Echinochrome A Inhibits Melanogenesis in B16F10 Cells by Downregulating CREB Signaling
Abstract
:1. Introduction
2. Results
2.1. Effects of Ech A on Cell Viability
2.2. Ech A Inhibits L-DOPA Oxidation
2.3. Ech A Inhibits mRNA of Tyrosinase in B16F10 Melanoma Cells
2.4. Ech A Suppresses Melanin Production
2.5. Ech A Inhibits Melanin Synthesis through the CREB Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Preparation of Ech A
4.2. Cell Culture
4.3. Cell Cytotoxicity Assay
4.4. Inhibition of Tyrosinase Activation and L-DOPA Oxidation
4.5. Melanin Synthesis Assay
4.6. Quantitative RT-PCR
4.7. Western Blot Analysis
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gilchrest, B.A.; Zhai, S.; Eller, M.S.; Yarosh, D.B.; Yaar, M. Treatment of human melanocytes and S91 melanoma cells with the DNA repair enzyme T4 endonuclease V enhances melanogenesis after ultraviolet irradiation. J. Investig. Dermatol. 1993, 101, 666–672. [Google Scholar] [CrossRef] [PubMed]
- Pavel, S. Dynamics of melanogenesis intermediates. J. Investig. Dermatol. 1993, 100, 162s–165s. [Google Scholar] [CrossRef] [PubMed]
- Choung, M.G.; Hwang, Y.S.; Kim, G.P.; Ahn, K.G.; Shim, H.S.; Hong, S.B.; Choi, J.H.; Yu, C.Y.; Kim, S.H. Antimelanogenic effect and whitening of anthocyanin rich fraction from seeds of liriope platyphylla. Korean J. Medicinal Crop Sci. 2013, 21, 361–371. [Google Scholar] [CrossRef]
- Iwata, M.; Corn, T.; Iwata, S.; Everett, M.A.; Fuller, B.B. The relationship between tyrosinase activity and skin color in human foreskins. J. Investig. Dermatol. 1990, 95, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Hill, H.Z. Induced melanin reduces mutations and cell killing in mouse melanoma. Photochem. Photobiol. 1997, 65, 480–485. [Google Scholar] [CrossRef] [PubMed]
- Herrling, T.; Jung, K.; Fuchs, J. The role of melanin as protector against free radicals in skin and its role as free radical indicator in hair. Spectrochim. Acta A Mol. Biomol. Spectrosc. 2008, 69, 1429–1435. [Google Scholar] [CrossRef]
- Oh, T.I.; Yun, J.M.; Park, E.J.; Kim, Y.S.; Lee, Y.M.; Lim, J.H. Plumbagin Suppresses α-MSH-Induced Melanogenesis in B16F10 Mouse Melanoma Cells by Inhibiting Tyrosinase Activity. Int. J. Mol. Sci. 2017, 18, 320. [Google Scholar] [CrossRef]
- Bentley, N.J.; Eisen, T.; Goding, C.R. Melanocyte-specific expression of the human tyrosinase promoter: Activation by the microphthalmia gene product and role of the initiator. Mol. Cell. Biol. 1994, 14, 7996–8006. [Google Scholar]
- Sun, M.; Xie, H.F.; Tang, Y.; Lin, S.Q.; Li, J.M.; Sun, S.N.; Hu, X.L.; Huang, Y.X.; Shi, W.; Jian, D. G protein-coupled estrogen receptor enhances melanogenesis via cAMP-protein kinase (PKA) by upregulating microphthalmia-related transcription factor-tyrosinase in melanoma. J. Steroid Biochem. Mol. Biol. 2017, 165, 236–246. [Google Scholar] [CrossRef]
- Vachtenheim, J.; Borovanský, J. “Transcription physiology” of pigment formation in melanocytes: Central role of MITF. Exp. Dermatol. 2010, 19, 617–627. [Google Scholar] [CrossRef]
- Land, E.J.; Ramsden, C.A.; Riley, P.A. Quinone chemistry and melanogenesis. Methods Enzymol. 2004, 378, 88–109. [Google Scholar] [PubMed]
- Slominski, R.M.; Sarna, T.; Płonka, P.M.; Raman, C.; Brożyna, A.A.; Slominski, A.T. Melanoma, Melanin, and Melanogenesis: The Yin and Yang Relationship. Front. Oncol. 2022, 12, 842496. [Google Scholar] [CrossRef]
- D’Mello, S.A.; Finlay, G.J.; Baguley, B.C.; Askarian-Amiri, M.E. Signaling Pathways in Melanogenesis. Int. J. Mol. Sci. 2016, 17, 1144. [Google Scholar] [CrossRef] [PubMed]
- Slominski, A.; Tobin, D.J.; Shibahara, S.; Wortsman, J. Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol Rev 2004, 84, 1155–1228. [Google Scholar] [CrossRef] [PubMed]
- Wolf Horrell, E.M.; Boulanger, M.C.; D’Orazio, J.A. Melanocortin 1 Receptor: Structure, Function, and Regulation. Front. Genet. 2016, 7, 95. [Google Scholar] [CrossRef] [PubMed]
- Jeong, S.H.; Kim, H.K.; Song, I.S.; Lee, S.J.; Ko, K.S.; Rhee, B.D.; Kim, N.; Mishchenko, N.P.; Fedoryev, S.A.; Stonik, V.A.; et al. Echinochrome A protects mitochondrial function in cardiomyocytes against cardiotoxic drugs. Mar. Drugs 2014, 12, 2922–2936. [Google Scholar] [CrossRef] [PubMed]
- Fedoreyev, S.A.; Krylova, N.V.; Mishchenko, N.P.; Vasileva, E.A.; Pislyagin, E.A.; Iunikhina, O.V.; Lavrov, V.F.; Svitich, O.A.; Ebralidze, L.K.; Leonova, G.N. Antiviral and Antioxidant Properties of Echinochrome A. Mar. Drugs 2018, 16, 509. [Google Scholar] [CrossRef]
- Kim, R.; Hur, D.; Kim, H.K.; Han, J.; Mishchenko, N.P.; Fedoreyev, S.A.; Stonik, V.A.; Chang, W. Echinochrome A Attenuates Cerebral Ischemic Injury through Regulation of Cell Survival after Middle Cerebral Artery Occlusion in Rat. Mar. Drugs 2019, 17, 501. [Google Scholar] [CrossRef]
- Nikolaeva, G.V.; Guseva, M.R.; Beslaneeva, M.B. [Analysis of efficacy of prevention and antioxidant therapy in premature infants]. Vestn. Oftalmol. 2012, 128, 57–58+60–61. [Google Scholar]
- Park, J.H.; Lee, N.K.; Lim, H.J.; Mazumder, S.; Kumar Rethineswaran, V.; Kim, Y.J.; Jang, W.B.; Ji, S.T.; Kang, S.; Kim, D.Y.; et al. Therapeutic Cell Protective Role of Histochrome under Oxidative Stress in Human Cardiac Progenitor Cells. Mar. Drugs 2019, 17, 368. [Google Scholar] [CrossRef]
- Yun, H.R.; Ahn, S.W.; Seol, B.; Vasileva, E.A.; Mishchenko, N.P.; Fedoreyev, S.A.; Stonik, V.A.; Han, J.; Ko, K.S.; Rhee, B.D.; et al. Echinochrome A Treatment Alleviates Atopic Dermatitis-like Skin Lesions in NC/Nga Mice via IL-4 and IL-13 Suppression. Mar. Drugs 2021, 19, 622. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.K.; Vasileva, E.A.; Mishchenko, N.P.; Fedoreyev, S.A.; Han, J. Multifaceted Clinical Effects of Echinochrome. Mar. Drugs 2021, 19, 412. [Google Scholar] [CrossRef] [PubMed]
- Park, G.T.; Yoon, J.W.; Yoo, S.B.; Song, Y.C.; Song, P.; Kim, H.K.; Han, J.; Bae, S.J.; Ha, K.T.; Mishchenko, N.P.; et al. Echinochrome A Treatment Alleviates Fibrosis and Inflammation in Bleomycin-Induced Scleroderma. Mar. Drugs 2021, 19, 237. [Google Scholar] [CrossRef] [PubMed]
- Bae, J.S.; Han, M.; Yao, C.; Chung, J.H. Chaetocin inhibits IBMX-induced melanogenesis in B16F10 mouse melanoma cells through activation of ERK. Chem.-Biol. Interact. 2016, 245, 66–71. [Google Scholar] [CrossRef]
- Kang, S.H.; Jeon, Y.D.; Cha, J.Y.; Hwang, S.W.; Lee, H.Y.; Park, M.; Lee, B.R.; Shin, M.K.; Kim, S.J.; Shin, S.M.; et al. Antioxidant and skin-whitening effects of aerial part of Euphorbia supina Raf. Extract. BMC Complement. Altern. Med. 2018, 18, 256. [Google Scholar] [CrossRef]
- Ullah, S.; Chung, Y.C.; Hyun, C.G. Induction of Melanogenesis by Fosfomycin in B16F10 Cells Through the Upregulation of P-JNK and P-p38 Signaling Pathways. Antibiotics 2020, 9, 172. [Google Scholar] [CrossRef] [PubMed]
- Momtaz, S.; Lall, N.; Basson, A. Inhibitory activities of mushroom tyrosine and DOPA oxidation by plant extracts. S. Afr. J. Bot. 2008, 74, 577–582. [Google Scholar] [CrossRef]
- Wu, K.C.; Hseu, Y.C.; Shih, Y.C.; Sivakumar, G.; Syu, J.T.; Chen, G.L.; Lu, M.T.; Chu, P.C. Calycosin, a Common Dietary Isoflavonoid, Suppresses Melanogenesis through the Downregulation of PKA/CREB and p38 MAPK Signaling Pathways. Int. J. Mol. Sci. 2022, 23, 1358. [Google Scholar] [CrossRef]
- Kahn, V. Effect of kojic acid on the oxidation of DL-DOPA, norepinephrine, and dopamine by mushroom tyrosinase. Pigm. Cell Res. 1995, 8, 234–240. [Google Scholar] [CrossRef]
- Kim, K.S.; Kim, J.A.; Eom, S.Y.; Lee, S.H.; Min, K.R.; Kim, Y. Inhibitory effect of piperlonguminine on melanin production in melanoma B16 cell line by downregulation of tyrosinase expression. Pigm. Cell Res. 2006, 19, 90–98. [Google Scholar] [CrossRef]
- Oh, S.J.; Seo, Y.; Ahn, J.S.; Shin, Y.Y.; Yang, J.W.; Kim, H.K.; Han, J.; Mishchenko, N.P.; Fedoreyev, S.A.; Stonik, V.A.; et al. Echinochrome A Reduces Colitis in Mice and Induces In Vitro Generation of Regulatory Immune Cells. Mar. Drugs 2019, 17, 622. [Google Scholar] [CrossRef] [PubMed]
- Seol, J.E.; Ahn, S.W.; Seol, B.; Yun, H.R.; Park, N.; Kim, H.K.; Vasileva, E.A.; Mishchenko, N.P.; Fedoreyev, S.A.; Stonik, V.A.; et al. Echinochrome A Protects against Ultraviolet B-induced Photoaging by Lowering Collagen Degradation and Inflammatory Cell Infiltration in Hairless Mice. Mar. Drugs 2021, 19, 550. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.K.; Cho, S.W.; Heo, H.J.; Jeong, S.H.; Kim, M.; Ko, K.S.; Rhee, B.D.; Mishchenko, N.P.; Vasileva, E.A.; Fedoreyev, S.A.; et al. A Novel Atypical PKC-Iota Inhibitor, Echinochrome A, Enhances Cardiomyocyte Differentiation from Mouse Embryonic Stem Cells. Mar. Drugs 2018, 16, 192. [Google Scholar] [CrossRef] [PubMed]
- Ko, C.Y.; Wang, W.L.; Wang, S.M.; Chu, Y.Y.; Chang, W.C.; Wang, J.M. Glycogen synthase kinase-3β-mediated CCAAT/enhancer-binding protein delta phosphorylation in astrocytes promotes migration and activation of microglia/macrophages. Neurobiol. Aging 2014, 35, 24–34. [Google Scholar] [CrossRef]
- Kim, B.Y.; Park, S.H.; Park, B.J.; Kim, J.J. Whitening effect of Androsace umbellata extract. J. Soc. Cosmet. Scientists Korea 2015, 41, 6. [Google Scholar] [CrossRef]
- Abdel-Malek, Z.A.; Kadekaro, A.L.; Swope, V.B. Stepping up melanocytes to the challenge of UV exposure. Pigment Cell Melanoma Res. 2010, 23, 171–186. [Google Scholar] [CrossRef]
- Buscà, R.; Abbe, P.; Mantoux, F.; Aberdam, E.; Peyssonnaux, C.; Eychène, A.; Ortonne, J.P.; Ballotti, R. Ras mediates the cAMP-dependent activation of extracellular signal-regulated kinases (ERKs) in melanocytes. EMBO J. 2000, 19, 2900–2910. [Google Scholar] [CrossRef] [PubMed]
- Yao, C.; Jin, C.L.; Oh, J.H.; Oh, I.G.; Park, C.H.; Chung, J.H. Ardisia crenata extract stimulates melanogenesis in B16F10 melanoma cells through inhibiting ERK1/2 and Akt activation. Mol. Med. Rep. 2015, 11, 653–657. [Google Scholar] [CrossRef]
- Otręba, M.; Rok, J.; Buszman, E.; Wrześniok, D. [Regulation of melanogenesis: The role of cAMP and MITF]. Postepy Hig. Med. Dosw. (Online) 2012, 66, 33–40. [Google Scholar]
- Chen, H.W.; Chou, Y.S.; Young, T.H.; Cheng, N.C. Inhibition of melanin synthesis and melanosome transfer by chitosan biomaterials. J. Biomed. Mater. Res. B Appl. Biomater. 2020, 108, 1239–1250. [Google Scholar] [CrossRef]
- Shim, J.H. Inhibitory Effects of Cycloheterophyllin on Melanin Synthesis. Molecules 2021, 26, 2526. [Google Scholar] [CrossRef] [PubMed]
- Ishihara, Y.; Oka, M.; Tsunakawa, M.; Tomita, K.; Hatori, M.; Yamamoto, H.; Kamei, H.; Miyaki, T.; Konishi, M.; Oki, T. Melanostatin, a new melanin synthesis inhibitor. Production, isolation, chemical properties, structure and biological activity. J. Antibiot. (Tokyo) 1991, 44, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Kong, K.H.; Park, S.Y.; Hong, M.P.; Cho, S.H. Expression and characterization of human tyrosinase from a bacterial expression system. Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 2000, 125, 563–569. [Google Scholar] [CrossRef]
- Choi, M.R.; Jung, K.H.; Park, J.H.; Das, N.D.; Chung, M.K.; Choi, I.G.; Lee, B.C.; Park, K.S.; Chai, Y.G. Ethanol-induced small heat shock protein genes in the differentiation of mouse embryonic neural stem cells. Arch. Toxicol. 2011, 85, 293–304. [Google Scholar] [CrossRef]





| Gene | Forward (5′-3′) | Reverse (5′-3′) | Amplicon Size (bp) | 
|---|---|---|---|
| Gapdh | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA | 123 | 
| Mitf | ACTTTCCCTTATCCCATCCACC | TGAGATCCAGAGTTGTCGTACA | 143 | 
| Tyrp1 | CCCCTAGCCTATATCTCCCTTTT | TACCATCGTGGGGATAATGGC | 229 | 
| Tyrp2 | TTCTGCTGGGTTGTCTGGG | CACAGATGTTGGTTGCCTCG | 135 | 
| Tyr | CTCTGGGCTTAGCAGTAGGC | GCAAGCTGTGGTAGTCGTCT | 107 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, M.R.; Lee, H.; Kim, H.K.; Han, J.; Seol, J.E.; Vasileva, E.A.; Mishchenko, N.P.; Fedoreyev, S.A.; Stonik, V.A.; Ju, W.S.; et al. Echinochrome A Inhibits Melanogenesis in B16F10 Cells by Downregulating CREB Signaling. Mar. Drugs 2022, 20, 555. https://doi.org/10.3390/md20090555
Choi MR, Lee H, Kim HK, Han J, Seol JE, Vasileva EA, Mishchenko NP, Fedoreyev SA, Stonik VA, Ju WS, et al. Echinochrome A Inhibits Melanogenesis in B16F10 Cells by Downregulating CREB Signaling. Marine Drugs. 2022; 20(9):555. https://doi.org/10.3390/md20090555
Chicago/Turabian StyleChoi, Mi Ran, Heejin Lee, Hyoung Kyu Kim, Jin Han, Jung Eun Seol, Elena A. Vasileva, Natalia P. Mishchenko, Sergey A. Fedoreyev, Valentin A. Stonik, Won Seok Ju, and et al. 2022. "Echinochrome A Inhibits Melanogenesis in B16F10 Cells by Downregulating CREB Signaling" Marine Drugs 20, no. 9: 555. https://doi.org/10.3390/md20090555
APA StyleChoi, M. R., Lee, H., Kim, H. K., Han, J., Seol, J. E., Vasileva, E. A., Mishchenko, N. P., Fedoreyev, S. A., Stonik, V. A., Ju, W. S., Kim, D.-J., & Lee, S.-R. (2022). Echinochrome A Inhibits Melanogenesis in B16F10 Cells by Downregulating CREB Signaling. Marine Drugs, 20(9), 555. https://doi.org/10.3390/md20090555
 
        




 
       