Next Article in Journal
Effect of Hydrothermal Aging and Beverages on Color Stability of Lithium Disilicate and Zirconia Based Ceramics
Previous Article in Journal
Could the Combination of Two Non-Psychotropic Cannabinoids Counteract Neuroinflammation? Effectiveness of Cannabidiol Associated with Cannabigerol
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

TZAP Mutation Leads to Poor Prognosis of Patients with Breast Cancer

1
Department of Anatomy, School of Medicine, Keimyung University, Daegu 42601, Korea
2
Department of Surgery, School of Medicine, Keimyung University, Dongsan Medical Center, Daegu 42601, Korea
3
Department of Pathology, School of Medicine, Keimyung University, Dongsan Medical Center, Daegu 42601, Korea
*
Authors to whom correspondence should be addressed.
This article was previously presented on the Breast Cancer Symposium in San Antonio, Texas, USA, on 4–8 Dec. 2018.
These authors contributed equally to this work.
Medicina 2019, 55(11), 748; https://doi.org/10.3390/medicina55110748
Submission received: 1 October 2019 / Revised: 5 November 2019 / Accepted: 8 November 2019 / Published: 18 November 2019

Abstract

Background and Objectives: ZBTB48 is a telomere-associated factor that has been renamed as telomeric zinc finger-associated protein (TZAP). It binds preferentially to long telomeres, competing with telomeric repeat factors 1 and 2. Materials and Methods: We analyzed the TZAP mutation in 128 breast carcinomas (BCs). In addition, its association with telomere length was investigated. Results: The TZAP mutation (c.1272 G > A, L424L) was found in 7.8% (10/128) of the BCs and was associated with the N0 stage. BCs with the TZAP mutation had longer telomeres than those without this mutation. Survival analysis showed that the TZAP mutation resulted in poorer overall survival. Conclusions: These results suggest that the TZAP mutation is a possible prognostic marker in BC.

1. Introduction

Breast carcinoma (BC) represents a heterogeneous group of lesions in terms of clinical, histopathological, and molecular complexity, and biological diversity [1,2]. Early diagnosis of BC would improve the prospects of survival. Consequently, an increasing number of studies have focused on biomarkers for early diagnosis and new therapeutic targets for BC [3,4,5].
Telomeres, composed of six base pair (TTAGGG) repeat sequences, are nucleoprotein complexes capping each end of the eukaryotic chromosome [6]. In normal human somatic cells, telomeres have an average length of 5 to 15 kilobases and are shortened by ~30 to 200 base pairs at every cell division [6,7]. With continuous shortening, telomeres eventually reach a critical length that triggers replicative senescence and apoptosis [8]. Therefore, telomere length (TL) must be maintained within an optimal range for long-term survival [6,7,8].
Telomere shortening is counteracted by the reverse transcriptase telomerase in stem cells and in approximately 85% of all cancers, whereas the remaining cancers maintain telomeres with an alternative lengthening mechanism [9,10]. This telomere elongation mechanism induces overly long telomeres that are cut back to normal length by rapid shortening (i.e., telomere trimming) [11]. Regulation of this process has not been identified although a recent study reports characterization of a protein that is necessary for regulating TL [12]. These authors identified the zinc finger protein ZBTB48 as a telomere-associated factor and renamed it telomeric zinc finger-associated protein (TZAP). It binds preferentially to long telomeres competing with telomeric repeat factors 1 and 2 [12]. Overexpression of TZAP causes progressive telomere shortening. TZAP localizes to chromosome 1p36, a region that is frequently rearranged or deleted in various cancers [13,14]. Genetic changes of TZAP may be associated with cancer pathogenesis; however, studies on its genetics have not been performed in any cancers.
In the present study, we analyzed the TZAP mutation in BC. Based on previous studies [12,15], we also determined whether the TZAP mutation deregulated TL. The clinicopathological and prognostic characteristics of the TZAP mutation were investigated.

2. Materials and Methods

2.1. Patients and DNA Extraction

One hundred and twenty-eight patients diagnosed with BC were included in the study. BCs and adjacent non-neoplastic tissues were obtained from patients undergoing surgery in Keimyung University Dongsan Medical Center (Daegu, Korea) between 2011 and 2014. Tissue samples were provided from the Keimyung Human Bio-Resource Bank, Korea. All patients were educated of the study purpose and informed consent was obtained from each study participant. The protocols were approved by the Institutional Review Board of Keimyung University Dongsan Medical Center (approval #2014-03-038-002). The pathologist confirmed the quality of BC tissues and provided them according to the study design. Patients and their distributions were classified according to the seventh and revised eighth editions of the AJCC manual. Tumor areas and adjacent normal mucosa were used for DNA extraction using an extraction kit (Absolute DNA Extraction Kit, BioSewoom, Gyeongsangnam-do, South Korea) according to the manufacturer’s instructions. DNA quantity and quality were measured using a NanoDrop 1000 (Thermo Fisher Scientific, Pittsburgh, PA, USA).

2.2. Telomeric Zinc Finger-Associated Protein (TZAP) Mutation Analysis

The TZAP mutation was amplified from isolated DNA using the polymerase chain reaction (PCR). PCR was performed using AmpliTaq Gold DNA polymerase (Applied Biosystems; Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences are presented in Table 1. Thermocycling conditions were 40 cycles at 94 °C for 30 s, 55–57 °C for 30 s, and 72 °C for 60 s. The PCR products were separated electrophoretically on a 1.5% agarose gel and stained with ethidium bromide for 20 min to confirm the size of the bands. Direct DNA sequencing of TZAP was subsequently performed using an ABI 3730 DNA sequencer (Bionics, Seoul, South Korea).

2.3. Telomere Length (TL) Analysis

TL was analyzed by quantitative real-time PCR. For quantitative determination of TL relative to nuclear DNA, primers for specific amplification of the telomere (T) and nuclear DNA-encoded ß-globin (S) were selected as reported in a previous study. The primer sequences are presented in Table 1. Real-time PCR was performed on a LightCycler 480 II system (Roche Diagnostics, Mannheim, Germany). Relative TL was determined by calculating T/S values using the formula: T/S = 2-∆Ct, where ∆Ct = average Ct telomere - average Ct ß-globin. Each measurement was repeated in triplicate and then, average data was used. Five serially diluted control samples were included in each experiment.

2.4. Statistical Analyses

The SPSS statistical package, version 20.0 for Windows (IBM, Armonk, NY, USA), was used for all statistical analyses. Chi-square, Fischer’s exact, and Mann-Whitney U-tests were used to analyze the relationship between variables. Survival curves, constructed using the univariate Kaplan-Meier estimators, were compared using the log-rank test. Overall survival was defined as the time between diagnosis and mortality. A two-tailed probability <0.05 was required for statistical significance.

3. Results

3.1. The TZAP Mutation in Breast Cancer

Sequences of the TZAP region were successfully analyzed in all 128 BCs. Sequencing results were analyzed by two experienced scientists (JHL and YRH) with an intraclass correlation coefficient of 0.92 (p < 0.001). The mutation was found in 7.8% (10/128) patients. TZAP mutations were c.1272 G > A (L424L) as silent mutation (Figure 1A). This mutation has been reported previously in hepatocellular carcinomas [16].
Clinicopathological characteristics of TZAP mutations are summarized in Table 2. The TZAP mutation was found only in the N0 stage of BCs (p = 0.035). This mutation was more frequently found in BC patients with longer telomeres, though it did not reach statistical significance (15.8 vs. 4.4%, p = 0.064). Other characteristics were not associated with TZAP mutations.

3.2. TL in Breast Cancer

TL was analyzed successfully using real time PCR in 128 BCs. TL was calculated in paired normal and tumor tissues. The average TL in BC was 1.10 ± 0.36 (standard deviation) when comparing the ratio of TL in tumors to that of paired normal tissues. For consideration of the association between clinicopathological characteristics and the TL and in BC, two groups, “longer” and “shorter” for TL, were assigned based on the mean TL value (Table 3) [17]. Telomere elongation was shown in 29.7% (38/128) of BCs and was significantly higher in luminal A and triple negative BCs (p < 0.001). The Mann-Whitney test showed that telomeres with the TZAP mutation were longer than those of wild-type TZAP (2.62 ± 1.71 vs. 0.98 ± 0.37, p = 0.007, Figure 1B). However, it did not have any clinicopathological value in BCs.

3.3. Prognostic Value of the TZAP Mutation in BC

We assessed survival to clarify the prognostic significance of the TZAP mutation in patients with BC. The median follow-up of patients for survival analysis was 46.7 months (range: 3–96 months). The results of the univariate survival analysis performed using a Kaplan–Meier curve revealed a shorter overall survival in BC patients with the TZAP mutation (52.8 vs. 87.3 months, χ2 = 4.37, p = 0.037; Figure 2A). However, TL did not have any prognostic value for patients with BC (65.2 vs. 86.7 months, χ2 = 0.013, p = 0.908; Figure 2B).

4. Discussion

In this study, we identified the TZAP mutation, for the first time, in BC. TZAP mutations have not yet been studied and rare mutations are only reported in the International Cancer Genome Consortium data [16]. We found that the c.1272 G > A TZAP mutation occurred frequently in patients with BC. Previously, this has been only reported by studies investigating hepatocellular carcinoma [16]; however, the same was not observed in 100 tissue samples of colorectal cancer and non-cancerous tissue (unpublished data). And we confirm that it is not single nucleotide polymorphism in many data bases. This mutation is a silent mutation, however, previous study demonstrated that silent mutation also contributes to alter transcript splicing affecting protein function as oncogenic [18]. Thus, this mutation may be BC-specific, although this needs to be confirmed.
Previous studies demonstrated that overexpression of TZAP caused progressive telomere shortening [12,15]. In agreement with these studies, our data showed that BCs with the TZAP mutation had longer telomeres than those with wild-type TZAP. It is suggested that disabling TZAP by this mutation causes dysregulation of telomere trimming [19,20]. However, the sample size with the TZAP mutation was extremely small. Therefore, additional research should be carried out to support this possible theory about the presence of longer telomeres in cancers with the TZAP mutation. We already demonstrated a positive correlation between TZAP and TERT as key regulators of telomere length in various cancers, though it was not found in BC. It also supports our hypothesis that TZAP may affect the telomere length in cancers. Additional investigations looking into how the TZAP mutation affects the molecular mechanisms of telomere crosstalk with other cellular processes are also warranted.
The TZAP mutation and telomere length change have clinicopathological significance in BCs. Interestingly, the TZAP mutation was not found in N1 and N2 stages of BCs, suggesting that this mutation occurs in the early stage of breast carcinogenesis. However, this mutation was associated with poorer overall survival. Multivariate analysis showed that the TZAP mutation did not have independent prognostic value for BC. The Cancer Genome Atlas (TCGA) data analysis showed that lower expression of TZAP was associated with poor prognosis in BC (Figure 3) [21]. TZAP mutations may induce the loss of its expression contributing to poor prognosis. The prognosis of BC depends on many factors, such as tumor grade, estrogen and progesterone receptor expression, and the expression of human epidermal growth factor 2 [1,2,3]. Therefore, further studies with a larger number of patients, and additional data, should be performed to clarify the precise mechanism of the TZAP mutation in BC.

5. Conclusions

In summary, the results of our study have demonstrated, for the first time, a poorer prognosis in BC patients with the TZAP mutation. This suggests that the TZAP mutation may have an important role in the progression of BC through effects on TL. The results of the present study warrant future large-scale studies to elucidate the underlying molecular mechanisms of TZAP and to clarify this hypothesis.

Author Contributions

Conceptualization, Y.-R.H., M.-H.L., J.C. and J.-H.L.; methodology, Y.-R.H., S.-Y.K.; validation, M.-H.L. and J.-H.L.; formal analysis, J.C. and J.-H.L.; investigation, Y.-R.H., M.-H.L., J.C. and J.-H.L.; resources, M.-H.L., S.-Y.K. and J.C.; data curation, Y.-R.H., M.-H.L., J.C. and J.-H.L.; writing—original draft preparation, Y.-R.H. and M.-H.L.; writing—review and editing, Y.-R.H., M.-H.L., S.-Y.K., J.C. and J.-H.L.; visualization, Y.-R.H. and J.-H.L.; supervision, J.C. and J.-H.L.; project administration, J.-H.L.

Funding

This study was supported by grants from the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the Ministry of Education (NRF-2014R1A6A3A04058057), and by the Korean Government (MSIP) (No. 2014R1A5A2010008).

Acknowledgments

The manuscript has been seen and approved by all authors.

Conflicts of Interest

There is no conflict of interest for authors

References

  1. Perou, C.M.; Sørlie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S.; Rees, C.A.; Pollack, J.R.; Ross, D.T.; Johnsen, H.; Akslen, L.A.; et al. Molecular portraits of human breast tumours. Nature 2000, 406, 747–752. [Google Scholar] [CrossRef] [PubMed]
  2. Petruccelli, N.; Daly, M.B.; Feldman, G.L. Hereditary breast and ovarian cancer due to mutations in BRCA1 and BRCA2. Genet. Med. 2010, 12, 245–259. [Google Scholar] [CrossRef] [PubMed]
  3. Reis-Filho, J.S.; Lakhani, S.R. The diagnosis and management of preinvasive breast disease: Genetic alterations in pre-invasive lesions. Breast Cancer Res. 2003, 5, 313–319. [Google Scholar] [CrossRef] [PubMed]
  4. Abdel-Fatah, T.M.; Powe, D.G.; Hodi, Z.; Reis-Filho, J.S.; Lee, A.H.; Ellis, I.O. Morphologic and molecular evolutionary pathways of low nuclear grade invasive breast cancers and their putative precursor lesions: Further evidence to support the concept of low nuclear grade breast neoplasia family. Am. J. Surg. Pathol. 2008, 32, 513–523. [Google Scholar] [CrossRef] [PubMed]
  5. Rakha, E.A.; Reis-Filho, J.S.; Ellis, I.O. Basal-like breast cancer: A critical review. J. Clin. Oncol. 2008, 26, 2568–2581. [Google Scholar] [CrossRef] [PubMed]
  6. Harley, C.B.; Futcher, A.B.; Greider, C.W. Telomeres shorten during ageing of human fibroblasts. Nature 1990, 345, 458–460. [Google Scholar] [CrossRef] [PubMed]
  7. Blackburn, E.H.; Greider, C.W.; Szostak, J.W. Telomeres and telomerase: The path from maize, Tetrahymena and yeast to human cancer and aging. Nat. Med. 2006, 12, 1133–1138. [Google Scholar] [CrossRef] [PubMed]
  8. Xin, H.; Liu, D.; Songyang, Z. The telosome/shelterin complex and its functions. Genome Biol. 2008, 9, 232. [Google Scholar] [CrossRef] [PubMed]
  9. Shay, J.W.; Wright, W.E. Role of telomeres and telomerase in cancer. Semin. Cancer Biol. 2011, 21, 349–353. [Google Scholar] [CrossRef] [PubMed]
  10. Jafri, M.A.; Ansari, S.A.; Alqahtani, M.H.; Shay, J.W. Roles of telomeres and telomerase in cancer, and advances in telomerase-targeted therapies. Genome Med. 2016, 8, 69. [Google Scholar] [CrossRef] [PubMed]
  11. Pickett, H.A.; Cesare, A.J.; Johnston, R.L.; Neumann, A.A.; Reddel, R.R. Control of telomere length by a trimming mechanism that involves generation of t-circles. EMBO J. 2009, 28, 799–809. [Google Scholar] [CrossRef] [PubMed]
  12. Li, J.S.; Miralles, F.J.; Simavorian, T.; Bartocci, C.; Tsai, J.; Karlseder, J.; Lazzerini, D.E. TZAP: A telomere-associated protein involved in telomere length control. Science 2017, 355, 638–641. [Google Scholar] [CrossRef] [PubMed]
  13. Maris, J.M.; Jensen, S.J.; Sulman, E.P.; Beltinger, C.P.; Gates, K.; Allen, C.; Biegel, J.A.; Brodeur, G.M.; White, P.S. Cloning, chromosomal localization, physical mapping, and genomic characterization of HKR3. Genomics 1996, 35, 289–298. [Google Scholar] [CrossRef] [PubMed]
  14. White, P.S.; Maris, J.M.; Sulman, E.P.; Jensen, S.J.; Kyemba, S.M.; Beltinger, C.P.; Allen, C.; Kramer, D.L.; Biegel, J.A.; Brodeur, G.M. Molecular analysis of the region of distal 1p commonly deleted in neuroblastoma. Eur. J. Cancer 1997, 33, 1957–1961. [Google Scholar] [CrossRef]
  15. Jahn, A.; Rane, G.; Paszkowski-Rogacz, M.; Sayols, S.; Bluhm, A.; Han, C.T.; Draškovič, I.; Londoño-Vallejo, J.A.; Kumar, A.P.; Buchholz, F. ZBTB48 is both a vertebrate telomere-binding protein and a transcriptional activator. EMBO Rep. 2017, 18, 929–946. [Google Scholar] [CrossRef] [PubMed]
  16. The COSMIC, the Catalogue of Somatic Mutations in Cancer. Available online: http://cancer.sanger.ac.uk/cosmic/mutation/overview?id=3705990/ (accessed on 01 February 2019).
  17. Thriveni, K.; Raju, A.; Kumar, R.V.; Krishnamurthy, S.; Chaluvarayaswamy, R. Patterns of Relative Telomere Length in Associated with hTERT Gene Expression in the Tissue of Breast Cancer Patients. Clin. Breast Cancer 2018, 19, 27–34. [Google Scholar] [CrossRef] [PubMed]
  18. Zheng, S.; Kim, H.; Verhaak, R.G.W. Silent Mutations Make Some Noise. Cell 2014, 156, 1129–1131. [Google Scholar] [CrossRef] [PubMed]
  19. Lossaint, G.; Lingner, J. TZAP or not to zap telomeres. Science 2017, 355, 578–579. [Google Scholar] [CrossRef] [PubMed]
  20. Zlotorynski, E. Chromosome biology: TZAP trims telomeres. Nat. Rev. Mol. Cell Biol. 2017, 18, 140. [Google Scholar] [CrossRef] [PubMed]
  21. Gyorffy, B.; Lanczky, A.; Eklund, A.C.; Denkert, C.; Budczies, J.; Li, Q.; Szallasi, Z. An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1809 patients. Breast Cancer Res. Treat. 2010, 123, 725–731. [Google Scholar] [CrossRef] [PubMed]
Figure 1. (A) Telomeric zinc finger-associated protein (TZAP) mutation (1272 G/A) in breast carcinomas (BCs). (B) Telomere length difference according to TZAP mutation status.
Figure 1. (A) Telomeric zinc finger-associated protein (TZAP) mutation (1272 G/A) in breast carcinomas (BCs). (B) Telomere length difference according to TZAP mutation status.
Medicina 55 00748 g001
Figure 2. Survival analysis in BCs. (A) Overall survival of TZAP mutation. (B) Overall survival of telomere length.
Figure 2. Survival analysis in BCs. (A) Overall survival of TZAP mutation. (B) Overall survival of telomere length.
Medicina 55 00748 g002
Figure 3. The Cancer Genome Atlas (TCGA) data analysis for prognostic value of TZAP expression. (A) Disease free survival. (B) Overall survival.
Figure 3. The Cancer Genome Atlas (TCGA) data analysis for prognostic value of TZAP expression. (A) Disease free survival. (B) Overall survival.
Medicina 55 00748 g003
Table 1. Primer sequences used in this study.
Table 1. Primer sequences used in this study.
Primer SequencesExon
TZAP 1F: CCAGACCTCAACAGCACAGA
R: CACAGCCCACGAACCTAGTG
1
TZAP 2F: ATCCCATTGGCCGTTCTCT
R: CCGGCACAGTGAGAGGAT
2
TZAP 3F: TAGAGGCCAACTTCCCGTTT
R: CCTGGGCACAGTACCTCATT
3
TZAP 4F: CCTGCTGATTCATTTGGTGA
R: GGAATGGCAGACAGGAAAAG
4
TZAP 5F: GGAGGTGAGGAAGTTGACCA
R: CCCTTCTAAGGGGAACAAGTG
5
TZAP 6F: GCTTGTCCCTGCACCTTAAC
R: GGAGAGGGCAACACATAACC
5
TZAP 7F: AGTCTGTCTGGGCCTGAGAA
R: CCCTCCCTGTCACTTACTGC
5
TZAP 8F: CCCTTCCCTGCTCTCACC
R: AAGAGAGAACGGGCGACAC
6
TZAP 9F: GTCACTTCCCTTGGTGATGG
R: GAGGGGACCAGTGGTTTACA
7
TZAP 10F: CTGGGTGGCACTGGAGAG
R: CACGGGAACAGACTGTCAGG
8
Telomere lengthF: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT
R: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT
β-globinF: TGTGCTGGCCCATCACTTTG
R: ACCAGCCA-CCACTTTCTGATAGG
F, forward; R, reverse.
Table 2. Clinicopathological characteristics of TZAP mutation in breast cancers.
Table 2. Clinicopathological characteristics of TZAP mutation in breast cancers.
TZAP
Wild (N, %)Mutant (N, %)p
Total118 (92.2)10 (7.8)
Age 0.253
<6580 (94.1)5 (5.9)
≥6538 (88.4)5 (11.6)
BMI 0.494
<2544 (91.7)4 (8.3)
≥2532 (86.5)5 (13.5)
T stage 0.706
T135 (89.7)4 (10.3)
T277 (93.9)5 (6.1)
T35 (83.3)1 (16.7)
T41 (100)0 (0)
N stage 0.035
N069 (87.3)10 (12.7)
N133 (100)0 (0)
N216 (100)0 (0)
Subtype 0.259
Luminal A43 (87.8)6 (12.2)
Luminal B38 (97.4)1 (2.6)
HER2-enriched11 (100)0 (0)
TN26 (89.7)3 (10.6)
Telomere length 0.064
Short86 (95.6)4 (4.4)
Long32 (84.2)6 (15.8)
BMI, body mass index; T, tumor size; N, lymph nodes; TN, triple negative.
Table 3. Clinicopathological characteristics of telomere length in breast cancers.
Table 3. Clinicopathological characteristics of telomere length in breast cancers.
Telomere Length
Short (N, %)Long (N, %)p
Total90 (70.3)38 (29.7)
Age 0.613
<6561 (71.8)24 (28.2)
≥6529 (67.4)14 (32.6)
BMI 0.127
<2536 (75.0)12 (25.0)
≥2522 (59.5)15 (40.5)
T stage 0.647
T128 (71.8)11 (28.2)
T258 (70.7)24 (29.3)
T33 (50.0)3 (50.0)
T41 (100)0 (0)
N stage 0.314
N063 (79.7)16 (20.3)
N123 (69.7)10 (30.3)
N214 (87.5)2 (12.5)
Subtype <0.001
Luminal A28 (57.1)21 (42.9)
Luminal B39 (100)0 (0)
HER2-enriched11 (100)0 (0)
TN22 (75.9)7 (24.1)
TZAP mutation 0.064
Wild86 (72.9)32 (27.1)
Mutant4 (40.0)6 (60.0)

Share and Cite

MDPI and ACS Style

Heo, Y.-R.; Lee, M.-H.; Kwon, S.-Y.; Cho, J.; Lee, J.-H. TZAP Mutation Leads to Poor Prognosis of Patients with Breast Cancer . Medicina 2019, 55, 748. https://doi.org/10.3390/medicina55110748

AMA Style

Heo Y-R, Lee M-H, Kwon S-Y, Cho J, Lee J-H. TZAP Mutation Leads to Poor Prognosis of Patients with Breast Cancer . Medicina. 2019; 55(11):748. https://doi.org/10.3390/medicina55110748

Chicago/Turabian Style

Heo, Yu-Ran, Moo-Hyun Lee, Sun-Young Kwon, Jihyoung Cho, and Jae-Ho Lee. 2019. "TZAP Mutation Leads to Poor Prognosis of Patients with Breast Cancer " Medicina 55, no. 11: 748. https://doi.org/10.3390/medicina55110748

APA Style

Heo, Y.-R., Lee, M.-H., Kwon, S.-Y., Cho, J., & Lee, J.-H. (2019). TZAP Mutation Leads to Poor Prognosis of Patients with Breast Cancer . Medicina, 55(11), 748. https://doi.org/10.3390/medicina55110748

Article Metrics

Back to TopTop