo through various biosynthetic processes to form structurally diverse compounds [20]. Our previous studies demonstrated the efficacy of an amino acid-directed strategy in promoting the accumulation of indole alkaloids in fungi [21,22]. As part of our ongoing research on bioactive alkaloids of the genus Aspergillus, an amino acid-directed strategy was employed to culture Aspergillus fumigatus AF1, a fungal strain collected at a depth of 3300 m in the northern basin of the South China Sea, by adding seven types of amino acids. Herein, the isolation, structural identification, and anti-pulmonary fibrosis activity of compounds 121 (Figure 1) are described.

2. Results and Discussion

2.1. Structural Elucidation

Compound 1 was isolated as a pale green solid. The molecular formula was revealed to be C31H34N4O6S2 with HR-ESI-MS at m/z 645.1813 [M + Na]+ (calcd for C31H34N4O6S2Na+, 645.1812), indicating 17 degrees of unsaturation. The NMR spectral data (Table 1, Figures S2–S8) revealed the presence of a monosubstituted benzene ring [δH 7.31 (1H, d, J = 7.0 Hz, H-18), 7.25 (1H, dd, J = 7.5, 7.0 Hz, H-19), 7.20 (1H, dd, J = 7.5, 7.5 Hz, H-20), 7.25 (1H, dd, J = 7.5, 7.0 Hz, H-21), 7.31 (1H, d, J = 7.0 Hz, H-22); δC 129.3 (C-18), 128.2 (C-19), 126.3 (C-20), 128.2 (C-21), 129.3 (C-22), and 137.9 (C-23)], a 1,2-disubstituted benzene ring [δH 7.66 (1H, dd, J = 7.5, 1.5 Hz, H-29), 7.20, (1H, dd, J = 7.5, 7.5 Hz, H-30), 7.50 (1H, ddd, J = 8.0, 7.5, 1.5 Hz, H-31), 7.10 (1H, d, J = 8.0 Hz, H-32); δC 126.3 (C-28), 130.3 (C-29), 124.0 (C-30), 132.2 (C-31), 121.0 (C-32), 136.8 (C-33)], two olefinic bonds [δH 5.64 (1H, d, J = 9.5 Hz, H-8), δH 5.90 (1H, m, H-9), δH 6.00 (1H, m, H-10); δC 130.6 (C-8), δC 123.5 (C-9), δC 119.3 (C-10), δC 133.1 (C-11)], three methyl groups [δH 2.19 (3H, s, H-14), 2.99 (3H, s, H-15), 2.20 (3H, s, H-16); δC 14.7 (C-14), 28.3 (C-15), 12.8 (C-16)], three methylene groups [δH 2.85, 3.12 (2H, m, H-12), 3.73 (1H, dd, J = 11.0, 3.0 Hz, H-17), 4.06 (1H, d, J = 11.0 Hz, H-17), 2.81, 3.12 (2H, m, H-24); δC 38.4 (C-12), 63.0 (C-17), 33.3 (C-24)], four carbonyl groups [δC 165.2 (C-1), 166.3 (C-4), 167.7, (C-27), 171.3 (C-34)], and two hydroxyl groups [δH 5.47 (1H, d, J = 3.0 Hz, 17-OH), 10.41 (1H, brs, 34-OH)]. Comparing the spectroscopic data (1H and 13C NMR, DEPT 135, 1H−1H COSY, HSQC, HMBC, and HR-ESI-MS) with the published data of the compounds bisdethiobis (methylthio) gliotoxin and dehydroxybisdethiobis (methylthio) gliotoxin [23,24], compound 1 has a similar fragment structure to bisdethiobis (methylthio) gliotoxin, except that the hydroxyl group at C-6 is replaced by an imide group, according to the molecular formula of compound 1. The 1H−1H COSY and HMBC correlations also proved that the fragment of bisdethiobis (methylthio) gliotoxin was connected to the imide group (7-NH) (Figure 2). Furthermore, the 1H−1H COSY correlations between H-24 (δH 2.81, m; δH 3.12, m) and H-25 (1H, δH 3.89, dt, J = 11.0, 6.5 Hz), H-25 and the active hydrogen H-26 (δH 8.51, 1H, brd, J = 6.5 Hz), along with the HMBC correlations from H-24 to C-18 (δC 129.3)/C-23 (δC 137.9)/C-34 (δC 171.3), H-25 to C-34 (δC 171.3)/C-23 (δC 137.9), and from 34-OH (δH 10.41, brs) to C-34 (δC 171.3)/C-25 (δC 53.9), indicated that the monosubstituted benzene ring was linked to –CH2-CH(C=O)-NH– through C-23 and composed the phenylalanine fragment (Figure 2). The 1H−1H COSY correlations of H-29/H-30/H-31/H-32 were observed. The HMBC correlations from H-29 to C-27 (δC 167.7)/C-33 (δC 136.8), from H-32 to C-27 (δC 167.7)/C-28 (δC 126.3), and from H-25 to C-27 (δC 167.7), indicated that the 1,2-disubstituted benzene ring was linked to the –CH2-CH(C=O)-NH– of the phenylalanine fragment though carbonyl C-27 (δC 167.7) (Figure 2). Finally, the two main sections were linked by 7-NH (δH 5.47, m) with the HMBC signals from 7-NH to C-6 (δC 69.0)/C-7 (δC 73.7)/C-8 (δC 130.6) and H-7 to C-31 (δC 132.2) (Figure 2). Thus, the planar structure of 1 was established as shown in Figure 1.
The relative configuration of 1 was deduced according to the NOESY experiment. Initially, the NOESY correlations between OH-34 (1H, δH 10.41, brs) and NH-7/Hb-17 and between NH-7 and Hb-17 suggested that OH-34, NH-7, and CH2OH shared the same orientation. Additionally, the relatively large coupling constants of H-6/H-7 (3JH-6/H-7 = 14.0 Hz) indicated that they are in opposite directions. Therefore, the four possible configurations of 1 were (3R, 6S, 7S, 13R, 25S)-1, (3S, 6R, 7R, 13R, 25R)-1, (3S, 6R, 7R, 13S, 25R)-1, and (3R, 6S, 7S, 13S, 25S)-1. According to the comparisons of the experimental and calculated ECD curves of the four possible configurations, the experimental results matched well with those calculated for (3R, 6S, 7S, 13R, 25S)-1 and (3S, 6R, 7R, 13R, 25R)-1 (Figure 3). In addition, the calculated optical rotation data of the configurations (3R, 6S, 7S, 13R, 25S)-1 and (3S, 6R, 7R, 13R, 25R)-1 were +228.195 and −577.239 (Table S1). Furthermore, the experimental optical rotation of compound 1 was +118.15, which is in better agreement with the calculated data of (3R, 6S, 7S, 13R, 25S)-1. Therefore, the absolute configuration of 1 was defined as (3R, 6S, 7S, 13R, 25S)-1 according to the above analysis. Herein, compound 1 was identified and named fumianthrogliotoxin.
Compound 2 was obtained as a pale green particulate. Its molecular formula was determined to be C20H17N3O3 based on a deprotonated molecular ion peak at m/z 346.1196 [M − H] (calcd for C20H16N3O3, 346.1197) in HR-ESI-MS with 14 degrees of unsaturation. The 1H NMR spectrum (Table 2) indicated the presence of two 1,2-disubstituted benzene rings [δH 7.66 (1H, d, J = 8.0 Hz, H-15), 7.22 (1H, dd, J = 8.0, 7.5 Hz, H-16), 7.26 (1H, dd, J = 8.0, 7.5 Hz, H-17), 7.39 (1H, d, J = 8.0 Hz, H-18); δH 7.77 (2H, m, H-6, H-7), 7.50 (1H, m, H-8), 8.34 (1H, d, J = 8.0 Hz, H-9)], one olefinic bond (δH 7.52, 1H, s, H-21), and one methoxy (δH 3.54, s, 3H). The 13C NMR data (Table 2) and HSQC data displayed signals for two carbonyls [δC 162.8 (C-1), 171.4 (C-13)], two disubstituted benzene rings [δC 147.7 (C-5), 127.0 (C-6), 134.7 (C-7), 127.3 (C-8), 126.9 (C-9), 120.6 (C-10); δC 119.9 (C-15), 119.9 (C-16), 121.7 (C-17), 123.5 (C-18), 135.8 (C-19), 126.2 (C-23)], one methoxy (δC 51.9), and one olefinic [δC 125.8 (C-21), 111.2 (C-22)]. The following data supported the presence of an indole residue: eight characteristic aromatic/olefinic carbons (C-15−C-23); the 1H−1H COSY correlations between δH 7.66 (1H, d, J = 8.0 Hz, H-15) and δH 7.22 (1H, dd, J = 8.0, 7.5 Hz, H-16), δH 7.26 (1H, dd, J = 8.0, 7.5 Hz, H-17), and δH 7.39 (1H, d, J = 8.0 Hz, H-18); HMBC correlations from δH 7.66 (H-15) to δC 121.7 (C-17)/δC 135.8 (C-19)/δC 111.2 (C-22), from δH 7.39 (H-18) to δC 119.9 (C-16)/δC 126.2 (C-23), and from δH 7.52 (1H, H-21) to δC 135.8 (C-19)/δC 111.2 (C-22); and the NH signal (δH 9.07, 20-NH). Additionally, the 1H−1H COSY correlation of δH 4.55 (2H, t, J = 7.6 Hz, H-11) and δH 2.71 (2H, t, J = 7.6 Hz, H-12) and the HMBC correlations from δH 4.55 (H-11) to δC 33.2 (C-12) and δC 171.4 (C-13), from δH 2.71 (H-12) to δC 42.0 (C-11) and δC 171.4 (C-13), and from δH 3.54 (3H, s, OCH3-14) to δC 171.4 (C-13), indicated the presence of the fragment –CH2-CH2 (CO)-OCH3. The 1H−1H COSY correlations of δH 7.77 (1H, m, H-7)/7.50 (1H, m, H-8) and 7.50 (H-8)/8.34 (1H, d, J = 8.0 Hz, H-9) were observed. Combined with the molecular formula and unsaturation, the HMBC correlations from δH 7.77 (H-7) to δC 147.7 (C-5), from δH 7.50 (H-8) to δC 127.0 (C-6), from δH 7.77 (1H, m, H-6) to δC 120.6 (C-10), and from δH 8.34 (1H, d, J = 8.0 Hz, H-9) to δC 162.8 (C-1)/δC 147.7 (C-5) indicated that the presence of the fragment quinazolin-4(3H)-one [8]. In addition, the HMBC correlations from δH 4.55 (1H, t, J = 7.6 Hz, H-11) to δC 162.8 (C-1)/δC 151.9 (C-3) were observed. Therefore, the two fragments of -CH2-CH2(CO)-OCH3 and quinazolin-4(3H)-one are connected by a nitrogen atom and comprise methyl 3-(4-oxoquinazolin-3(4H)-yl) propanoate [8]. According to the molecular formula and the unsaturation of compound 2, the fragment of methyl 3-(4-oxoquinazolin-3(4H)-yl) propanoate is linked to the indole residue through C-3 (δC 151.9) and C-22 (δC 111.2). Thus, the structure of 2 was established as shown in Figure 1 and named N3-(methyl propionate) indoquizoline.
Compound 3 was isolated as a light-brown solid. The HR-ESI-MS analysis of 3 showed a molecular ion at m/z 303.0738 [M + Na]+ (calcd for C16H12N2O3Na+, 303.0740), which indicated 12 degrees of unsaturation. The 1H NMR data (Table 3) indicated the presence of one 1,2-disubstituted benzene ring [δH 8.15 (1H, d, J = 7.0 Hz, H-4), 7.17 (1H, dd, J = 7.5, 7.0 Hz, H-5), 7.21 (1H, dd, J = 7.5, 7.0 Hz, H-6), 7.50 (1H, d, J = 7.5 Hz, H-7)] and one 1,3,4-trisubstituted benzene ring [δH 8.36 (1H, s, H-10), 6.71 (1H, d, J = 7.5, Hz, H-13), 7.63 (1H, d, J = 7.5 Hz, H-14)]. The 13C NMR data (Table 4) and HMBC data displayed signals for two carbonyls [δC 188.2 (C-8), 171.0 (C-15)], one disubstituted benzene ring [δC 126.7 (C-4a), 121.4 (C-4), 121.1 (C-5), 122.6 (C-6), 112.0 (C-7), 136.4 (C-7a)], one trisubstituted benzene ring [δC 126.1 (C-9), 134.0 (C-10), 126.1 (C-11), 153.8 (C-12), 115.2 (C-13), 132.2 (C-14)], and one olefinic [δC 133.2 (C-2), 115.1 (C-3)]. The following indicated the presence of a 3-substituted indole group: eight characteristic aromatic/olefinic carbons (δC 133.2, 115.1, 126.7, 121.4, 121.1, 122.6, 112.0, 136.4); the 1H−1H COSY correlations of δH 8.15 (1H, d, J = 7.0 Hz, H-4)/7.17 (1H, dd, J = 7.5, 7.0 Hz, H-5), 7.21 (1H, dd, J = 7.5, 7.0 Hz, H-6)/7.50 (1H, d, J = 7.5 Hz, H-7), and 7.86 (1H, s, H-2)/11.94 (NH-1, s); and the HMBC correlations from H-5 to δC 126.7 (C-4a)/δC 136.4 (C-7a), δH 7.21 (H-6) to δC 136.4 (C-7a)/δC 121.4 (C-4), from δH 7.86 (H-2) to δC 115.1 (C-3)/δC 126.7 (C-4a)/δC 136.4 (C-7a), and from δH 11.94 (NH-1, s) to δC 115.1 (C-3)/δC 126.7 (C-4a)/δC 136.4 (C-7a). The HMBC correlations from δH 8.15 (H-4)/δH 7.86 (H-2) to δC 188.2 (C-8), revealed that the carbonyl group is linked to a 3-substituted indole group through C-3 (δC 115.1). In addition, the presence of the fragment anthranilic acid residue was deduced by according to the 1H−1H COSY correlations of δH 6.71 (1H, d, J = 7.5 Hz, H-13)/7.63 (1H, d, J = 7.5 Hz, H-14), and the HMBC correlations from δH 6.71 (1H, d, J = 7.5 Hz, H-13) to δC 126.1 (C-9)/δC 126.1 (C-11), from δH 7.63 (1H, d, J = 7.5 Hz, H-14) to δC 134.0 (C-10)/δC 153.8 (C-12), and from δH 8.36 (H-10) to δC 153.8 (C-12)/δC 132.2 (C-14)/δC 171.0 (C-15), along with the molecular formula and the unsaturation. Finally, the HMBC correlations from δH 7.86 (H-2)/δH 8.15 (H-4)/δH 8.36 (H-10)/δH 7.63 (H-14) to C-8 (δC 188.2) revealed that the two fragments are connected by the carbonyl group (δC 188.2). Thus, the structure of 3 was established as shown in Figure 1 and named anthroxyindole.
Compound 4 was isolated as a dark-brown solid with the molecular formula of C18H16N2O4, based on the HR-ESI-MS ion at m/z 347.1002 [M + Na]+ (calcd for C18H16N2O4Na+, 347.1002). The 1H NMR data (Table 3) indicated the presence of one 1,2-disubstituted benzene ring [δH 7.35 (1H, d, J = 8.0 Hz, H-4), 6.93 (1H, dd, J = 8.0, 7.0 Hz, H-5), 7.06 (1H, dd, J = 8.0, 7.0 Hz, H-6), 7.35 (1H, d, J = 8.0 Hz, H-7)], one 1,3,4-trisubstituted benzene ring [δH 7.71 (1H, s, H-10), 6.66 (1H, d, J = 8.0 Hz, H-13), 7.23 (1H, d, J = 8.0 Hz, H-14)], one methoxy (δH 3.66, s, 3H, OCH3-17), and one methine (δH 5.12, s, 1H, H-8). The 13C NMR (Table 4), DEPT 90, and HSQC data displayed signals for two carbonyls [δC 173.4 (C-16), 169.8 (C-15)], one disubstituted benzene ring [δC 126.2 (C-4a), 118.6 (C-4), 118.7 (C-5), 121.3 (C-6), 111.6 (C-7), 136.3 (C-7a)], one trisubstituted benzene ring [δC 125.0 (C-9), 130.8 (C-10), 110.1 (C-11), 150.5 (C-12), 116.4 (C-13), 133.8 (C-14)], one olefinic [δC 123.5 (C-2), 112.7 (C-3)], one methoxy (δC 57.0, OCH3-17), and one methine group (δC 47.1, C-8). The HMBC correlations from δH 3.66 (3H, s, OCH3-17) to δC 173.4 (C-16), indicated the presence of the fragment–COOCH3 (Figure 2). Based on the analysis of the NMR data mentioned above and the molecular formula, compound 4 has the same skeleton comprising a 3-substituted indole group and anthranilic acid residues as compound 3. Moreover, the key correlations from δH 5.12 (1H, s, H-8) to δC 123.5 (C-2)/δC 112.7 (C-3)/δC 125.0 (C-9)/δC 130.8 (C-10)/δC 173.4 (C-16) support that the three fragments are linked by CH (δC 47.1, C-8) (Figure 2). Thus, the planar structure of 4 is shown in Figure 1, where it can be seen that there is a chiral carbon at C-8; however, the experimental CD spectra of compound 4 did not indicate any apparent Cotton effects (Figure 4), and its optical rotation could barely be detected, indicating that 4 might be a racemic mixture. Unfortunately, the enantiomers were not isolated due to the limited sample mass. Therefore, compound 4 was identified and named (±)-asperfumiindole A.
Compound 5 was obtained as a dark-brown solid. The molecular formula was established as C18H16N2O4 based on the HR-ESI-MS ion at m/z 347.1002 [M + Na]+ (calculated for C18H16N2O4Na+, 347.1002). The comparison of the NMR signals of 5 with those of 4 indicated that 5 was an analogue of 4, with the major differences existing in the 1H and 13C NMR data of the benzene ring between 5 and 4. In the 1H and 13C NMR spectra (Table 3 and Table 4), the chemical shifts of the aromatic ring at δH 7.23 (1H, d, J = 8.0, H-14), 6.66 (1H, d, J = 8.0, H-13); and δC 125.0, 130.8, 110.1, 150.5, 116.4, 133.8 in 4 were changed to δH 6.96 (1H, dd, J = 8.0, 2.0 Hz, H-12), 6.44 (1H, d, J = 8.0, H-13); and δC 124.0 (C-9), 131.6 (C-10), 120.1 (C-11), 129.9 (C-12), 115.2 (C-13), 149.3 (C-14) in 5, suggesting that the substituent group is located in a different position to compose a 1,2,4-trisubstituent in 5. The analysis of the 1H-1H COSY correlations of δH 6.96 (1H, dd, J = 8.0, 2.0 Hz, H-12)/6.44 (1H, d, J = 8.0 Hz, H-13) and the HMBC correlations from δH 6.96 (H-12) to δC 131.6 (C-10)/δC 149.3 (C-14), from δH 6.44 (H-13) to δC 124.0 (C-9)/δC 120.1 (C-11), and from δH 7.73 (1H, d, J = 2.0 Hz, H-10) to δC 129.9 (C-12)/δC 149.3 (C-14)/δC 149.3 (C-15) (Figure 2) also proved the fragment para-aminobenzoic acid. Therefore, compound 5 was deduced to have the same skeleton as 4, except that the NH2 substituent group is linked to the position of the benzene ring at C-14 (δC 149.3) instead of C-12 (δC 129.9) in 5. Thus, the structure of 5 was determined as shown in Figure 1, where it can be seen that there is a chiral carbon at C-8; however, the experimental CD spectra of compound 5 did not display any apparent Cotton effect (Figure 5), and its optical rotation could barely be detected, indicating that 5 might be a racemic mixture. Unfortunately, the enantiomers were not isolated due to the sample mass being too low. Thus, compound 5 was identified and named (±)-asperfumiindole B.
The chemical structures of the known compounds 621 were elucidated as fumiquinazoline C (6) [12], fumiquinazoline D (7) [25], spiroquinazoline (8) [26], fumiquinazoline J (9) [27], alantrypinone (10) [28], 3-(4-oxoquinazolin-3-yl)spiro[1H-indole-3,5-oxolane]-2, 20-dione (11) [9], fumigatoside F (12) [29], tryptoquivaline O (13) [30], fumitremorgin C (14) [27], cyclotryprostatin B (15) [31], cyclotryprostatin A (16) [32], cycloanthranilylproline (17) [33], benzodiazepinedione (18) [12], perlolyrine (19) [34], 1-methoxycarbonyl-β-carboline (20) [35], and 4-methoxy-1-vinyl-β-carboline (21) [36]. All of these compounds were identified by comparing their 1H and 13C NMR data (Figures S45–S76) with those reported in the literature.

2.2. Anti-Pulmonary Fibrosis Activity

Compounds 211 and 1321 were tested for their anti-pulmonary fibrosis activity in A549 cells using qRT-PCR. FN1, COL1A1, and α-SMA are crucial molecular markers of pulmonary fibrosis [37]. FN1 contributes to the formation of the extracellular matrix formation, COL1A1 is a key component of type I collagen, and α-SMA serves as a marker of myofibroblast activity. The abnormal expression of these markers often indicates fibrosis progression, which is closely associated with tissue stiffening and functional impairment [38]. Bleomycin is an antitumor antibiotic widely used to induce pulmonary fibrosis in animal models [39]. It causes direct lung tissue damage, triggering inflammatory responses and fibroblast activation, which ultimately leads to excessive extracellular matrix deposition, such as collagen, and fibrosis formation. The qRT-PCR results showed that the mRNA expression levels of COL1A1, α-SMA, and FN1 were significantly upregulated in the bleomycin-treated group, indicating high expression of the extracellular matrix proteins FN1 and COL1A1 and the myofibroblast marker α-SMA. These findings are closely associated with the fibroblast activation, excessive extracellular matrix deposition, and tissue stiffening observed in pulmonary fibrosis. In our study, compounds 8 and 13 showed significant downregulation of the mRNA expression levels of all three molecular markers (COL1A1, α-SMA, and FN1), with compound 13 exhibiting the best performance among all the tested compounds (Figure 6).

3. Materials and Methods

3.1. General Experimental Procedures

An Anton Paar MCP500 polarimeter was used to measure optical rotations. ECD spectra were acquired with a JASCO J-810 circular dichroism spectrometer (Applied Photophysics Ltd., Leatherhead, UK). UV and IR spectra were obtained using a Shimadzu UV-vis-NIR spectrophotometer and a Bruker Tensor-27 spectrophotometer. 1D and 2D NMR spectra were recorded on Bruker Avance IIIT 500HD and Bruker Avance II 400 spectrometers (Bruker Bio Spin AG, Industriestrasse 26, Fällanden, Switzerland). The chemical shifts relative to the residual solvent signals were as follows: CDCl3: δH 7.260 and δC 77.00; DMSO-d6: δH 2.500, and δC 39.52. HR-ESI-MS data were acquired using Thermo DSQ EI low-resolution and Thermo MAT95XP EI high-resolution mass spectrometers (Thermo Fisher Scientific Inc., Waltham, MA, USA). Preparative HPLC was performed by using a Shimadzu LC-20AT HPLC pump combined with an SPD-20A dual λ absorbance detector and an ODS column (250 × 20 mm; Shimadzu Corporation, Nakagyo-ku, Kyoto, Japan). Column chromatography was performed by using silica gel (SiO2, 200–300 mesh; Qingdao Marine Chemical Factory, Qingdao, China). Sephadex LH-20 (GE Healthcare, Chicago, IL, USA) was also utilized for column chromatography.

3.2. Fungal Material

The fungal strain Aspergillus fumigatus AF1, which had been separated from 3300 m deep sea water in the northern basin of the South China Sea, was stored in a 15% (v/v) glycerol aqueous solution at −80 °C. A voucher specimen was deposited in the School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou, China.

3.3. Fermentation, Extraction, and Isolation

To stimulate the secondary metabolism in the A. fumigatus AF1, we employed the amino acid-directed strategy [19]. The culture with fungal mycelia was statically incubated at 28 °C for 30 days in 180 Erlenmeyer flasks (1000 mL), each containing 400 mL of sterilized GPY medium supplemented with amino acids (L-Trp 2 g/L, L-Ser 2 g/L, L-Thr 2 g/L, L-Lys 2 g/L, L-Phe 2 g/L, L-Val 2 g/L, and D,L-Met 2 g/L) and artificial sea salt (20 g/L) at pH = 7. After incubation, the fermentation liquid and mycelia were separated by with cheesecloth and then extracted five times with EtOAc and MeOH, respectively. The crude extracts of fermentation liquid and mycelia were concentrated using rotary evaporation to obtain 50 g and 20 g of extracts, respectively.
The EtOAc extract (50 g) of fermentation was chromatographed on a silica gel column with a gradient of petroleum ether-EtOAc-MeOH (10:0:0–0:10:0–0:0:10) to yield 7 fractions (Fr.1–Fr.7). Fr.3 was fractionated to obtain six subfractions (Fr.3.1–Fr.3.6) using the silica gel chromatography column with a gradient of petroleum ether-EtOAc (10:0–0:10). Compounds 1 (16 mg), 3 (8 mg), 4 (6 mg), and 16 (13 mg) were purified from Fr.3.2 by performing preparative HPLC with MeOH-H2O (68:32, v/v). Fr.3.3 was chromatographed on Sephadex LH-20 (MeOH) to obtain 10 subfractions (Fr.3.3.1–Fr.3.3.10), and Fr.3.3.8 was further purified by performing preparative HPLC with MeOH- H2O (70:30, v/v) to yield 9 (10 mg). Compounds 2 (6 mg) and 12 (2 mg) were separated from Fr.3.4 by performing preparative reverse-phase HPLC with MeOH-H2O (68:32, v/v), and compound 5 (6 mg) was obtained from s Fr.3.6 by performing preparative HPLC with MeOH-H2O (72:28, v/v).
Subsequently, Fr.4 was fractionated into seven subfractions (Fr.4.1–Fr.4.7) on Sephadex LH-20 (MeOH). Fr.4.1 was repeatedly fractionated by performing HPLC with MeOH-H2O (76:24, v/v) to afford compound 15 (4 mg). Compounds 14 (10 mg) and 8 (3 mg) were isolated from Fr.4.2 and Fr.4.3, respectively, by performing HPLC with MeOH-H2O (70:30, v/v). Fr.4.4 was further purified by performing preparative HPLC to yield compound 17 (5 mg) with MeOH-H2O (58:42, v/v). Compounds 11 (3 mg) and 20 (2 mg) were isolated from Fr.4.5 using a preparative HPLC column with MeOH-H2O (58:42, v/v). Fr.5 was purified into six subfractions (Fr.5.1–Fr.5.6) using a silica gel column with a step gradient elution of petroleum ether-EtOAc (10:0–0:10). Compounds 10 (3 mg) and 3 (8 mg) were obtained from Fr.5.3 (MeOH: H2O, 60:40, v/v) and Fr.5.5 (MeOH: H2O, 72:28, v/v) using reverse-phase HPLC, respectively. Fr.6 was separated into six subfractions (Fr.6.1–Fr.6.6) using Sephadex LH-20 (MeOH). Compound 18 (8 mg) was separately purified by preparative HPLC (MeOH: H2O, 76:24, v/v) from Fr.6.1. Fr.6.4 was purified by reverse-phase HPLC with an eluent of MeOH-H2O (64:36, v/v) to yield compound 13 (5 mg).
The MeOH extract (20 g) from the mycelia was chromatographed on a silica gel column with a stepwise gradient of petroleum ether-EtOAc (100:0–0:100) and EtOAc-MeOH (100:0–0:100) to obtain 5 fractions (Fr.1–Fr.5). Fr.2 was treated with Sephadex LH-20 (MeOH) and HPLC successively to obtain compounds 6 (10 mg; MeOH: H2O, 72:28, v/v) and 7 (3 mg; MeOH: H2O, 70:30, v/v). Fr.3 was separated using a silica gel column with step gradients of petroleum ether-EtOAc (10:0–0:10) and EtOAc-MeOH (10:0–0:10) to afford 6 subfractions (Fr.3.1–Fr.3.6). Moreover, compound 19 (2 mg) was purified from Fr.3.4 using Sephadex LH-20 (MeOH).
Fumianthrogliotoxin (1): pale green solid; [α ] D 25 + 118.15 (c 0.2, MeOH); UV (MeOH) λmax (log ε) 213 (4.77) nm; IR υmax 3377, 2975, 2924, 1642, 1422, 1386, 1260, 1231, 1193, 1085, 1050, 960, 880 cm−1; for 1H and 13C NMR data, see Table 1; HR-ESI-MS m/z 645.1813 [M + Na]+ (calcd for C31H34N4O6S2Na+, 645.1812).
N3-(methyl propionate) indoquizoline (2): pale green particulate; UV (MeOH) λmax (log ε) 310 (3.56), 278 (3.59), 217 (4.15) nm; IR υmax 3360, 2975, 1731, 1672, 1558, 1439, 1375, 1242, 1163, 1089, 1050, 881 cm−1; for 1H and 13C NMR data, see Table 2; HR-ESI-MS m/z 346.1196 [M − H] (calcd for C20H16N3O3, 346.1197).
Anthroxyindole (3): light-brown solid; UV (MeOH) λmax (log ε) 334 (3.84), 248 (3.77), 211 (4.21) nm; IR υmax 3348, 1620, 1517, 1431, 1375, 1208, 1050 cm−1; for 1H NMR data, see Table 3, and for 13C NMR data, see Table 4; HR-ESI-MS m/z 303.0738 [M + Na]+ (calcd for C16H12N2O3Na+, 303.0740).
(±)-Asperfumiindole A (4): dark-brown solid; [α ] D 25 + 0.197 (c 0.2, MeOH); UV (MeOH) λmax (log ε) 338 (3.06), 257 (3.67), 220 (4.25) nm; IR υmax 3366, 2975, 1724, 1677, 1624, 1584, 1563, 1497, 1457, 1434, 1377, 1339, 1299, 1233, 1193, 1161, 1126, 1091, 1047, 1022, 998, 879, 824 cm−1; for 1H NMR data, see Table 3, and for 13C NMR data, see Table 4; HR-ESI-MS m/z 347.1002 [M + Na]+ (calcd for C18H12N2O4Na+, 347.1002).
(±)-Asperfumiindole B (5): dark-brown solid; [α ] D 25 + 0.495 (c 0.17, MeOH); UV (MeOH) λmax (log ε) 328 (4.08), 256 (4.67), 220 (5.22) nm; IR υmax 3359, 2974, 2924, 2256, 1724, 1621, 1574, 1536, 1457, 1432, 1375, 1339, 1243, 1199, 1161, 1126, 1091, 1048, 1024, 1008, 930, 880, 824 cm−1; for 1H NMR data, see Table 3, and for 13C NMR data, see Table 4; HR-ESI-MS m/z 347.1002 [M + Na]+ (calcd for C18H12N2O4Na+, 347.1002).

3.4. Anti-Pulmonary Fibrosis Activity Analysis

3.4.1. Cell Culture and Treatment

The cell lines used in the manuscript were obtained from Wuhan Pricella Biotechnology Co., Ltd. A549 cells were cultured in RPMI-1640 medium containing 10% FBS, 100 U/mL penicillin, and 100 mg/L streptomycin at 37 °C and 5% CO2. The cells were pre-treated with the compound at a concentration of 50 μM for 2 h, followed by treatment with bleomycin at a final concentration of 0.02 U/mL for an additional 48 h.

3.4.2. Quantitative Real-Time PCR (qRT-PCR) Assay

For the mRNA-level analysis of the cultured cells, total RNA was extracted by using the FastPure Cell/Tissue Total RNA Isolation Kit V2 (Nanjing Vazyme Biotechnology Co., Ltd., Nanjing, China). Complementary DNA (cDNA) was synthesized by using HiScript II qRT SuperMix (Nanjing Vazyme Biotechnology Co., Ltd., Nanjing, China). qRT-PCR was performed by using a CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and ChamQ Universal SYBR qPCR Master Mix (QIAGEN, Hilden, Germany) with cDNA as the template. Gene expression fold changes were calculated by using the 2TCM method. The primer pairs used in this study are listed in Table 5.

4. Conclusions

In summary, a total of 21 alkaloid derivatives were isolated from the fermentation of the deep-sea fungus Aspergillus fumigatus AF1, including five undescribed indole alkaloid derivatives, fumianthrogliotoxin (1), N3-(methyl propionate) indoquizoline (2), anthroxyindole (3), (±)- asperfumiindole A (4), and (±)- asperfumiindole B (5). Compounds 211 and 1321 were evaluated for their anti-pulmonary fibrosis activity in A549 cells. Among all the tested samples, compounds 8 and 13 exhibited better performance, as they significantly downregulated the mRNA expression levels of all three molecular markers (COL1A1, α-SMA, and FN1). This study provides evidence that the employed to amino acid-directed strategy can improve the structural diversity of indole alkaloids in deep-sea-derived fungi. Moreover, indole alkaloids 8 and 13 demonstrated significant downregulation of mRNA expression levels of pulmonary fibrosis markers, highlighting the potential of indole alkaloids as lead compounds in the treatment of pulmonary fibrosis. With the ultimate aim of finding more bioactive indole alkaloids effective against pulmonary fibrosis, further exploration of the amino acid-directed strategy is essential.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/md23010004/s1, Table S1: Energy analysis and calculated optical rotations of different configurations for 1; Figures S1–S76: Spectrum of compounds.

Author Contributions

Investigation, data analysis, and writing—original draft: L.-H.D.; Investigation, data analysis, and writing—original draft: G.-R.Z.; Investigation, data analysis, and writing—original draft: Y.-H.O.; Investigation and data analysis: X.-J.L.; Methodology, validation, funding acquisition, resources: H.-L.Y.; Writing—review and editing, funding acquisition and resources: W.-H.H.; Conceptualization, methodology, validation, writing—review and editing, supervision and resources: H.-J.L.; Conceptualization, methodology, validation, writing—review and editing, supervision, funding acquisition and resources: W.-J.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Science Foundation of China (No. 81872795), the Key-Area Research and Development Program of Guangdong Province (Nos. 2020B1111110003, 2022B1111050003), Southern Marine Science and Engineering Guangdong Laboratory (Zhuhai) (SML2003SP236), Guangdong Basic and Applied Basic Research Foundation (No. 2021A1515011761), and Guangdong Academy of Sciences Program (Nos. 2022GDASZH-2022010110, 2022GDASZH-2022020402-01).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data are contained within the article or Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kong, F.-D.; Zhang, S.-L.; Zhou, S.-Q.; Ma, Q.-Y.; Xie, Q.-Y.; Chen, J.-P.; Li, J.-H.; Zhou, L.-M.; Yuan, J.-Z.; Hu, Z.; et al. Quinazoline-Containing Indole Alkaloids from the Marine-Derived Fungus Aspergillus sp. HNMF114. J. Nat. Prod. 2019, 82, 3456–3463. [Google Scholar] [CrossRef] [PubMed]
  2. Liao, L.; You, M.; Chung, B.K.; Oh, D.-C.; Oh, K.-B.; Shin, J. Alkaloidal Metabolites from a Marine-Derived Aspergillus sp. Fungus. J. Nat. Prod. 2015, 78, 349–354. [Google Scholar] [CrossRef] [PubMed]
  3. Zain Ul Arifeen, M.; Ma, Y.-N.; Xue, Y.-R.; Liu, C.-H. Deep-Sea Fungi Could Be the New Arsenal for Bioactive Molecules. Mar. Drugs 2019, 18, 9. [Google Scholar] [CrossRef] [PubMed]
  4. Sun, C.; Mudassir, S.; Zhang, Z.; Feng, Y.; Chang, Y.; Che, Q.; Gu, Q.; Zhu, T.; Zhang, G.; Li, D. Secondary Metabolites from Deep-Sea Derived Microorganisms. Curr. Med. Chem. 2020, 27, 6244–6273. [Google Scholar] [CrossRef]
  5. Wang, W.; Yu, Y.; Keller, N.P.; Wang, P. Presence, Mode of Action, and Application of Pathway Specific Transcription Factors in Aspergillus Biosynthetic Gene Clusters. Int. J. Mol. Sci. 2021, 22, 8709. [Google Scholar] [CrossRef]
  6. Youssef, F.S.; Simal-Gandara, J. Comprehensive Overview on the Chemistry and Biological Activities of Selected Alkaloid Producing Marine-Derived Fungi as a Valuable Reservoir of Drug Entities. Biomedicines 2021, 9, 485. [Google Scholar] [CrossRef]
  7. Zhu, J.; Song, L.; Shen, S.; Fu, W.; Zhu, Y.; Liu, L. Bioactive Alkaloids as Secondary Metabolites from Plant Endophytic Aspergillus Genus. Molecules 2023, 28, 7789. [Google Scholar] [CrossRef]
  8. Li, S.-G.; Wang, K.-B.; Gong, C.; Bao, Y.; Qin, N.-B.; Li, D.-H.; Li, Z.-L.; Bai, J.; Hua, H.-M. Cytotoxic Quinazoline Alkaloids from the Seeds of Peganum harmala. Bioorganic Med. Chem. Lett. 2018, 28, 103–106. [Google Scholar] [CrossRef]
  9. Buttachon, S.; Chandrapatya, A.; Manoch, L.; Silva, A.; Gales, L.; Bruyère, C.; Kiss, R.; Kijjoa, A. Sartorymensin, a New Indole Alkaloid, and New Analogues of Tryptoquivaline and Fiscalins Produced by Neosartorya siamensis (KUFC 6349). Tetrahedron 2012, 68, 3253–3262. [Google Scholar] [CrossRef]
  10. Long, S.; Duarte, D.; Carvalho, C.; Oliveira, R.; Santarém, N.; Palmeira, A.; Resende, D.I.S.P.; Silva, A.M.S.; Moreira, R.; Kijjoa, A.; et al. Indole-Containing Pyrazino[2,1-b]Quinazoline-3,6-Diones Active against Plasmodium and Trypanosomatids. ACS Med. Chem. Lett. 2022, 13, 225–235. [Google Scholar] [CrossRef]
  11. Numata, A.; Takahashi, C.; Matsushita, T.; Miyamoto, T.; Kawai, K.; Usami, Y.; Matsumura, E.; Inoue, M.; Ohishi, H.; Shingu, T. Fumiquinazolines, Novel Metabolites of a Fungus Isolated from a Saltfish. Tetrahedron Lett. 1992, 33, 1621–1624. [Google Scholar] [CrossRef]
  12. Takahashi, C.; Matsushita, T.; Doi, M.; Minoura, K.; Shingu, T.; Kumeda, Y.; Numata, A. Fumiquinazolines A–G, Novel Metabolites of a Fungus Separated from a Pseudolabrus Marine Fish. J. Chem. Soc. Perkin Trans. 1995, 1, 2345–2353. [Google Scholar] [CrossRef]
  13. Liu, R.; Li, H.; Yang, J.; An, Z. Quinazolinones Isolated from Aspergillus sp., an Endophytic Fungus of Astragalus membranaceus. Chem. Nat. Compd. 2018, 54, 808–810. [Google Scholar] [CrossRef]
  14. Liu, Y.; Cui, Y.; Lu, L.; Gong, Y.; Han, W.; Piao, G. Natural Indole-containing Alkaloids and Their Antibacterial Activities. Arch. Pharm. 2020, 353, 2000120. [Google Scholar] [CrossRef]
  15. Hu, Y.; Chen, S.; Yang, F.; Dong, S. Marine Indole Alkaloids—Isolation, Structure and Bioactivities. Mar. Drugs 2021, 19, 658. [Google Scholar] [CrossRef]
  16. Islam, F.; Dehbia, Z.; Zehravi, M.; Das, R.; Sivakumar, M.; Krishnan, K.; Billah, A.A.M.; Bose, B.; Ghosh, A.; Paul, S.; et al. Indole Alkaloids from Marine Resources: Understandings from Therapeutic Point of View to Treat Cancers. Chem. Biol. Interact. 2023, 383, 110682. [Google Scholar] [CrossRef]
  17. Alrajhi, N.N. Post-COVID-19 Pulmonary Fibrosis: An Ongoing Concern. Ann. Thorac. Med. 2023, 18, 173–181. [Google Scholar] [CrossRef]
  18. Perez-Favila, A.; Garza-Veloz, I. Antifibrotic Drugs against Idiopathic Pulmonary Fibrosis and Pulmonary Fibrosis Induced by COVID-19: Therapeutic Approaches and Potential Diagnostic Biomarkers. Int. J. Mol. Sci. 2024, 25, 1562. [Google Scholar] [CrossRef]
  19. Qin, R.; Zhao, Q.; Han, B.; Zhu, H.-P.; Peng, C.; Zhan, G.; Huang, W. Indole-Based Small Molecules as Potential Therapeutic Agents for the Treatment of Fibrosis. Front. Pharmacol. 2022, 13, 845892. [Google Scholar] [CrossRef]
  20. Cheng, Z.; Lou, L.; Liu, D.; Li, X.; Proksch, P.; Yin, S.; Lin, W. Versiquinazolines A–K, Fumiquinazoline-Type Alkaloids from the Gorgonian-Derived Fungus Aspergillus versicolor LZD-14-1. J. Nat. Prod. 2016, 79, 2941–2952. [Google Scholar] [CrossRef]
  21. Guo, Y.-W.; Liu, X.-J.; Yuan, J.; Li, H.-J.; Mahmud, T.; Hong, M.-J.; Yu, J.-C.; Lan, W.-J. l-Tryptophan Induces a Marine-Derived Fusarium sp. to Produce Indole Alkaloids with Activity against the Zika Virus. J. Nat. Prod. 2020, 83, 3372–3380. [Google Scholar] [CrossRef] [PubMed]
  22. Huang, L.-H.; Xu, M.-Y.; Li, H.-J.; Li, J.-Q.; Chen, Y.-X.; Ma, W.-Z.; Li, Y.-P.; Xu, J.; Yang, D.-P.; Lan, W.-J. Amino Acid-Directed Strategy for Inducing the Marine-Derived Fungus Scedosporium apiospermum F41–1 to Maximize Alkaloid Diversity. Org. Lett. 2017, 19, 4888–4891. [Google Scholar] [CrossRef] [PubMed]
  23. Kirby, G.W.; Robins, D.J.; Sefton, M.A.; Talekar, R.R. Biosynthesis of Bisdethiobis(Methylthio)Gliotoxin, a New Metabolite of Gliocladium deliquescens. J. Chem. Soc. Perkin Trans. 1980, 1, 119. [Google Scholar] [CrossRef]
  24. Li, X.; Kim, S.-K.; Nam, K.W.; Kang, J.S.; Choi, H.D.; Son, B.W. A New Antibacterial Dioxopiperazine Alkaloid Related to Gliotoxin from a Marine Isolate of the Fungus Pseudallescheria. J. Antibiot. 2006, 59, 248–250. [Google Scholar] [CrossRef]
  25. Afiyatullov, S.S.; Kalinovskii, A.I.; Pivkin, M.V.; Dmitrenok, P.S.; Kuznetsova, T.A. Alkaloids from the Marine Isolate of the Fungus Aspergillus fumigatus. Chem. Nat. Compd. 2005, 41, 236–238. [Google Scholar] [CrossRef]
  26. Barrow, C.J.; Sun, H.H. Spiroquinazoline, a Novel Substance P Inhibitor with a New Carbon Skeleton, Isolated from Aspergillus flavipes. J. Nat. Prod. 1994, 57, 471–476. [Google Scholar] [CrossRef]
  27. Zhang, W.; Li, J.; Wei, C.; Deng, X.; Xu, J. Chemical Epigenetic Modifiers Enhance the Production of Immunosuppressants from the Endophytic Fungus Aspergillus fumigatus Isolated from Cynodon dactylon. Nat. Prod. Res. 2022, 36, 4481–4485. [Google Scholar] [CrossRef]
  28. Larsen, T.O.; Frydenvang, K.; Frisvad, J.C.; Christophersen, C. UV-Guided Isolation of Alantrypinone, a Novel Penicillium Alkaloid. J. Nat. Prod. 1998, 61, 1154–1157. [Google Scholar] [CrossRef]
  29. Limbadri, S.; Luo, X.; Lin, X.; Liao, S.; Wang, J.; Zhou, X.; Yang, B.; Liu, Y. Bioactive Novel Indole Alkaloids and Steroids from Deep Sea-Derived Fungus Aspergillus fumigatus SCSIO 41012. Molecules 2018, 23, 2379. [Google Scholar] [CrossRef]
  30. Jiao, R.H.; Xu, S.; Liu, J.Y.; Ge, H.M.; Ding, H.; Xu, C.; Zhu, H.L.; Tan, R.X. Chaetominine, a Cytotoxic Alkaloid Produced by Endophytic Chaetomium sp. IFB-E015. Org. Lett. 2006, 8, 5709–5712. [Google Scholar] [CrossRef]
  31. Sun, J.-H.; Yang, Z.-D.; Zhang, Y.-F. Chemical Constituents and Bioactivity of a Fungal Endophyte from Lamium amplexicaule. Chem. Nat. Compd. 2019, 55, 775–778. [Google Scholar] [CrossRef]
  32. Afiyatullov, S.S.; Kalinovskii, A.I.; Pivkin, M.V.; Dmitrenok, P.S.; Kuznetsova, T.A. Fumitremorgins from the Marine Isolate of the Fungus Aspergillus fumigatus. Chem. Nat. Compd. 2004, 40, 615–617. [Google Scholar] [CrossRef]
  33. Çetinel Aksoy, S.; Küçüksolak, M.; Uze, A.; Bedir, E. Benzodiazepine Derivatives from Marine-Derived Streptomyces cacaoi 14CM034. Rec. Nat. Prod. 2021, 15, 602–607. [Google Scholar] [CrossRef]
  34. Peng, Q.; Cai, J.; Long, J.; Yang, B.; Lin, X.; Wang, J.; Xiao, J.; Liu, Y.; Zhou, X. New Azaphthalide and Phthalide Derivatives from the Marine Coral-Derived Fungus Aspergillus sp. SCSIO41405. Phytochem. Lett. 2021, 43, 94–97. [Google Scholar] [CrossRef]
  35. Cha, X.-J.; Pu, G.; Xiong, R.-F.; Ma, Y.-Y.; Zhang, G.-H.; Yao, H.; Kong, G.-H.; Bao, M.-F.; Hu, Q.-F.; Li, Y.-K.; et al. Carboline Alkaloids from the Cigar Tobacco-Derived Fungi Aspergillus sp. and Their Anti-TMV Activity. Chem. Nat. Compd. 2023, 59, 881–885. [Google Scholar] [CrossRef]
  36. Kwon, H.C.; Lee, B.G.; Kim, S.H.; Jung, C.M.; Hong, S.Y.; Han, J.W.; Lee, H.W.; Zee, O.P.; Lee, K.R. Inducible Nitric Oxide Synthase Inhibitors from Melia azedarach var. Japonica. Arch. Pharm. Res. 1999, 22, 410–413. [Google Scholar] [CrossRef]
  37. Wang, J.; Jiang, M.; Xiong, A.; Zhang, L.; Luo, L.; Liu, Y.; Liu, S.; Ran, Q.; Wu, D.; Xiong, Y.; et al. Integrated Analysis of Single-Cell and Bulk RNA Sequencing Reveals pro-Fibrotic PLA2G7 High Macrophages in Pulmonary Fibrosis. Pharmacol. Res. 2022, 182, 106286. [Google Scholar] [CrossRef]
  38. Al-Habeeb, F.; Aloufi, N.; Traboulsi, H.; Liu, X.; Nair, P.; Haston, C.; Azuelos, I.; Huang, S.K.; White, E.S.; Gallouzi, I.E.; et al. Human Antigen R Promotes Lung Fibroblast Differentiation to Myofibroblasts and Increases Extracellular Matrix Production. J. Cell Physiol. 2021, 236, 6836–6851. [Google Scholar] [CrossRef]
  39. Cárdenes, N.; Sembrat, J.; Noda, K.; Lovelace, T.; Álvarez, D.; Bittar, H.E.T.; Philips, B.J.; Nouraie, M.; Benos, P.V.; Sánchez, P.G.; et al. Human Ex Vivo Lung Perfusion: A Novel Model to Study Human Lung Diseases. Sci. Rep. 2021, 11, 490. [Google Scholar] [CrossRef]
Figure 1. Chemical structures of compounds 121.
Figure 1. Chemical structures of compounds 121.
Marinedrugs 23 00004 g001
Figure 2. Key 1H-1H COSY and HMBC correlations of 15, and NOESY correlations of 1.
Figure 2. Key 1H-1H COSY and HMBC correlations of 15, and NOESY correlations of 1.
Marinedrugs 23 00004 g002
Figure 3. Experimental and calculated ECD spectra of 1.
Figure 3. Experimental and calculated ECD spectra of 1.
Marinedrugs 23 00004 g003
Figure 4. Experimental and calculated ECD spectra of 4.
Figure 4. Experimental and calculated ECD spectra of 4.
Marinedrugs 23 00004 g004
Figure 5. Experimental and calculated ECD spectra of 5.
Figure 5. Experimental and calculated ECD spectra of 5.
Marinedrugs 23 00004 g005
Figure 6. Relative mRNA expression levels of FN1 (A), α-SMA (B), and COL1A1 (C) in bleomycin-treated A549 cells. A549 cells were pre-treated with control (DMSO) or indicated compounds (50 μM) for 2 h, followed by stimulation with bleomycin (0.02 U/mL) for an additional 48 h. Relative mRNA expression levels of COL1A1, α-SMA, and FN1 were measured with qRT-PCR and normalized to GADPH. Data are presented as means ± SD (error bars) values. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. BLM group.
Figure 6. Relative mRNA expression levels of FN1 (A), α-SMA (B), and COL1A1 (C) in bleomycin-treated A549 cells. A549 cells were pre-treated with control (DMSO) or indicated compounds (50 μM) for 2 h, followed by stimulation with bleomycin (0.02 U/mL) for an additional 48 h. Relative mRNA expression levels of COL1A1, α-SMA, and FN1 were measured with qRT-PCR and normalized to GADPH. Data are presented as means ± SD (error bars) values. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. BLM group.
Marinedrugs 23 00004 g006
Table 1. 1H (500 MHz) and 13C (125 MHz) NMR data of 1 in DMSO-d6 (δ in ppm; J in Hz).
Table 1. 1H (500 MHz) and 13C (125 MHz) NMR data of 1 in DMSO-d6 (δ in ppm; J in Hz).
PositionδC, TypeδH, Mult (J in Hz)
1165.2, C
2N
372.8, C
4166.3, C
5N
669.0, CH4.82, d (14.0)
773.7, CH4.72, d (14.0)
7-NH 5.47, m
8130.6, CH5.64, d (9.5)
9123.5, CH5.90, m
10119.3, CH6.00, m
11133.1, C
1238.4, CH22.85, m; 3.12, m
1371.52, C
1414.7, CH32.19, s
1528.3, CH32.99, s
1612.8, CH32.20, s
1763.0, CH23.73, dd (11.0, 3.0);
4.06, d (11.0)
17-OH 5.47, d (3.0)
18129.3, CH7.31, d (7.0)
19128.2, CH7.25, dd (7.5, 7.0)
20126.3, CH7.20, dd (7.5, 7.5)
21128.2, CH7.25, dd (7.5, 7.0)
22129.3, CH7.31, d (7.0)
23137.9, C
2433.3, CH22.81, m; 3.12, m
2553.9, CH3.89, dt (11.0, 6.5)
26NH8.51, brd (6.5)
27167.7, C
28126.3, C
29130.3, CH7.66, dd (7.5, 1.5)
30124.0, CH7.20, dd (7.5, 7.5)
31132.2, CH7.50, ddd (8.0, 7.5, 1.5)
32121.0, CH7.10, d (8.0)
33136.8, C
34171.3, C
34-OH 10.41, brs
Table 2. 1H (400 MHz) and 13C (100 MHz) NMR data for 2 in CDCl3 (δ in ppm; J in Hz).
Table 2. 1H (400 MHz) and 13C (100 MHz) NMR data for 2 in CDCl3 (δ in ppm; J in Hz).
PositionδC, TypeδH, Mult (J in Hz)
1162.8, C
2N
3151.9, C
4N
5147.7, C
6127.0, CH7.77, m
7134.7, C7.77, m
8127.3, C7.50, m
9126.9, C8.34, d (8.0)
10120.6, C
1142.0, CH24.55, t (7.6)
1233.2, C2.71, t (7.6)
13171.4, C
1451.9, OCH33.54, s
15119.9, CH7.66, d (8.0)
16119.9, C7.22, dd (8.0, 7.5)
17121.7, C7.26, dd (8.0, 7.5)
18123.5, C7.39, d (8.0)
19135.8, C
20NH9.07, s
21125.8, C7.52, s
22111.2, C
23126.2, C
Table 3. 1H NMR (500 MHz) data for compounds 35 in DMSO-d6 (δ in ppm; J in Hz).
Table 3. 1H NMR (500 MHz) data for compounds 35 in DMSO-d6 (δ in ppm; J in Hz).
Position345
δH, Mult (J in Hz)
111.94, s11.02, s10.99, s
27.86, s7.18, s7.14, dd (2.0)
3
4a
48.15, d (7.0)7.35, d (8.0)7.33, dd (8.0, 7.0)
57.17, dd (7.5, 7.0)6.93, dd (8.0, 7.0)6.91, dd (8.0, 7.0)
67.21, dd (7.5, 7.0)7.06, dd (8.0, 7.0)7.04, dd (8.0, 7.0)
77.50, d (7.5)7.35, d (8.0)7.33, dd (8.0, 7.0)
7a
8 5.12, s5.01, s
9
108.36, s7.71, s7.73, d (2.0)
11
12 6.96, dd (8.0, 2.0)
136.71, d (7.5)6.66, d (8.0)6.44, d (8.0)
147.63, d (7.5)7.23, d (8.0)
15
16
17 3.66, s3.62, s
Table 4. 13C NMR (125 MHz) data for compounds 35 in DMSO-d6 (δ in ppm).
Table 4. 13C NMR (125 MHz) data for compounds 35 in DMSO-d6 (δ in ppm).
Position345
δC, Type
1NHNHNH
2133.2, CH123.5, CH123.4, CH
3115.1, C112.7, C113.2, C
4a126.7, C126.2, C126.4, C
4121.4, CH118.6, CH111.6, CH
5121.1, CH118.7, CH118.6, CH
6122.6, CH121.3, CH121.2, CH
7112.0, CH111.6, CH118.7, CH
7a136.4, C136.3, C136.3, C
8188.2, C47.1, CH47.6, CH
9126.1, C125.0, C124.0, C
10134.0, CH130.8, CH131.6, CH
11126.1, C110.1, C120.1, C
12153.8, C150.5, C129.9, CH
13115.2, CH116.4, CH115.2, CH
14132.2, CH133.8, CH149.3, C
15171.0, C169.8, C149.3, C
16NH173.4, C173.7, C
17 57.0, OCH351.8, CH3
Table 5. List of primers used in this study.
Table 5. List of primers used in this study.
Primer NamePrimer Sequence (5′-3′)
FN1-FCGGTGGCTGTCAGTCAAAG
FN1-RAAACCTCGGCTTCCTCCATAA
α-SMA-FGTGTTGCCCCTGAAGAGCAT
α-SMA-R GCTGGGACATTGAAAGTCTCA
COL1A1-FGTGCGATGACGTGATCTGTGA
COL1A1-RCGGTGGTTTCTTGGTCGGT
GADPH-FACCCAGAAGACTGTGGATGG
GADPH-RTGCTGTAGCCAAATTCGTTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dai, L.-H.; Zhang, G.-R.; Ou, Y.-H.; Liu, X.-J.; Yao, H.-L.; Hu, W.-H.; Li, H.-J.; Lan, W.-J. Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1. Mar. Drugs 2025, 23, 4. https://doi.org/10.3390/md23010004

AMA Style

Dai L-H, Zhang G-R, Ou Y-H, Liu X-J, Yao H-L, Hu W-H, Li H-J, Lan W-J. Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1. Marine Drugs. 2025; 23(1):4. https://doi.org/10.3390/md23010004

Chicago/Turabian Style

Dai, Lai-Hui, Gao-Rong Zhang, Yang-Hui Ou, Xiao-Jing Liu, Hong-Liang Yao, Wen-Hao Hu, Hou-Jin Li, and Wen-Jian Lan. 2025. "Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1" Marine Drugs 23, no. 1: 4. https://doi.org/10.3390/md23010004

APA Style

Dai, L.-H., Zhang, G.-R., Ou, Y.-H., Liu, X.-J., Yao, H.-L., Hu, W.-H., Li, H.-J., & Lan, W.-J. (2025). Five New Indole Alkaloid Derivatives from Deep-Sea Fungus Aspergillus fumigatus AF1. Marine Drugs, 23(1), 4. https://doi.org/10.3390/md23010004

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop