Boiogito Ameliorates Inflammation-Associated Adipocyte Dysfunction and Restores Adipogenesis in Association with Suppression of NF-κB Signaling
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Media
2.2. Differentiation of 3T3-L1 Cells
2.3. Experimental Design
2.3.1. Differentiation Model
2.3.2. Mature Adipocyte Model
2.4. Cell Viability Assessment
2.5. Oil Red O Staining
2.6. Enzyme-Linked Immunosorbent Assay
2.7. RT-qPCR
2.8. Western Blotting
2.9. Statistical Analysis
3. Results
3.1. Cytotoxicity During Adipocyte Differentiation
3.2. Effects of BOT on Inflammation During Adipocyte Differentiation
3.2.1. BOT Modulates Lipid Accumulation and Adiponectin Secretion
3.2.2. BOT Regulates Adipogenic Gene Expression
3.2.3. BOT Suppresses Inflammatory Cytokine Production
3.2.4. BOT Inhibits NF-κB Signaling
3.3. Effects of BOT on Inflammation in Mature Adipocytes
3.3.1. BOT Modulates Lipid Accumulation and Adiponectin Secretion
3.3.2. BOT Regulates Adipogenic Gene Expression
3.3.3. BOT Suppresses Inflammatory Cytokine Production
3.3.4. BOT Inhibits NF-κB Signaling
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BOT | Boiogito |
| C/EBPα | CCAAT/enhancer-binding protein α |
| FFA | free fatty acids |
| IκB | Inhibitor of κB |
| IL-6 | Interleukin-6 |
| MCP-1 | Monocyte chemoattractant protein-1 |
| NF-κB | Nuclear factor kappa B |
| PPARγ | Peroxisome proliferator-activated receptor γ |
| P-IκB | Phosphorylated IκB |
| P-p65 | Phosphorylated p65 |
| TNF-α | Tumor necrosis factor-α |
References
- Mo, Z.; Yang, Y.; Wu, Z.; Guan, B.; Cheng, L.; Ding, W.; Wu, L.; Huang, S.; Xie, J.; Yang, J. Association between neutrophil-to-HDL cholesterol ratio and insulin resistance in individuals with obesity: Cross-sectional study of Chinese and U.S. cohorts. Lipids 2026. ahead of print. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lumish, H.S.; O’Reilly, M.; Reilly, M.P. Sex differences in genomic drivers of adipose distribution and related cardiometabolic disorders: Opportunities for precision medicine. Arter. Thromb. Vasc. Biol. 2020, 40, 45–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hotamisligil, G.S. Inflammation, metaflammation, and immunometabolic disorders. Nature 2017, 542, 177–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gregor, M.F.; Hotamisligil, G.S. Inflammatory mechanisms in obesity. Annu. Rev. Immunol. 2011, 29, 415–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tilg, H.; Ianiro, G.; Gasbarrini, A.; Adolph, T.E. Adipokines: Masterminds of metabolic inflammation. Nat. Rev. Immunol. 2025, 25, 250–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.A.; Choi, K.M. Newly discovered adipokines: Pathophysiological link between obesity and cardiometabolic disorders. Front. Physiol. 2020, 11, 568800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kershaw, E.E.; Flier, J.S. Adipose tissue as an endocrine organ. J. Clin. Endocrinol. Metab. 2004, 89, 2548–2556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Gao, H.; Hasegawa, Y.; Lu, X. Fight against fibrosis in adipose tissue remodeling. Am. J. Physiol. Endocrinol. Metab. 2021, 321, E169–E175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, J.; Qian, H.; An, Y.; Chu, L.; Tan, D.; Qin, C.; Sun, Q.; Wang, Y.; Qi, W. PPARγ and C/EBPα enable adipocyte differentiation upon inhibition of histone methyltransferase PRC2 in malignant tumors. J. Biol. Chem. 2024, 300, 107765. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, M.; Yang, L.; Wang, H.; Chen, Y.; Chen, X.; Hu, Q.; Sun, H. Research progress into adipose tissue macrophages and insulin resistance. Physiol. Res. 2023, 72, 287–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stephens, J.M.; Lee, J.; Pilch, P.F. Tumor necrosis factor-alpha-induced insulin resistance in 3T3-L1 adipocytes is accompanied by a loss of insulin receptor substrate-1 and GLUT4 expression without a loss of insulin receptor-mediated signal transduction. J. Biol. Chem. 1997, 272, 971–976. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cawthorn, W.P.; Sethi, J.K. TNF-alpha and adipocyte biology. FEBS Lett. 2008, 582, 117–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petrascu, F.M.; Matei, S.C.; Olteanu, G.E.; Barna, R.; Marian, C. Canonical NF-κB pathway as a central regulator of obesity-associated inflammation: A narrative review. Biomedicines 2025, 13, 3050. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mobeen, A.; Joshi, S.; Fatima, F.; Bhargav, A.; Arif, Y.; Faruq, M.; Ramachandran, S. NF-κB signaling is the major inflammatory pathway for inducing insulin resistance. 3 Biotech 2025, 15, 47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakadate, K.; Ito, N.; Kawakami, K.; Yamazaki, N. Anti-inflammatory actions of plant-derived compounds and prevention of chronic diseases: From molecular mechanisms to applications. Int. J. Mol. Sci. 2025, 26, 5206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rayalam, S.; Della-Fera, M.A.; Baile, C.A. Phytochemicals and regulation of the adipocyte life cycle. J. Nutr. Biochem. 2008, 19, 717–726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayaraman, S.; Prasad, M.; Natarajan, S.R.; Krishnamoorthy, R.; Alshuniaber, M.A.; Gatasheh, M.K.; Veeraraghavan, V.P.; Rajagopal, P.; Palanisamy, C.P. Molecular mechanisms underlying the effects of beta-sitosterol on TGF-β1/Nrf2/SIRT1/p53-mediated signaling in the kidney of a high-fat diet- and sucrose-induced type-2 diabetic rat. Chem. Biol. Interact. 2025, 411, 111443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Li, S.; Wang, Y.; Pu, W.; Liu, Q.; Zhang, Y.; Liu, Y.; Hao, H. Fangji Huangqi Decoction alleviates rheumatoid arthritis through regulating HIF-1α mediated the angiogenesis and the balance between autophagy and apoptosis. J. Ethnopharmacol. 2024, 329, 118061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majima, T.; Inoue, M.; Kasahara, Y.; Onodera, T.; Takahashi, D.; Minami, A. Effect of the Japanese herbal medicine, Boiogito, on the osteoarthritis of the knee with joint effusion. Sports. Med. Arthrosc. Rehabil. Ther. Technol. 2012, 4, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, S. Pharmacological mechanisms of Boiogito and Bofutsushosan in diabetes and obesity models. Yakugaku. Zasshi. 2018, 138, 389–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamakawa, J.; Moriya, J.; Takeuchi, K.; Nakatou, M.; Motoo, Y.; Kobayashi, J. Significance of kampo, Japanese traditional medicine, in the treatment of obesity: Basic and clinical evidence. Evid. Based Complement. Altern. Med. 2013, 2013, 943075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, K.; Wu, X.; Han, G.; Sun, L.; Zheng, C.; Hou, H.; Xu, B.B.; El-Bahy, Z.M.; Qian, C.; Kallel, M.; et al. Phyllostachys nigra (Lodd. ex Lindl.) derived polysaccharide with enhanced glycolipid metabolism regulation and mice gut microbiome. Int. J. Biol. Macromol. 2024, 257, 128588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramírez-Zacarías, J.L.; Castro-Muñozledo, F.; Kuri-Harcuch, W. Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with Oil Red O. Histochemistry 1992, 97, 493–497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kraus, N.A.; Ehebauer, F.; Zapp, B.; Rudolphi, B.; Kraus, B.J.; Kraus, D. Quantitative assessment of adipocyte differentiation in cell culture. Adipocyte 2016, 5, 351–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, W.; Song, H.; Cai, W.; Shen, X. Real-time monitoring of inhibition of adipogenesis and angiogenesis by (−)-epigallocatechin-3-gallate in 3T3-L1 adipocytes and human umbilical vein endothelial cells. Nutrients 2015, 7, 8871–8886. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chae, G.N.; Kwak, S.J. NF-κB is involved in the TNF-α-induced inhibition of the differentiation of 3T3-L1 cells by reducing PPARγ expression. Exp. Mol. Med. 2003, 35, 431–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Höpfinger, A.; Schmid, A.; Schweitzer, L.; Patz, M.; Weber, A.; Schäffler, A.; Karrasch, T. Regulation of cathelicidin antimicrobial peptide (CAMP) gene expression by TNFα and cfDNA in adipocytes. Int. J. Mol. Sci. 2023, 24, 15820. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jack, B.U.; Mamushi, M.; Viraragavan, A.; Dias, S.; Pheiffer, C. Comparing the effects of tumor necrosis factor alpha, lipopolysaccharide and palmitic acid on lipid metabolism and inflammation in murine 3T3-L1 adipocytes. Life Sci. 2022, 297, 120422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruan, H.; Hacohen, N.; Golub, T.R.; Van Parijs, L.; Lodish, H.F. Tumor necrosis factor-alpha suppresses adipocyte-specific genes and activates expression of preadipocyte genes in 3T3-L1 adipocytes: Nuclear factor-kappaB activation by TNF-alpha is obligatory. Diabetes 2002, 51, 1319–1336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, H.; Li, Q.; Li, M.; Zou, X.; Bai, N.; Yu, Z.; Zhang, J.; Zhang, D.; Zhang, Q.; Wang, J.; et al. Ajuba functions as a co-activator of C/EBPβ to induce expression of PPARγ and C/EBPα during adipogenesis. Mol. Cell. Endocrinol. 2022, 539, 111485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernandez-Quiles, M.; Broekema, M.F.; Kalkhoven, E. PPARgamma in metabolism, immunity, and cancer: Unified and diverse mechanisms of action. Front. Endocrinol. 2021, 12, 624112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sethi, J.K.; Hotamisligil, G.S. Metabolic messengers: Tumour necrosis factor. Nat. Metab. 2021, 3, 1302–1312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.H.; Hao, Y.M.; Liu, X.F.; Gao, X.; Wang, B.Z.; Takahashi, K.; Du, L. Docosahexaenoic acid-enriched phospholipids and eicosapentaenoic acid-enriched phospholipids inhibit tumor necrosis factor-alpha-induced lipolysis in 3T3-L1 adipocytes by activating sirtuin 1 pathways. Food Funct. 2021, 12, 4783–4796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, D.; Bing, C.; Griffiths, H.R. Disrupted adipokine secretion and inflammatory responses in human adipocyte hypertrophy. Adipocyte 2025, 14, 2485927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawai, T.; Autieri, M.V.; Scalia, R. Adipose tissue inflammation and metabolic dysfunction in obesity. Am. J. Physiol. Cell. Physiol. 2021, 320, C375–C391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Liu, Z.; Li, W.; Kang, Y.; Xu, Z.; Li, X.; Gao, Y.; Qi, Y. MAPKs/AP-1, not NF-κB, is responsible for MCP-1 production in TNF-α-activated adipocytes. Adipocyte 2022, 11, 477–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, J.; Wu, D.; Qiu, Y. Adipose tissue macrophage in obesity-associated metabolic diseases. Front. Immunol. 2022, 13, 977485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhen, Y.; Shu, W.; Hou, X.; Wang, Y. Innate immune system orchestrates metabolic homeostasis and dysfunction in visceral adipose tissue during obesity. Front. Immunol. 2021, 12, 702835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, M.Y.; Tong, Q.Y. Anti-inflammation effects of sinomenine on macrophages through suppressing activated TLR4/NF-κB signaling pathway. Curr. Med. Sci. 2020, 40, 130–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Zhu, Y.; Gao, L.; Yin, H.; Xie, Z.; Wang, D.; Zhu, Z.; Han, X. Formononetin attenuates IL-1β-induced apoptosis and NF-κB activation in INS-1 cells. Molecules 2012, 17, 10052–10064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Watanabe, Y.; Nagai, Y.; Honda, H.; Okamoto, N.; Yamamoto, S.; Hamashima, T.; Ishii, Y.; Tanaka, M.; Suganami, T.; Sasahara, M.; et al. Isoliquiritigenin attenuates adipose tissue inflammation in vitro and adipose tissue fibrosis through inhibition of innate immune responses in mice. Sci. Rep. 2016, 6, 23097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, J.E.; Han, J.S. Improving the effect of ferulic acid on inflammation and insulin resistance by regulating the JNK/ERK and NF-κB pathways in TNF-α-treated 3T3-L1 adipocytes. Nutrients 2024, 16, 294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foley, K.P.; Chen, Y.; Barra, N.G.; Heal, M.; Kwok, K.; Tamrakar, A.K.; Chi, W.; Duggan, B.M.; Henriksbo, B.D.; Liu, Y.; et al. Inflammation promotes adipocyte lipolysis via IRE1 kinase. J. Biol. Chem. 2021, 296, 100440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kojta, I.; Chacińska, M.; Błachnio-Zabielska, A. Obesity, bioactive lipids, and adipose tissue inflammation in insulin resistance. Nutrients 2020, 12, 1305. [Google Scholar] [CrossRef] [Scilit] [PubMed]











| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| PPARγ | TCACAATGCCATCAGGT | GCGGGAAGGACTTTATGTA |
| C/EBPα | GCCCCTCAGTCCCTGTCTTTA | AGCCCTCCACCTCCCTGTAG |
| β-actin | CCTCTATGCCAACACAGT | AGCCACCAATCCACACAG |
| Target Protein | Antibody (Catalog No.) | Dilution | Source |
|---|---|---|---|
| Phospho-NF-κB p65 | P-p65 (#3033) | 1:1000 | Cell Signaling Technology |
| p65 (total) | p65 (10475-1-AP) | 1:1000 | Proteintech |
| Phospho-IκBα | P-IκBα (#2859) | 1:1000 | Cell Signaling Technology |
| IκB (total) | IκB (10268-1-AP) | 1:1000 | Proteintech |
| β-actin | β-actin (#5125) | 1:1000 | Cell Signaling Technology |
| Rabbit IgG (Secondary Antibody) | Anti-rabbit IgG (#7074) | 1:2000 | Cell Signaling Technology |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Luo, Y.; Hu, A.; Lu, J.; Yuan, W.; Tan, Y.; Yamaguchi, T.; Kawakami, Z.; Ikarashi, Y.; Harada, Y.; Kobayashi, H. Boiogito Ameliorates Inflammation-Associated Adipocyte Dysfunction and Restores Adipogenesis in Association with Suppression of NF-κB Signaling. Curr. Issues Mol. Biol. 2026, 48, 693. https://doi.org/10.3390/cimb48070693
Luo Y, Hu A, Lu J, Yuan W, Tan Y, Yamaguchi T, Kawakami Z, Ikarashi Y, Harada Y, Kobayashi H. Boiogito Ameliorates Inflammation-Associated Adipocyte Dysfunction and Restores Adipogenesis in Association with Suppression of NF-κB Signaling. Current Issues in Molecular Biology. 2026; 48(7):693. https://doi.org/10.3390/cimb48070693
Chicago/Turabian StyleLuo, Yi, Ailing Hu, Jingya Lu, Wenshu Yuan, Yu Tan, Takuji Yamaguchi, Zenji Kawakami, Yasushi Ikarashi, Yoshinao Harada, and Hiroyuki Kobayashi. 2026. "Boiogito Ameliorates Inflammation-Associated Adipocyte Dysfunction and Restores Adipogenesis in Association with Suppression of NF-κB Signaling" Current Issues in Molecular Biology 48, no. 7: 693. https://doi.org/10.3390/cimb48070693
APA StyleLuo, Y., Hu, A., Lu, J., Yuan, W., Tan, Y., Yamaguchi, T., Kawakami, Z., Ikarashi, Y., Harada, Y., & Kobayashi, H. (2026). Boiogito Ameliorates Inflammation-Associated Adipocyte Dysfunction and Restores Adipogenesis in Association with Suppression of NF-κB Signaling. Current Issues in Molecular Biology, 48(7), 693. https://doi.org/10.3390/cimb48070693

