Do Polymorphisms of the TERT, GSTM1, and GSTT1 Genes Increase Laryngeal Cancer Susceptibility in Smokers of Romanian Descent?
Abstract
1. Introduction
2. Materials and Methods
DNA Extraction and Genotyping
3. Statistical Analysis
4. Results
5. Discussion
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
TERT | telomerase reverse transcriptase |
GST | glutathione S-transferases |
GSTM1 | glutathione S-transferase class Mu |
GSTT1 | glutathione S-transferase class Theta |
LSCC | laryngeal squamous cell carcinoma |
PF | forward primer |
PR | reverse primer |
HNC | head and neck cancer |
SNP | single-nucleotide polymorphism |
ETDA | ethylenediaminetetraacetic acid |
PCR–RFLP | polymerase chain reaction-restriction fragment length polymorphism |
HWE | Hardy–Weinberg equilibrium theory |
A | adenine |
C | cytosine |
GST null genotype (-) | deletion present |
GST positive genotype (+) | no deletion present |
OR | odds ratio |
CI | confidence interval |
FDR | false discovery rate |
References
- Wu, X.; Gu, J.; Spitz, M.R. Mutagen sensitivity: A genetic predisposition factor for cancer. Cancer Res. 2007, 67, 3493–3495. [Google Scholar] [CrossRef] [PubMed]
- Smith, G.; Stanley, L.A.; Sim, E.; Strange, R.C.; Wolf, C.R. Metabolic polymorphisms and cancer susceptibility. Cancer Surv. 1995, 25, 27–65. [Google Scholar] [PubMed]
- Hemminki, K.; Försti, A.; Lorenzo Bermejo, J. Etiologic impact of known cancer susceptibility genes. Mutat. Res. 2008, 658, 42–54. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Guo, L.; Wang, S.; Yu, Q.; Lu, J. Association of Smoking and XPG, CYP1A1, OGG1, ERCC5, ERCC1, MMP2, and MMP9 Gene Polymorphisms with the early detection and occurrence of Laryngeal Squamous Carcinoma. J. Cancer 2018, 9, 968–977. [Google Scholar] [CrossRef] [PubMed]
- Barnes, L.; Tse, L.; Hunt, J.; Brandwein-Gensler, M.; Urken, M.; Slootweg, P.; Gale, N.; Cardesa, A.; Zidar, N.; Boffetta, P. Tumours of the hypopharynx, larynx and trachea: Introduction. In World Health Classification of Tumors Pathology and Genetics of Head and Neck Tumors; Barnes, L., Evenson, J.W., Reichart, P., Sidransky, D., Eds.; IARC Press: Lyon, France, 2005; pp. 109–120. [Google Scholar]
- Sarafoleanu, C. Esenţialul în Laringologie; Editura Academiei Române: Bucureşti, Romania, 2007; pp. 77–111, 322–351. [Google Scholar]
- Wang, C.; Li, Q.; Wang, Y.; Feng, J.; Yao, H.; Xiao, H. Case-control study on risk factors of laryngeal cancer in Heilongjiang Province. Lin Chuang Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 2011, 25, 1117–1119. [Google Scholar] [PubMed]
- Pantel, M.; Guntinas-Lichius, O. Laryngeal Carcinoma: Epidemiology, Risk Factors and Survival. HNO 2012, 60, 32–40. [Google Scholar] [CrossRef] [PubMed]
- Ramroth, H.; Dietz, A.; Becher, H. Environmental tobacco smoke and laryngeal cancer: Results from a population-based case-control study. Eur. Arch. Otorhinolaryngol. 2008, 265, 1367–1371. [Google Scholar] [CrossRef]
- Armstrong, W.B.; Vokes, D.E.; Verma, S.P. Malignant tumors of the larynx. In Cummings Otolaryngology Head and Neck Surgery, 6th ed.; Flint, P.W., Haughey, B.H., Lund, V., Niparko, J.K., Robbins, K.T., Thomas, J.R., Lesperance, M.M., Eds.; Elsevier: Philadelphia, PA, USA, 2014; pp. 1880–1923. [Google Scholar]
- Maier, H.; Dietz, A.; Gewelke, U.; Heller, W.D.; Weidauer, H. Tobacco and alcohol and the risk of head and neck cancer. Clin. Investig. 1992, 70, 320–327. [Google Scholar] [CrossRef]
- Guoxiang, L.; Li, L.; Haiyan, C. Analysis of laryngeal cancer aetiology. Clin. Med. 2011, 31, 98. [Google Scholar]
- Cornean, C.I.; Cosgarea, M.; Cătană, A.; Mogoantă, C.A.; Necula, V.; Maniu, A.A. Do we know enough about the genetic involvement in laryngeal cancer susceptibility and prognostic outcome? Rom. J. Morphol. Embryol. 2019, 60, 353–367. [Google Scholar]
- Online Calculator of Hardy-Weinberg Equilibrium. Available online: https://wpcalc.com/en/equilibrium-hardy-weinberg/ (accessed on 20 August 2021).
- Li, H.; Xu, Y.; Mei, H.; Peng, L.; Li, X.; Tang, J. The TERT rs2736100 polymorphism increases cancer risk: A meta-analysis. Oncotarget 2017, 8, 38693–38705. [Google Scholar] [CrossRef]
- Zou, P.; Gu, A.; Ji, G.; Zhao, L.; Zhao, P.; Lu, A. The TERT rs2736100 Polymorphism and Cancer Risk: A Meta-analysis Based on 25 Case-Control Studies. BMC Cancer 2012, 12, 7. [Google Scholar] [CrossRef] [PubMed]
- Pestana, A.; Vinagre, J.; Sobrinho-Simões, M.; Soares, P. TERT biology and function in cancer: Beyond immortalisation. J. Mol. Endocrinol. 2017, 58, R129–R146. [Google Scholar] [CrossRef] [PubMed]
- Snetselaar, R.; van Oosterhout, M.F.M.; Grutters, J.C.; van Moorsel, C.H.M. Telomerase Reverse Transcriptase Polymorphism rs2736100: A Balancing Act between Cancer and Non-Cancer Disease, a Meta-Analysis. Front. Med. 2018, 5, 41. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.W.; Piatyszek, M.A.; Prowse, K.R.; Harley, C.B.; West, M.D.; Ho, P.L.; Coviello, G.M.; Wright, W.E.; Weinrich, S.L.; Shay, J.W. Specific association of human telomerase activity with immortal cells and cancer. Science 1994, 266, 2011–2015. [Google Scholar] [CrossRef]
- Yang, J.; Jiao, S. Increased lung cancer risk associated with the TERT rs2736100 polymorphism: An updated meta-analysis. Tumour Biol. 2014, 35, 5763–5769. [Google Scholar] [CrossRef]
- Nie, W.; Zang, Y.; Chen, J.; Xiu, Q. TERT rs2736100 polymorphism contributes to lung cancer risk: A meta-analysis including 49,869 cases and 73,464 controls. Tumour Biol. 2014, 35, 5569–5574. [Google Scholar] [CrossRef]
- Zhou, P.; Wei, L.; Xia, X.; Shao, N.; Qian, X.; Yang, Y. Association between telomerase reverse transcriptase rs2736100 polymorphism and risk of glioma. J. Surg. Res. 2014, 191, 156–160. [Google Scholar] [CrossRef]
- Dahlström, J.; Liu, T.; Yuan, X.; Saft, L.; Ghaderi, M.; Wei, Y.B.; Lavebratt, C.; Li, P.; Zheng, C.; Björkholm, M.; et al. TERT rs2736100 genotypes are associated with differential risk of myeloproliferative neoplasms in Swedish and Chinese male patient populations. Ann. Hematol. 2016, 95, 1825–1832. [Google Scholar] [CrossRef]
- Talamini, R.; Bosetti, C.; La Vecchia, C.; Dal Maso, L.; Levi, F.; Bidoli, E.; Negri, E.; Pasche, C.; Vaccarella, S.; Barzan, L.; et al. Combined effect of tobacco and alcohol on laryngeal cancer risk: A case-control study. Cancer Causes Control 2002, 13, 957–964. [Google Scholar] [CrossRef]
- Menvielle, G.; Luce, D.; Goldberg, P.; Bugel, I.; Leclerc, A. Smoking, alcohol drinking and cancer risk for various sites of the larynx and hypopharynx. A case-control study in France. Eur. J. Cancer Prev. 2004, 13, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Sheehan, D.; Meade, G.; Foley, V.M.; Dowd, C.A. Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem. J. 2001, 360 Pt 1, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Geisler, S.A.; Olshan, A.F. GSTM1, GSTT1, and the Risk of Squamous Cell Carcinoma of the Head and Neck: A Mini-HuGE Review. Am. J. Epidemiol. 2001, 154, 95–105. [Google Scholar] [CrossRef][Green Version]
- Hashibe, M.; Brennan, P.; Strange, R.C.; Bhisey, R.; Cascorbi, I.; Lazarus, P.; Ophuis, M.B.O.; Benhamou, S.; Foulkes, W.D.; Katoh, T.; et al. Meta- and Pooled Analyses of GSTM1, GSTT1, GSTP1, and CYP1A1 Genotypes and Risk of Head and Neck Cancer. Cancer Epidemiol. Biomark. Prev. 2003, 12, 1509–1517. [Google Scholar]
- Zhang, Y.; Ni, Y.; Zhang, H.; Pan, Y.; Ma, J.; Wang, L. Association between GSTM1 and GSTT1 allelic variants and head and neck squamous cell cancinoma. PLoS ONE 2012, 7, e47579. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Chen, W.; Ji, J.-F.; Wang, Z.-y.; Wu, M.-H.; Zhang, K.; Wang, Q.-P. GSTM1 null polymorphisms is associated with laryngeal cancer risk: A meta-analysis. Tumour Biol. 2014, 35, 6303–6309. [Google Scholar] [CrossRef]
- Liu, X.; Fan, Q.; Ni, L.; Liu, F.; Huang, S.; Gao, J.; Chen, B. GSTM1 null genotype is a risk factor for laryngeal cancer. Int. J. Clin. Exp. Med. 2015, 8, 7661–7666. [Google Scholar]
- Ying, X.-J.; Dong, P.; Shen, B.; Xu, C.-Z.; Xu, H.-M.; Zhao, S.-W. Glutathione S-Transferase M1 Gene Polymorphism and Laryngeal Cancer Risk: A Meta-Analysis. PLoS ONE 2012, 7, e42826. [Google Scholar] [CrossRef]
- Li, Q.; Wang, L.; Chen, Y.; Du, Y.; Kong, P.; Li, Y.; Xu, X. Polymorphisms of GSTM1, GSTT1 and susceptibility of laryngeal and hypopharyngeal carcinomas. Lin Chuang Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 2009, 23, 1105–1107, 1111. [Google Scholar]
- Unal, M.; Tamer, L.; Ates, N.A.; Akbas, Y.; Pata, Y.S.; Vayisoglu, Y.; Ercan, B.; Gorur, K.; Atik, U. Glutathione S-transferase M1, T1, and P1 gene polymorphism in laryngeal squamous cell carcinoma. Am. J. Otolaryngol. 2004, 25, 318–322. [Google Scholar] [CrossRef]
- Lourenço, G.J.; Silva, E.F.S.N.; Rinck-Junior, J.A.; Chone, C.T.; Lima, C.S.P. CYP1A1, GSTM1 and GSTT1 polymorphisms, tobacco and alcohol status and risk of head and neck squamous cell carcinoma. Tumour Biol. 2011, 32, 1209–1215. [Google Scholar] [CrossRef] [PubMed]
- Rebbeck, T.R. Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol. Biomark. Prev. 1997, 6, 733–743. [Google Scholar]
- Tian, S.; Zhang, J.; Xiao, Q.; Zhai, J.; Yan, X.; Huang, M.; Chen, F.; Li, Q.; Guan, Z. The association between genetic polymorphisms of GSTM1, GSTT1, GSTP1 and susceptibility to laryngeal carcinoma from the Han people in Guangdong zone. Lin Chuang Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 2011, 25, 204–210. [Google Scholar]
- Peters, E.S.; McClean, M.D.; Marsit, C.J.; Luckett, B.; Kelsey, K.T. Glutathione S-Transferase Polymorphisms and the Synergy of Alcohol and Tobacco in Oral, Pharyngeal, and Laryngeal Carcinoma. Cancer Epidemiol. Biomark. Prev. 2006, 15, 2196–2202. [Google Scholar] [CrossRef] [PubMed]
- Acar, H.; Ozturk, K.; Muslumanoglu, M.H.; Yildirim, M.S.; Cora, T.; Cilingir, O.; Ozer, B. Relation of glutathione S-transferase genotypes (GSTM1 and GSTT1) to laryngeal squamous cell carcinoma risk. Cancer Genet. Cytogenet. 2006, 169, 89–93. [Google Scholar] [CrossRef] [PubMed]
Polymorphism | DNA Extraction Kit | Specific Primer Sequence a | Temperature | Time | Cycles |
---|---|---|---|---|---|
TERTRs2736100 | Wizard Genomic DNA Purification Kit | GAAAAGCAGGGCGGGGGCACAAGCTA [A/C] AGAAACACTCAACACGGAAAACAAT | 95 °C | 10 min | X1 |
92 °C | 15 s | X40 | |||
60 °C | 1 min | ||||
GSTM1 | TaqMan™ Genotyping Master Mix | PF 5′-GAACTCCCTGAAAAGCTAAAGC-3′ | 94 °C | 5 min | X1 |
PR 5′-TTCCTTACTGGTCCTCACATCTC-3′ | 94 °C | 1 min | X35 | ||
GSTT1 | PF 5′-TTCCTTACTGGTCCTCACATCTC-3′ | 58 °C | 1 min | ||
PR 5′-TCACCGGATCATGGCCAGCA-3′ | 72 °C | 1 min | |||
72 °C | 10 min | Final extension |
Variables | Cases n = 92 (%) | Controls n = 101 (%) | χ2 a | p-Value |
---|---|---|---|---|
Gender | ||||
Male | 87 (94.57%) | 92 (91.09%) | 0.86 | 0.41 |
Female | 5 (5.43%) | 9 (8.91%) | ||
Age (years) | ||||
Mean | 60 ± 7.79 | 62 ± 6.59 | 3.85 | 0.06 |
<62 | 54 (58.7%) | 45 (44.44%) | ||
≥62 | 38 (41.30%) | 56 (55.45%) | ||
Tobacco consumption b | ||||
Mean | 29 ± 7.92 | 28 ± 7.21 | ||
<29 years | 31 (33.70%) | 45 (44.55%) | 2.37 | 0.14 |
≥29 years | 61 (66.30%) | 56 (55.45%) |
Polymorphism | Cases n = 92 (%) | Controls n = 101 (%) | χ2 a | p-Value e |
---|---|---|---|---|
TERTRs2736100 b | ||||
AA | 24 (26.09%) | 26 (25.74%) | 1.51 | 0.46 |
AC | 32 (34.78%) | 43 (42.57%) | ||
CC | 36 (39.13%) | 32 (31.68%) | ||
Alele C | 104 (%) | 107 (%) | 0.49 | 0.53 |
Alele A | 80 (%) | 95 (7%) | ||
GSTM1(+/−) c | ||||
positive (+) | 41 (44.57%) | 52 (51.49%) | 0.92 | 0.38 |
null (−) | 51 (55.43%) | 49 (48.51%) | ||
GSTT1(+/−) c | ||||
positive (+) | 61 (66.30%) | 81 (80.20%) | 4.78 | 0.03 |
null (−) | 31 (33.70%) | 20 (19.80%) | ||
GSTM1/GSTT1 d | ||||
Genotype 00 [GSTM1(+)/GSTT1(+)] | 28 (30.43%) | 43 (42.57%) | 5.67 | 0.12 |
Genotype 01 [GSTM1(+)/GSTT1(−)] | 12 (13.04%) | 9 (8.91%) | ||
Genotype 10 [GSTM1(−)/GSTT1(+)] | 33(35.87%) | 38 (37.62%) | ||
Genotype 11 [GSTM1(−)/GSTT1(−)] | 19 (20.65%) | 11 (10.89%) |
Genetic Model | Crude OR a (95% CI) | p-Value | Adjusted OR d (95% CI) | p-Value d |
---|---|---|---|---|
TERTRs2736100 | ||||
AA | (Ref) 1.00 b | (Ref) 1.00 b | ||
AC | 0.80 (0.36–1.76) | 0.58 | 0.80 (0.39–1.65) | 0.55 |
CC | 1.21 (0.55–2.70) | 0.7 | 1.21 (0.58–2.53) | 0.59 |
Dominant b | 0.98 (0.49–1.97) | 1 | 0.98 (0.51–1.87) | 0.95 |
Recessive b | 1.38 (0.73–2.61) | 0.29 | 1.38 (0.76–2.50) | 0.27 |
Allele C | (Ref) 1.00 b | 0.53 | (Ref) 1.00 b | 0.48 |
Allele A | 1.15 (0.75–1.75) | 1.15 (0.77–1.72) | ||
GSTM1(+/−) | ||||
GSTM1(+) | (Ref) 1.00 c | (Ref) 1.00 c | ||
GSTM1(−) | 1.31 (0.72–2.42) | 0.38 | 1.34 (0.76–2.36) | 0.3 |
GSTT1(+/−) | ||||
GSTT1(+) | (Ref) 1.00 c | (Ref) 1.00 c | ||
GSTT1(−) | 2.05 (1.02–4.19) | 0.03 | 2.05 (1.07–3.95) | 0.02 e |
GSTM1/GSTT1 | ||||
GSTM1(+)/GSTT1(+) | (Ref) 1.00 c | (Ref) 1.00 c | ||
GSTM1(+)/GSTT1(−) | 2.03 (0.68–6.25) | 0.21 | 2.04 (0.76–5.49) | 0.15 |
GSTM1(−)/GSTT1(+) | 1.33 (0.64–2.74) | 0.49 | 1.33 (0.68–2.59) | 0.39 |
GSTM1(−)/GSTT1(−) | 2.62 (1.01–7.12) | 0.03 | 2.65 (1.09–6.40) | 0.02 |
TERTRs2736100 C/A | |||||||
---|---|---|---|---|---|---|---|
Variables | Number of Cases/Controls | Adjusted OR a,b (95% CI) | |||||
AA c | AC c | CC c | AC vs. AA c | CC vs. AA c | (AC + CC) vs. AA c | CC vs. (AA + AC) c | |
Gender | |||||||
Male | 23/24 | 31/37 | 33/31 | 9.65 (3.51–26.51), p = 0.0000 d | 1.11 (0.52–2.35), p = 0.78 | 0.82 (0.42–1.62), p = 0.58 | 1.27 (0.68–2.35), p = 0.44 |
Female | 1/2 | 1/6 | 3/1 | 0.33 (0.01–8.15), p = 0.5 | 5.99 (0.22–162.17), p = 0.26 | 1.14 (0.07–16.91), p = 0.92 | 12 (0.77–186.36), p = 0.05 |
Age (in years) | |||||||
<62 | 16/13 | 17/16 | 21/16 | 0.86 (0.31–2.34), p = 0.77 | 1.07 (0.40–2.88), p = 0.87 | 0.96 (0.40–2.30), p = 0.93 | 1.27 (0.56–2.86), p = 0.55 |
≥62 | 8/13 | 15/27 | 15/16 | 0.90 (0.30–2.66), p = 0.85 | 1.52 (0.49–4.70), p = 0.46 | 1.47 (0.53–4.05), p = 0.44 | 1.63 (0.68–3.89), p = 0.27 |
Smoking status (in years) | |||||||
<29 | 7/12 | 8/17 | 16/16 | 0.80 (0.23–2.82), p = 0.73 | 1.71 (0.53–5.47), p = 0.35 | 1.24 (0.42–3.63), p = 0.68 | 1.933 (0.76–4.91), p = 0.16 |
p ≥ 29 | 17/14 | 24/26 | 20/16 | 0.76 (0.30–1.86), p = 0.54 | 1.02 (0.39–2.70), p = 0.95 | 0.90 (0.39–2.07), p = 0.81 | 1.21 (0.55–2.68), p = 0.62 |
Combined GSTM1/GSTT1 | |||||||
---|---|---|---|---|---|---|---|
Variables | Number of Cases/Controls | Adjusted OR a,b (95% CI) | |||||
Genotype 00 c | Genotype 01 c | Genotype 10 c | Genotype 11 c | Genotype 01 vs. Genotype 00 | Genotype 10 vs. Genotype 00 | Genotype 11 vs. Genotype 00 | |
Gender | |||||||
Male | 26/40 | 11/7 | 32/34 | 18/11 | 2.41 (0.83–7.03), p = 0.10 | 1.44 (0.72, 2.88), p = 0.29 e | 2.51 (1.02, 6.17), p = 0.04 e |
Female | 2/3 | 1/2 | 1/4 | 1/0 | 0.75 (0.03–14.99), p = 0.84 | 0.37 (0.03–17.50) p = 0.85 | d |
Age (in years) | |||||||
<62 | 15/17 | 8/4 | 22/20 | 9/4 | 2.26 (0.56–9.06), p = 0.23 | 1.24 (0.49–3.13), p = 0.63 | 2.73 (0.69–10.78), p = 0.13 |
≥62 | 13/26 | 4/5 | 11/18 | 10/7 | 1.60 (0.36–6.98), p = 0.53 | 1.22 (0.44–3.33), p = 0.69 | 2.85 (0.88–9.23), p = 0.07 |
Smoking status (in years) | |||||||
<29 | 8/23 | 6/4 | 16/14 | 1/4 | 2.87 (0.57–14.27), p = 0.19 | 3.28 (1.11–9.64), p = 0.02 | 0.71 (0.06–7.41), p = 0.77 |
≥29 | 20/20 | 6/5 | 17/24 | 18/7 | 1.19 (0.31–4.57), p = 0.78 | 2.57 (0.88–7.49), p = 0.07 | 0.70 (0.29–1.70), p = 0.44 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cornean, C.I.; Catana, A.; Maniu, A.A. Do Polymorphisms of the TERT, GSTM1, and GSTT1 Genes Increase Laryngeal Cancer Susceptibility in Smokers of Romanian Descent? Medicina 2022, 58, 1106. https://doi.org/10.3390/medicina58081106
Cornean CI, Catana A, Maniu AA. Do Polymorphisms of the TERT, GSTM1, and GSTT1 Genes Increase Laryngeal Cancer Susceptibility in Smokers of Romanian Descent? Medicina. 2022; 58(8):1106. https://doi.org/10.3390/medicina58081106
Chicago/Turabian StyleCornean, Corina Iulia, Andreea Catana, and Alma Aurelia Maniu. 2022. "Do Polymorphisms of the TERT, GSTM1, and GSTT1 Genes Increase Laryngeal Cancer Susceptibility in Smokers of Romanian Descent?" Medicina 58, no. 8: 1106. https://doi.org/10.3390/medicina58081106
APA StyleCornean, C. I., Catana, A., & Maniu, A. A. (2022). Do Polymorphisms of the TERT, GSTM1, and GSTT1 Genes Increase Laryngeal Cancer Susceptibility in Smokers of Romanian Descent? Medicina, 58(8), 1106. https://doi.org/10.3390/medicina58081106