Salivary Exosomal MicroRNA-486-5p and MicroRNA-10b-5p in Oral and Oropharyngeal Squamous Cell Carcinoma
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Cohorts
2.2. Saliva Harvesting
2.3. Exosome Isolation and Characterization
2.4. cDNA Synthesis and qRT-PCR
3. Results
Exosome Isolation and Characterization
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Johnson, D.E.; Burtness, B.; Leemans, C.R.; Lui, V.W.Y.; Bauman, J.E.; Grandis, J.R. Head and Neck Squamous Cell Carcinoma. Nat. Rev. Dis. Primer 2020, 6, 92. [Google Scholar] [CrossRef] [PubMed]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Guidi, A.; Codecà, C.; Ferrari, D. Chemotherapy and Immunotherapy for Recurrent and Metastatic Head and Neck Cancer: A Systematic Review. Med. Oncol. Northwood Lond. Engl. 2018, 35, 37. [Google Scholar] [CrossRef] [PubMed]
- Ferris, R.L.; Blumenschein, G., Jr.; Fayette, J.; Guigay, J.; Colevas, A.D.; Licitra, L.; Harrington, K.; Kasper, S.; Vokes, E.E.; Even, C.; et al. Nivolumab for Recurrent Squamous-Cell Carcinoma of the Head and Neck. N. Engl. J. Med. 2016, 375, 1865–1868. [Google Scholar] [CrossRef]
- Chung, I.-M.; Rajakumar, G.; Venkidasamy, B.; Subramanian, U.; Thiruvengadam, M. Exosomes: Current Use and Future Applications. Clin. Chim. Acta Int. J. Clin. Chem. 2020, 500, 226–232. [Google Scholar] [CrossRef]
- Milman, N.; Ginini, L.; Gil, Z. Exosomes and Their Role in Tumorigenesis and Anticancer Drug Resistance. Drug Resist. Updat. Rev. Comment. Antimicrob. Anticancer. Chemother. 2019, 45, 1–12. [Google Scholar] [CrossRef]
- Nonaka, T.; Wong, D.T.W. Saliva-Exosomics in Cancer: Molecular Characterization of Cancer-Derived Exosomes in Saliva. In Enzymes; Academic Press: Cambridge, MA, USA, 2017; Volume 42, pp. 125–151. [Google Scholar]
- Gai, C.; Camussi, F.; Broccoletti, R.; Gambino, A.; Cabras, M.; Molinaro, L.; Carossa, S.; Camussi, G.; Arduino, P.G. Salivary Extracellular Vesicle-Associated MiRNAs as Potential Biomarkers in Oral Squamous Cell Carcinoma. BMC Cancer 2018, 18, 439. [Google Scholar] [CrossRef]
- Vu, L.T.; Gong, J.; Pham, T.T.; Kim, Y.; Le, M.T.N. MicroRNA Exchange via Extracellular Vesicles in Cancer. Cell Prolif. 2020, 53, e12877. [Google Scholar] [CrossRef]
- Mohr, A.M.; Mott, J.L. Overview of MicroRNA Biology. Semin. Liver Dis. 2015, 35, 3–11. [Google Scholar] [CrossRef]
- Berindan-Neagoe, I.; Calin, G.A. Molecular Pathways: MicroRNAs, Cancer Cells, and Microenvironment. Clin. Cancer Res. 2014, 20, 6247–6253. [Google Scholar] [CrossRef]
- Friedman, R.C.; Farh, K.K.H.; Burge, C.B.; Bartel, D.P. Most Mammalian MRNAs Are Conserved Targets of MicroRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef]
- Langevin, S.; Kuhnell, D.; Parry, T.; Biesiada, J.; Huang, S.; Wise-Draper, T.; Casper, K.; Zhang, X.; Medvedovic, M.; Kasper, S. Comprehensive MicroRNA-Sequencing of Exosomes Derived from Head and Neck Carcinoma Cells in Vitro Reveals Common Secretion Profiles and Potential Utility as Salivary Biomarkers. Oncotarget 2017, 8, 82459–82474. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Ping, F.; Fan, Z.; Zhang, C.; Deng, M.; Cheng, B.; Xia, J. Salivary Exosomal MiR-24-3p Serves as a Potential Detective Biomarker for Oral Squamous Cell Carcinoma Screening. Biomed. Pharmacother. 2020, 121, 109553. [Google Scholar] [CrossRef] [PubMed]
- Farag, A.; Sabry, D.; Hassabou, N.; Alaa EL-Din, Y. MicroRNA-134/MicroRNA-200a Derived Salivary Exosomes Are Novel Diagnostic Biomarkers of Oral Squamous Cell Carcinoma. Egypt. Dent. J. 2021, 67, 367–377. [Google Scholar] [CrossRef]
- Byun, J.S.; Hong, S.H.; Choi, J.K.; Jung, J.K.; Lee, H.J. Diagnostic Profiling of Salivary Exosomal MicroRNAs in Oral Lichen Planus Patients. Oral Dis. 2015, 21, 987–993. [Google Scholar] [CrossRef]
- Hosein, M.; RCSE, F.; RCSI, F. Diagnostic Importance of Saliva—An Overview. JPDA 2019, 28, 129–135. [Google Scholar]
- Lousada-Fernandez, F.; Rapado-Gonzalez, O.; Lopez-Cedrun, J.L.; Lopez-Lopez, R.; Muinelo-Romay, L.; Suarez-Cunqueiro, M.M. Liquid Biopsy in Oral Cancer. Int. J. Mol. Sci. 2018, 19, 1704. [Google Scholar] [CrossRef]
- Ribeiro, I.P.; de Melo, J.B.; Carreira, I.M. Head and Neck Cancer: Searching for Genomic and Epigenetic Biomarkers in Body Fluids—The State of Art. Mol. Cytogenet. 2019, 12, 33. [Google Scholar] [CrossRef]
- Rapado-González, Ó.; Majem, B.; Muinelo-Romay, L.; Álvarez-Castro, A.; Santamaría, A.; Gil-Moreno, A.; López-López, R.; Suárez-Cunqueiro, M.M. Human Salivary MicroRNAs in Cancer. J. Cancer 2018, 9, 638–649. [Google Scholar] [CrossRef]
- Faur, C.I.; Rotaru, H.; Osan, C.; Jurj, A.; Roman, R.C.; Moldovan, M.; Chirila, M.; Hedesiu, M. Salivary Exosomal MicroRNAs as Biomarkers for Head and Neck Cancer Detection—A Literature Review. Maxillofac. Plast. Reconstr. Surg. 2021, 43, 19. [Google Scholar] [CrossRef]
- Zanoni, D.K.; Patel, S.G.; Shah, J.P. Changes in the 8th Edition of the American Joint Committee on Cancer (AJCC) Staging of Head and Neck Cancer: Rationale and Implications. Curr. Oncol. Rep. 2019, 21, 52. [Google Scholar] [CrossRef] [PubMed]
- Gallo, A.; Alevizos, I. Isolation of Circulating MicroRNA in Saliva. Methods Mol. Biol. Clifton 2013, 1024, 183–190. [Google Scholar] [CrossRef]
- Zahran, F.; Ghalwash, D.; Shaker, O.; Al-Johani, K.; Scully, C. Salivary MicroRNAs in Oral Cancer. Oral Dis. 2015, 21, 739–747. [Google Scholar] [CrossRef] [PubMed]
- Machida, T.; Tomofuji, T.; Ekuni, D.; Maruyama, T.; Yoneda, T.; Kawabata, Y.; Mizuno, H.; Miyai, H.; Kunitomo, M.; Morita, M. MicroRNAs in Salivary Exosome as Potential Biomarkers of Aging. Int. J. Mol. Sci. 2015, 16, 21294–21309. [Google Scholar] [CrossRef]
- Falamas, A.; Faur, C.I.; Ciupe, S.; Chirila, M.; Rotaru, H.; Hedesiu, M.; Cinta Pinzaru, S. Rapid and Noninvasive Diagnosis of Oral and Oropharyngeal Cancer Based on Micro-Raman and FT-IR Spectra of Saliva. Spectrochim. Acta. A Mol. Biomol. Spectrosc. 2021, 252, 119477. [Google Scholar] [CrossRef]
- Chandrashekar, D.S.; Karthikeyan, S.K.; Korla, P.K.; Patel, H.; Shovon, A.R.; Athar, M.; Netto, G.J.; Qin, Z.S.; Kumar, S.; Manne, U.; et al. UALCAN: An Update to the Integrated Cancer Data Analysis Platform. Neoplasia 2022, 25, 18–27. [Google Scholar] [CrossRef]
- Blackwell, R.H.; Foreman, K.E.; Gupta, G.N. The Role of Cancer-Derived Exosomes in Tumorigenicity & Epithelial-to-Mesenchymal Transition. Cancers 2017, 9, 105. [Google Scholar]
- Sahu, A.; Deshmukh, A.; Ghanate, A.D.; Singh, S.P.; Chaturvedi, P.; Murali Krishna, C. Raman Spectroscopy of Oral Buccal Mucosa: A Study on Age-Related Physiological Changes and Tobacco-Related Pathological Changes. Technol. Cancer Res. Treat. 2012, 11, 529–541. [Google Scholar] [CrossRef]
- Tevetoğlu, F.; Kara, S.; Aliyeva, C.; Yıldırım, R.; Yener, H.M. Delayed Presentation of Head and Neck Cancer Patients during COVID-19 Pandemic. Eur. Arch. Otorhinolaryngol. 2021, 278, 1. [Google Scholar] [CrossRef]
- Werner, M.T.; Carey, R.M.; Albergotti, W.G.; Lukens, J.N.; Brody, R.M. Impact of the COVID-19 Pandemic on the Management of Head and Neck Malignancies. Otolaryngol. Head Neck Surg. 2020, 162, 816–817. [Google Scholar] [CrossRef]
- (PDF) MiR-486-3p, MiR-139-5p, and MiR-21 as Biomarkers for the Detection of Oral Tongue Squamous Cell Carcinoma. Available online: https://www.researchgate.net/publication/312520637_miR-486-3p_miR-139-5p_and_miR-21_as_Biomarkers_for_the_Detection_of_Oral_Tongue_Squamous_Cell_Carcinoma (accessed on 27 July 2022).
- Furness, A.J.S.; Vargas, F.A.; Peggs, K.S.; Quezada, S.A. Impact of Tumour Microenvironment and Fc Receptors on the Activity of Immunomodulatory Antibodies. Trends Immunol. 2014, 35, 290–298. [Google Scholar] [CrossRef]
- Rakoff-Nahoum, S.; Medzhitov, R. Toll-like Receptors and Cancer. Nat. Rev. Cancer 2009, 9, 57–63. [Google Scholar] [CrossRef] [PubMed]
- Thomaidou, A.C.; Batsaki, P.; Adamaki, M.; Goulielmaki, M.; Baxevanis, C.N.; Zoumpourlis, V.; Fortis, S.P. Promising Biomarkers in Head and Neck Cancer: The Most Clinically Important MiRNAs. Int. J. Mol. Sci. 2022, 23, 8257. [Google Scholar] [CrossRef] [PubMed]
- Cooper, T.; Biron, V.L.; Adam, B.; Klimowicz, A.C.; Puttagunta, L.; Seikaly, H. Association of Keratinization With 5-Year Disease-Specific Survival in Oropharyngeal Squamous Cell Carcinoma. JAMA Otolaryngol. Neck Surg. 2015, 141, 250–256. [Google Scholar] [CrossRef] [PubMed]
- Kademani, D.; Bell, R.B.; Bagheri, S.; Holmgren, E.; Dierks, E.; Potter, B.; Homer, L. Prognostic Factors in Intraoral Squamous Cell Carcinoma: The Influence of Histologic Grade. J. Oral Maxillofac. Surg. 2005, 63, 1599–1605. [Google Scholar] [CrossRef]
- Reddy, S.P.; Raslan, W.F.; Gooneratne, S.; Kathuria, S.; Marks, J.E. Prognostic Significance of Keratinization in Nasopharyngeal Carcinoma. Am. J. Otolaryngol. 1995, 16, 103–108. [Google Scholar] [CrossRef]
- Panta, P. Oral Cancer Detection: Novel Strategies and Clinical Impact; Springer: Berlin, Germany, 2019; pp. 1–314. ISBN 978-3-319-61255-3. [Google Scholar]
- Granger, D.A.; Editors, M.K.T. Salivary Bioscience; Springer: Berlin, Germany, 2020; ISBN 9783030357832. [Google Scholar]
- Gallo, A.; Tandon, M.; Alevizos, I.; Illei, G.G. The Majority of MicroRNAs Detectable in Serum and Saliva Is Concentrated in Exosomes. PLoS ONE 2012, 7, e30679. [Google Scholar] [CrossRef]
- Yan, Z.; Dutta, S.; Liu, Z.; Yu, X.; Mesgarzadeh, N.; Ji, F.; Bitan, G.; Xie, Y.H. A Label-Free Platform for Identification of Exosomes from Different Sources. ACS Sens. 2019, 4, 488–497. [Google Scholar] [CrossRef]
- Lötvall, J.; Hill, A.F.; Hochberg, F.; Buzás, E.I.; Di Vizio, D.; Gardiner, C.; Gho, Y.S.; Kurochkin, I.V.; Mathivanan, S.; Quesenberry, P.; et al. Minimal Experimental Requirements for Definition of Extracellular Vesicles and Their Functions: A Position Statement from the International Society for Extracellular Vesicles. J. Extracell. Vesicles 2014, 3, 26913. [Google Scholar] [CrossRef]
- Stremersch, S.; Marro, M.; Pinchasik, B.-E.; Baatsen, P.; Hendrix, A.; De Smedt, S.C.; Loza-Alvarez, P.; Skirtach, A.G.; Raemdonck, K.; Braeckmans, K. Identification of Individual Exosome-like Vesicles by Surface Enhanced Raman Spectroscopy. Small 2016, 12, 3292–3301. [Google Scholar] [CrossRef]
- Chiabotto, G.; Gai, C.; Deregibus, M.C.; Camussi, G. Salivary Extracellular Vesicle-Associated ExRNA as Cancer Biomarker. Cancers 2019, 11, 891. [Google Scholar] [CrossRef] [PubMed]
- Chevillet, J.R.; Kang, Q.; Ruf, I.K.; Briggs, H.A.; Vojtech, L.N.; Hughes, S.M.; Cheng, H.H.; Arroyo, J.D.; Meredith, E.K.; Gallichotte, E.N.; et al. Quantitative and Stoichiometric Analysis of the MicroRNA Content of Exosomes. Proc. Natl. Acad. Sci. USA 2014, 111, 14888–14893. [Google Scholar] [CrossRef] [PubMed]
- Kalluri, R.; LeBleu, V.S. The Biology, Function, and Biomedical Applications of Exosomes. Science 2020, 367, eaau6977. [Google Scholar] [CrossRef] [PubMed]
- Park, N.J.; Zhou, H.; Elashoff, D.; Henson, B.S.; Kastratovic, D.A.; Abemayor, E.; Wong, D.T. Salivary MicroRNA: Discovery, Characterization, and Clinical Utility for Oral Cancer Detection. Clin. Cancer Res. 2009, 15, 5473–5477. [Google Scholar] [CrossRef] [PubMed]
- Nowicka, Z.; Stawiski, K.; Tomasik, B.; Fendler, W. Extracellular MiRNAs as Biomarkers of Head and Neck Cancer Progression and Metastasis. Int. J. Mol. Sci. 2019, 20, 4799. [Google Scholar] [CrossRef]
- Bhat, M.Y.; Advani, J.; Rajagopalan, P.; Patel, K.; Nanjappa, V.; Solanki, H.S.; Patil, A.; Bhat, F.A.; Mathur, P.; Nair, B.; et al. Cigarette Smoke and Chewing Tobacco Alter Expression of Different Sets of MiRNAs in Oral Keratinocytes. Sci. Rep. 2018, 8, 7040. [Google Scholar] [CrossRef]
- Lajer, C.; Nielsen, F.C.; Friis-Hansen, L.; Norrild, B.; Borup, R.; Garnaes, E.; Rossing, M.A.; Specht, L.; Therkildsen, M.H.; Nauntofte, B.; et al. Different MiRNA Signatures of Oral and Pharyngeal Squamous Cell Carcinomas: A Prospective Translational Study. Br. J. Cancer 2011, 104, 830–840. [Google Scholar] [CrossRef]
Assay Name | Assay ID | miRNA Sequence |
---|---|---|
hsa-miR-16-5p | 000391 | UAGCAGCACGUAAAUAUUGGCG |
hsa-miR-10b-5p | 002218 | UACCCUGUAGAACCGAAUUUGUG |
hsa-miR-486-5p | 001278 | UCCUGUACUGAGCUGCCCCGAG |
miR-10b-5p | miR-486-5p | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Median | Q1 | Q3 | IQR | p | Median | Q1 | Q3 | IQR | p | |
Keratinized SCC | 1.09 | 0.49 | 1.92 | 1.43 | 0.33 | 2.01 | 1.58 | 3.24 | 1.66 | 0.93 |
Non-keratinized SCC | 0.37 | 0.26 | 1.66 | 1.40 | 1.44 | 0.94 | 4.29 | 3.35 | ||
Stage II | 5.19 | 2.05 | 20.85 | 18.80 | 0.13 | 12.85 | 7.85 | 24.81 | 16.96 | 0.33 |
Stage III | 1.47 | 1.02 | 1.87 | 0.85 | 1.67 | 1.42 | 2.09 | 0.67 | ||
Stage IV | 0.59 | 0.28 | 1.53 | 1.25 | 1.51 | 0.80 | 2.80 | 2.00 | ||
Well-differentiated G1 SCC | 1.31 | 0.59 | 1.54 | 0.95 | 0.74 | 2.44 | 0.80 | 5.11 | 4.31 | 0.64 |
Intermediate-differentiated G2 SCC | 0.65 | 0.29 | 1.71 | 1.42 | 1.44 | 0.94 | 2.93 | 1.99 | ||
Poorly differentiated G3 SCC | 1.43 | 0.64 | 13.86 | 13.22 | 2.11 | 1.42 | 11.59 | 10.17 |
miR-486-5p | miR-10b-5p | |||||||
---|---|---|---|---|---|---|---|---|
AUC | Standard Error | 95% Confidence Interval | p-Value | AUC | Standard Error | 95% Confidence Interval | p-Value | |
Oral cavity | 0.67 | 0.08 | 0.50, 0.84 | 0.05 | 0.58 | 0.09 | 0.41, 0.76 | 0.33 |
Oropharynx | 0.89 | 0.06 | 0.76, 1.02 | 0.01 | 0.50 | 0.16 | 0.18, 0.82 | 0.97 |
Stage II | 1 | 0 | 1.00, 1.00 | <0.01 | 0.61 | 0.23 | 0.15, 1.08 | 0.51 |
Stage III | 0.75 | 0.09 | 0.56, 0.93 | 0.11 | 0.61 | 0.11 | 0.38, 0.84 | 0.47 |
Stage IV | 0.58 | 0.09 | 0.39, 0.77 | 0.36 | 0.68 | 0.08 | 0.51, 0.85 | 0.05 |
Well-differentiated G1 SCC | 0.71 | 0.17 | 0.36, 1.07 | 0.16 | 0.55 | 0.13 | 0.29, 0.82 | 0.68 |
Intermediate-differentiated G2 SCC | 0.66 | 0.09 | 0.47, 0.85 | 0.10 | 0.61 | 0.09 | 0.42, 0.80 | 0.25 |
Poorly differentiated G3 SCC | 0.79 | 0.11 | 0.57, 1.01 | 0.06 | 0.55 | 0.19 | 0.17, 0.92 | 0.74 |
Keratinized SCC | 0.71 | 0.08 | 0.54, 0.87 | 0.02 | 0.54 | 0.09 | 0.35, 0.72 | 0.66 |
Non-Keratinized SCC | 0.85 | 0.07 | 0.70, 1.00 | 0.02 | 0.67 | 0.14 | 0.38, 0.96 | 0.22 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Faur, C.I.; Roman, R.C.; Jurj, A.; Raduly, L.; Almășan, O.; Rotaru, H.; Chirilă, M.; Moldovan, M.A.; Hedeșiu, M.; Dinu, C. Salivary Exosomal MicroRNA-486-5p and MicroRNA-10b-5p in Oral and Oropharyngeal Squamous Cell Carcinoma. Medicina 2022, 58, 1478. https://doi.org/10.3390/medicina58101478
Faur CI, Roman RC, Jurj A, Raduly L, Almășan O, Rotaru H, Chirilă M, Moldovan MA, Hedeșiu M, Dinu C. Salivary Exosomal MicroRNA-486-5p and MicroRNA-10b-5p in Oral and Oropharyngeal Squamous Cell Carcinoma. Medicina. 2022; 58(10):1478. https://doi.org/10.3390/medicina58101478
Chicago/Turabian StyleFaur, Cosmin Ioan, Rareș Călin Roman, Ancuța Jurj, Lajos Raduly, Oana Almășan, Horațiu Rotaru, Magdalena Chirilă, Mădălina Anca Moldovan, Mihaela Hedeșiu, and Cristian Dinu. 2022. "Salivary Exosomal MicroRNA-486-5p and MicroRNA-10b-5p in Oral and Oropharyngeal Squamous Cell Carcinoma" Medicina 58, no. 10: 1478. https://doi.org/10.3390/medicina58101478
APA StyleFaur, C. I., Roman, R. C., Jurj, A., Raduly, L., Almășan, O., Rotaru, H., Chirilă, M., Moldovan, M. A., Hedeșiu, M., & Dinu, C. (2022). Salivary Exosomal MicroRNA-486-5p and MicroRNA-10b-5p in Oral and Oropharyngeal Squamous Cell Carcinoma. Medicina, 58(10), 1478. https://doi.org/10.3390/medicina58101478