Next Article in Journal
Comparison of ABQ-48 Multimodal Cytotoxicity Mechanism Against Lung, Colorectal, and Breast Cancer Cells
Previous Article in Journal
Measles: An Updated Literature Review of the Host Response, Pathogenesis, Complications, Prevention Measures, and Recent Outbreaks
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
CIMB
Volume 48
Issue 2
10.3390/cimb48020207
cimb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Rhus coriaria Linn Extract as a Natural Inhibitor of Influenza A Virus Replication In Vitro

by
Carla Prezioso
1,2,
Maria Luisa Savo Sardaro
1,3,*,
Flavio Frezza
2,
Dolores Limongi
1,2,
Salvatore Velotto
1,
Leonardo Lupacchini
4,
Giovanni D’Auria
5,
Marta De Angelis
6,7,
Lucia Nencioni
6 and
Paola Checconi
1,2,*
1
Department for the Promotion of Human Sciences and Quality of Life, San Raffaele University, Via di Val Cannuta 247, 00166 Rome, Italy
2
Laboratory of Microbiology, IRCCS San Raffaele Roma, Via di Val Cannuta 247, 00166 Rome, Italy
3
Department of Anthropology, Northwestern University, Evanston, IL 60208, USA
4
Laboratory of Molecular and Cellular Neurobiology, IRCCS San Raffaele Roma, Via di Val Cannuta 247, 00166 Rome, Italy
5
Department of Agricultural Sciences, University of Naples Federico II, 80055 Portici, Italy
6
Department of Public Health and Infectious Diseases, Laboratory Affiliated to Istituto Pasteur Italia-Fondazione Cenci Bolognetti, Sapienza University, 00185 Rome, Italy
7
Laboratory of Virology, Department of Molecular Medicine, Sapienza University, 00185 Rome, Italy
*
Authors to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2026, 48(2), 207; https://doi.org/10.3390/cimb48020207
Submission received: 16 January 2026 / Revised: 9 February 2026 / Accepted: 10 February 2026 / Published: 13 February 2026
(This article belongs to the Special Issue Molecular and Real-World Evidence Research of Respiratory Diseases and Infections, 2nd Edition)
Browse Figures
Versions Notes

Abstract

Influenza A viruses remain a major public health threat due to their high mutation rates, antigenic variability, and the emergence of resistance to current antivirals, underscoring the need for novel therapeutic options. Natural compounds rich in polyphenols and flavonoids have attracted increasing attention as potential broad-spectrum antiviral agents. In this study, the activity of Rhus coriaria L. water extract against Influenza A virus in BEAS-2B human bronchial epithelial cells was investigated. Cell viability assay identified non-cytotoxic concentrations, up to 0.1 mg/mL, which were used in infection experiments. Viral replication was assessed at multiple levels by quantitative real-time PCR, western blotting, immunofluorescence and tissue culture infectious dose 50% (TCID50). Treatment with R. coriaria extract resulted in a dose-dependent and statistically significant reduction of viral load. The extract decreased mRNA levels of Hemagglutin (HA), Neuraminidase (NA) and Matrix protein 2 (M2). Consistently, western blot analysis showed a decrease in major viral proteins HA, Nucleoprotein (NP), Matrix protein 1 (M1) and Polymerase Acidic protein (PA). Confocal images revealed a marked reduction in HA and PA signals, results that are statistically significant according to quantitative fluorescence evaluation. The convergence of results obtained through independent methodologies at both the transcriptional and protein levels highlight the robustness of the findings. These data provide the experimental evidence that Rhus coriaria interferes with influenza A virus replication in airway epithelial cells and support its further investigation as a promising phytochemical platform for the development of novel anti-influenza strategies.

1. Introduction

Influenza viruses are responsible for recurring seasonal epidemics and occasional pandemics, posing a persistent threat to global public health [1]. In particular, Influenza A viruses are characterized by high mutation rates and frequent antigenic shifts, which complicate vaccine development and reduce the efficacy of existing antiviral drugs [2]. Current therapies, such as neuraminidase and polymerase inhibitors, often suffer from limited efficacy, potential side effects, and the emergence of resistant viral strains [3,4,5]. These limitations underscore the need for novel, effective and safe antiviral agents.
In recent years, there has been a growing interest in exploring natural products as alternative or complementary antiviral therapies [6,7,8,9]. Among these, polyphenol- and flavonoid-rich plant extracts have drawn particular attention due to their broad-spectrum antiviral effects, antioxidant and anti-inflammatory properties, and favorable safety profiles [10,11,12,13]. These bioactive compounds act through multiple mechanisms, including inhibition of viral entry, replication, and assembly, as well as modulation of host cell responses [12,13,14]. Their low cost, ease of extraction, and environmentally sustainable production make them attractive candidates in the context of global health and green pharmaceutical development.
Rhus coriaria Linn (R. coriaria L.), also known as Sumac, has been traditionally used in Mediterranean and Middle Eastern medicine, and, together with other species of the genus Rhus, has been extensively studied over the last decades for its biological and pharmacological properties [15,16,17]. Sumac extracts, in fact, exhibit antimicrobial, anti-inflammatory, and antioxidant activities, attributed to their high content of tannins, gallic acid, quercetin, kaempferol, catechins, anthocyanins and other phenolics [17,18].
Importantly, the antiviral potential of Sumac has been demonstrated, too, in some studies. Aqueous and ethanolic extracts of R. coriaria and other Rhus spp. have shown inhibitory effects against hepatitis B virus (HBV) [19,20], herpes simplex virus (HSV) [21], human immunodeficiency virus (HIV) [22,23], and influenza virus [24], but, in the latter, various Rhus spp., different from Rhus coriaria L., were tested. Sumac-derived phytochemicals have shown antiviral activity as well [25]. Some Sumac polyphenols have shown strong binding affinities to key viral proteins, such as to SARS-CoV-2 main protease, through computational and in vitro approaches [26,27]. Recently, components isolated from Sumac were found to be effective in inhibiting different viruses, too, particularly against members of Herpesviridae subfamilies, highlighting their potential as broad-spectrum antivirals [28].
However, to our knowledge, no studies have yet investigated the antiviral activity of Rhus coriaria L. water extract specifically against Influenza virus, in a cell model of infection. Neither cellular nor mechanistic evidence is available.
Therefore, the aim of the present study is to investigate the antiviral effects of Rhus coriaria water extract against Influenza A virus in an in vitro bronchial epithelial cell model. In particular, we evaluated whether treatment with Rhus coriaria extract could interfere with viral replication; we consistently observed a reduction in viral propagation through independent experimental approaches, without cytotoxic effects.
These findings could contribute to expanding the evidence base for natural antiviral compounds and highlight the potential of Rhus coriaria as a candidate for novel antiviral therapeutic strategies.

2. Materials and Methods

2.1. Preparation of Rhus coriaria Extract

The fruits pericarp of Rhus coriaria L. were collected from a wild population grown in Kawkaba in southern Lebanon (33° 23′ 44″ N, 35° 38′ 18″ E). The variety selected had an ORAC value (Oxygen Radical Absorbance Capacity) of 319,130 μmol TE/100 g. The pericarp was used for the preparation of aqueous extracts. The dried pericarp was homogenized in distilled water and incubated in a water bath at 40 °C for 1.5 h, as described elsewhere [29]. Following extraction, the water extracts were filtered and frozen.

2.2. High Resolution LC–MS/MS Analysis

Mass spectrometry analyses were performed by using an EXPLORIS 120 Orbitrap mass spectrometer coupled to a Vanquish-Horizon Flex HPLC system (Thermo Scientific, Waltham, MA, USA). Before loading, the Sumac extract was first micro-filtered through a 0.22 μm filter. Analytes were separated on a C18 reverse phase column (AccucoreTM aQ 100 × 2.1 mm, particle size 2.6 μm) at a flow rate of 0.3 mL/min with a gradient from 0% to 15% of solvent B (0.1% formic acid in 100% acetonitrile) over 35 min; from 15% to 45% of solvent B in 5 min and from 45% to 98% of solvent B in 5 min. Solvent A was 0.5% formic acid in ultrapure water. Acetonitrile, ultra-pure water and formic acid were purchased from Fisher Scientific and were of LC/MS grade. The MS/MS acquisition method was set up in a data-dependent acquisition mode with a full scan in the 70 to 1000 m/z range. Up to 4 of the most intense ions in MS1 were selected for fragmentation in MS/MS mode with a fragmentation ramp of 30, 40, 50 and 60% HCD normalised collision energies. A resolving power of 120,000 full width at half maximum (FWHM), an automatic gain control (AGC) target of 1 × 106 ions and a maximum ion injection time (IT) of 100 ms were set to generate precursor spectra. MS/MS fragmentation spectra were obtained at a resolving power of 60,000 FWHM. The generated spectra were manually evaluated for the presence of organic acids, phenolic compounds and anthocyanins using both the Mass Bank database and the relevant literature [30,31,32,33,34]. For the semi-quantitative analysis, the peak intensities of each compound were expressed as a percentage of the sum of intensities of all identified compounds, representing their relative composition (%). This calculation was performed separately for both negative and positive ionization modes.

2.3. Cell Cultures

BEAS-2B human bronchial epithelial cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and grown in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% fetal bovine serum (FBS), 0.3 mg/mL glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin.

2.4. Virus Infection and Titration

Influenza virus A/Puerto Rico/8/34 H1N1 (PR8) was propagated in 10-day embryonated eggs and harvested after 48 h. Confluent monolayers of BEAS-2B cells were infected at 1 m.o.i. or 0.1 m.o.i. for 1 h at 37°. After viral adsorption, the cells were washed with phosphate-buffered saline (PBS) and then incubated with medium supplemented with 2% FBS for 8 h or 24 h. Viral RNA, for the hemagglutinin (HA) gene, was determined in the supernatants of infected cells by qRT-PCR; standard curves using plasmid standards allowed viral RNA to be quantified in Log10 copies/mL, as described previously [35]. Virus infectivity was determined by the tissue culture infectious dose 50% (TCID50) assay from the same supernatants; briefly, confluent monolayers of MDCK cells, plated in 96-well plates, were inoculated with 10-fold dilutions of the samples and incubated for 3 days. The number of wells showing positive cytopathic effect was scored, and the TCID50 titer was calculated according to the interpolating procedure of Reed and Muench [36].

2.5. Cell Treatment

Cytotoxicity was evaluated on BEAS-2B cells by treating the cells with different concentrations of Rhus coriaria extract (0.01–0.05–0.1–0.5–1 and 5 mg/mL). After 24 h, the cytotoxicity of the treatments was evaluated by the 3-(4,5-dimethyl-2-thiazolyl)-2,5 diphenyl tetrazolium bromide (MTT) assay. For the evaluation of antiviral activity, Rhus coriaria extract was diluted to the final concentrations in the cell-culture medium and added after infection, at 8 h or 24 h of infection.

2.6. RNA Extraction and Quantitative Reverse Transcription-PCR (qRT-PCR)

Total RNA was extracted from cells using TRIzol reagent (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocol. RNA concentration and purity were assessed by spectrophotometry (NanoDrop; A260/280 = 1.9–2.1). For viral RNA quantification in cell lysates, one-step qRT-PCR was performed using SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Thermo Fisher Scientific) on an AMPLilab™ Real-Time PCR System (Adaltis, Rome, Italy). Primer sequences used to detect hemagglutinin, neuraminidase and the matrix protein 2 (HA, NA, M2) gene were designed on the basis of the published genome sequences of Influenza A virus A/PR/8/34 (H1N1), retrieved from GenBank (accession numbers NC_002016, NC_002023) and originally described by Winter et al. [37]. Primers were subsequently checked for specificity using NCBI BLAST+ 2.17.0 against the Influenza Virus Resource, and only primers showing perfect matching to the target regions and no relevant off-target hits were selected. The primer sequences were as follows: HA F: TGGGGCCATTGCCGGTTTCA, R: TGCCCCCAGGGAGACTACCA; NA F: GCCCAGACAATGGGGCAGTGG, R: CCGTCTGGCCAAGACCAACCC; M2 F: GCAAGCGATGAGAACCATTGG, R: GCGGCAATAGCGAGAGGATC; GAPDH F: GGGTGTGAACCATGAGAA, R: GCTAAGCAGTTGGTGGTGC. All primer sets are routinely employed and validated in our laboratory and have previously shown amplification efficiencies within the acceptable MIQE range (90–110%) [38]. Amplification was carried out under standard SYBR Green conditions using primers with Tm values in the range of ~58–62 °C; therefore, an annealing temperature of 60 °C was used for all primer sets. The thermal program consisted of reverse transcription at 50 °C for 15 min and initial denaturation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. A melt-curve analysis was performed at the end of each run to confirm amplification specificity. Gene expression was normalized to GAPDH using the 2−ΔΔCt method [39].

2.7. Western Blot Analysis

After 24 h of infection and treatment, cells were lysed using RIPA buffer containing PMSF and protease inhibitor cocktail (Sigma-Aldrich). Protein concentration was determined using the DC Protein Assay Kit (Bio-Rad, Hercules, CA, USA). Equal amounts of protein were resolved by SDS-PAGE (percentages of acrylamide of 10 and 12%) in reducing conditions (by addition of DTT) and transferred to nitrocellulose membranes. Then membranes were blocked in 5% non-fat dry milk and incubated overnight at 4 °C with primary antibodies against Influenza A virus proteins (anti-Influenza A, Merck Millipore, Burlington, MA, USA, cat. AB1074, anti-polymerase acidic protein, PA, Invitrogen, Carlsbad, CA, USA, cat. PA5-32223, both at 1:1000 dilution) and GAPDH (Santa Cruz Biotechnology, Dallas, TX, USA, cat. sc-47724, at 1:1000 dilution). After washing, membranes were incubated with species-appropriate secondary horseradish peroxidase-conjugated antibodies: anti-goat, anti-rabbit and anti-mouse (Bethyl Laboratories, Montgomery, TX, USA, cat. A50-101P, A120-101P, A90116P, respectively, all diluted 1:10,000). Detection was carried out using WesternBright ECL substrate (Advansta, San Jose, CA, USA), and densitometric analysis was performed using ImageJ software v1.53t (National Institutes of Health, Bethesda, MD, USA).

2.8. Immunofluorescence Analysis

Following PR8 infection, as described above, BEAS-2B cells were fixed with methanol, permeabilized with 0.1% Triton X-100, blocked with 3% milk, and stained with anti-HA antibody (Santa Cruz Biotechnology, cat. sc-52025) and anti-PA (Invitrogen, cat. PA5-32223). Alexa Fluor 546-conjugated anti-mouse and 488-conjugated anti-rabbit were used as secondary antibodies. Nuclei were stained with 4′6-diamidino-2-phenylindole (DAPI). Coverslips were mounted in ProLong Glass medium and analyzed using a Nikon Eclipse Ti2 confocal fluorescence microscope (Nikon Europe B.V., Amstelveen, The Netherlands). Images were acquired as z-stacks and 4 × 4 tiled fields at 60× magnification. Maximum intensity projections (MIP) were generated and processed under identical acquisition and analysis settings for all conditions. For quantitative evaluation, mean fluorescence intensity (MFI) of HA- or PA-positive cells was measured using ImageJ/Fiji v2.14.0 (National Institutes of Health, USA).

2.9. Statistical Analysis

Data were obtained from at least three independent experiments and are presented as mean ± standard deviation (SD). Statistical significance between two experimental groups was determined using a two-tailed Student’s t-test. For experiments including more than two groups, data were analyzed by one-way analysis of variance (ANOVA) followed by Dunnett’s multiple-comparison post hoc test. A p-value < 0.05 was considered statistically significant. For immunofluorescence analysis, a minimum of nine independent fields per condition were analyzed. Quantitative data were statistically assessed using an unpaired two-tailed Student’s t-test, and a p-value < 0.05 was considered significant.

3. Results

3.1. Phytochemical Analysis

Phytochemical composition of Rhus coriaria water extract was characterized by LC–MS/MS analysis, as described in the Section 2 and reported in Table 1 and Table 2.

3.2. Antiviral Activity

Different concentrations of Rhus coriaria extract were tested for their effect on cell viability. In particular, BEAS-2B cells were treated with extract concentrations ranging from 0.01 to 5 mg/mL, for 24 h, microscopically observed and subjected to MTT assay, as described in Materials and Methods, to exclude cytotoxicity. In Figure 1a, the values of cell viability were reported as percentages of control cells (100%). The concentrations from 0.5 to 5 mg/mL were excluded as cell viability was lower than 90%.
Then we tested the antiviral activity of three concentrations of R. coriaria (0.01–0.05–0.1 mg/mL) on PR8-infected BEAS-2B cells. As shown in Figure 1b, viral load was reduced in a dose-dependent manner by extract, with a statistically significant reduction observed at concentrations of 0.05 and 0.1 mg/mL (p < 0.01). The highest concentration (0.1 mg/mL) was therefore selected for subsequent experiments. To test viral infectivity, TCID50 assay was performed with supernatants collected from PR8-infected cells treated and not treated with R. coriaria extract, confirming a significantly lower viral titer in treated samples (Figure 1c).
Cimb 48 00207 g001
Figure 1. R. coriaria extract reduced Influenza virus titer in dose-dependent manner without cytotoxic effect. (a) BEAS-2B cells were treated with different concentrations of extract (ranging from 0.01 to 5 mg/mL) for 24 h; cell viability was evaluated by MTT assay and expressed as percentage of control. (b) BEAS-2B cells were infected with Influenza virus A/PR8 (0.1 m.o.i.) and treated with no cytotoxic concentrations of extract (0.01–0.05–0.1 mg/mL). Viral load was quantified by qRT-PCR in supernatants for 24 h p.i., using HA-specific primers. Data are shown as mean ± SD (n = 3). Statistical analysis was performed using one-way ANOVA followed by Dunnett’s post hoc test versus infected sample. (c) TCID50 from supernatants of PR8-infected and PR8-infected and treated with 0.1 mg/mL extract cells, collected 24 h p.i. Data are shown as mean ± SD of four different experiments (n = 4), * p < 0.01.
Figure 1. R. coriaria extract reduced Influenza virus titer in dose-dependent manner without cytotoxic effect. (a) BEAS-2B cells were treated with different concentrations of extract (ranging from 0.01 to 5 mg/mL) for 24 h; cell viability was evaluated by MTT assay and expressed as percentage of control. (b) BEAS-2B cells were infected with Influenza virus A/PR8 (0.1 m.o.i.) and treated with no cytotoxic concentrations of extract (0.01–0.05–0.1 mg/mL). Viral load was quantified by qRT-PCR in supernatants for 24 h p.i., using HA-specific primers. Data are shown as mean ± SD (n = 3). Statistical analysis was performed using one-way ANOVA followed by Dunnett’s post hoc test versus infected sample. (c) TCID50 from supernatants of PR8-infected and PR8-infected and treated with 0.1 mg/mL extract cells, collected 24 h p.i. Data are shown as mean ± SD of four different experiments (n = 4), * p < 0.01.
Cimb 48 00207 g001

3.3. Real-Time PCR Analysis of Viral Gene Expression

To investigate the impact of Rhus coriaria on the Influenza A virus replication cycle, we first analyzed, at the transcriptional level, the expression of viral genes HA, NA and M2, and quantified them by real-time PCR using the comparative ΔΔCt method (reference gene: GAPDH). In PR8-infected cells treated with R. coriaria extract, at 6 h p.i., for all three genes, a moderate but significant reduction in mRNA levels was observed compared with untreated infected samples, with slightly different degrees of inhibition (fold change values of 0.6 for HA, 0.7 for NA, 0.55 for M2, Figure 2).

3.4. Western Blot Detection of Viral Proteins

To determine whether these changes in transcript levels were reflected at the protein levels, western blot analysis was performed on infected cells for 24 h p.i. As shown in Figure 3a, treatment with Rhus coriaria led to a reduction in the expression for all four of the analyzed viral proteins (HA, NP, M1 and PA); this reduction was confirmed by densitometric analysis values and means of the ratio protein/GAPDH, and used as a loading control protein (Figure 3b). The inhibition in percentage ranged from 35 to 54%, respectively, for NP and HA.

3.5. Immunofluorescence Visualization of Viral Proteins

The effect of Rhus coriaria extract on viral proteins was further examined by immunofluorescence. In particular, the protein resulted most inhibited, HA, was stained at 24 h p.i., in the same conditions as previous experiments. Nine independent fields were acquired per coverslip under identical acquisition settings. Confocal microscopy images (Figure 4) showed a clear reduction in HA fluorescence in treated cells compared with untreated infected samples. We repeated an immunofluorescence analysis, but this time performing the experiment at higher multiplicity of infection (1 m.o.i.) to visualize a higher number of infected cells. We stained Influenza PA at 8 h p.i. and, as before, nine independent fields were acquired per coverslip under identical acquisition settings. Confocal microscopy images (Figure 5) showed an evident reduction in PA fluorescence in treated cells compared with untreated infected samples. A quantitative evaluation of the images, for both experiments, therefore for both infection conditions, was performed, revealing a significant decrease in the percentage of infected cells when they were treated with the extract (Figure 6), providing additional confirmation of the inhibitory effect of Rhus coriaria on Influenza A virus replication.

4. Discussion

In this study, we observed that Rhus coriaria L. water extract exerts a significant antiviral effect against Influenza A virus in human bronchial epithelial cells. The water extract exhibited a rich spectrum of bioactive compounds, including high levels of gallic acid among phenolic compounds, together with delphinidin-based anthocyanins and organic acids such as malic acid. Our results demonstrate that treatment with this extract reduces the expression of viral genes HA, NA, and M2, and markedly decreases the levels of the viral proteins HA, NP, M1 and PA. The consistency of these findings was confirmed by independent and complementary methodological approaches. Real-time PCR revealed a reduction in viral transcripts, western blotting analysis showed a decrease in the major viral proteins, and immunofluorescence provided direct visualization of reduced viral protein expression in infected cells. In addition, viral titration assays demonstrated a significant inhibition of viral load. The convergence of these results at both the transcriptional and protein levels, obtained through different methodologies, represents a major strength of our study and reinforces the reliability of the conclusions.
When compared with the available literature, our findings support that the antiviral activity of Sumac is not confined to a single virus but may reflect broader properties of its phytochemical composition. In hepatitis B virus models, Rhus coriaria extract significantly reduced the release of surface (HBsAg) and precore (HBeAg) antigens in hepatocytes [19], while, in our respiratory model, we observed a comparable effect with the downregulation of the Influenza structural proteins that are essential for viral assembly and spread. In the context of coronaviruses, the polyphenolic preparation Rutan, derived from Rhus coriaria, showed clinical efficacy by reducing viral load and inflammatory parameters in COVID-19 patients, consistent with biochemical evidence of inhibition of viral proteases and RNA polymerase [40]. Although these observations involve different viral families, the common outcome of the reduced expression of viral proteins and functional enzymes supports the hypothesis that Sumac phytocomplexes may exert multi-target antiviral effects across diverse viruses. Moreover, as shown for other natural extracts, both viral and cellular proteins and pathways could be targeted [41]. More specifically towards Influenza viruses, Rhus verniciflua ethanol extract showed anti-Influenza activity by neuraminidase inhibition [24]; biflavonoids isolated from related species such as Rhus succedanea and amentaflavone, present in many plants, have been reported to inhibit Influenza A and B in vitro [25,42]. However, it is important to highlight that the phytochemical composition of Rhus coriaria fruit aqueous extract investigated here is fundamentally different from the antiviral preparations previously reported within the Rhus genus. Most studies have used organic or hydroalcoholic extracts from leaves, bark or wood, resulting in phytochemical profiles dominated by flavonoids, chalcones or high-molecular-weight gallotannins [24,25,26,27,28,42]. By contrast, our extract—obtained from the edible fruit pericarp and prepared in water—exhibited a markedly different composition, being enriched in low-molecular-weight organic and phenolic acids, flavonol glycosides and delphinidin-based anthocyanins, with minimal gallotannin content. Notably, while the semi-quantitative data allow reliable comparison of relative abundances within the same batch, absolute quantification of each relevant compound using a targeted approach would be necessary to evaluate reproducibility across different laboratories or between separate Sumac batches. Future studies could determine the absolute concentration of the phytoconstituents of interest to facilitate inter-laboratory comparisons and assess batch-to-batch variability.
Gallic acid, the dominant phenolic acid in our extract, showed potent antioxidant and anti-inflammatory properties, and contributed to neuroprotection by reducing oxidative stress through the activation of the Nrf2/Keap1 pathway [43]. Polyphenols bearing gallate structures also demonstrated antiviral potential through interference with viral entry and protease activity [44]. Myricetin was shown to inhibit the viral polymerase subunit PB2, thus limiting viral transcription [45], while quercetin and its derivatives interfere with hemagglutinin and neuraminidase, impairing viral attachment and release [46]. Although less abundant, protocatechuic acid has been reported to enhance both antiviral and immune-modulatory responses, improving resistance to avian Influenza and other viral infections while protecting against oxidative injury [47]. Delphinidin-3-O-glucoside, a predominant anthocyanin, strengthens the extract’s antioxidant and cytoprotective properties and has been shown to extend lifespan and stress tolerance in Caenorhabditis elegans [48]. Organic acids—particularly malic acid—may further contribute to acidification, metal chelation, and antimicrobial stability [49]. The substantial literature on these compounds could provide a solid basis for future mechanistic studies. Moreover, the extract composition aligns with metabolomic profiles reported for Rhus coriaria fruits [29] but, importantly, has not been previously evaluated as whole extract for anti-Influenza activity. The chemical distinctions between this extract and the antiviral formulations described from other Rhus spp. reinforce the novelty and relevance of the present study. Finally, given the wide geographic distribution of R. coriaria across the Middle East and Mediterranean basin, and its extensive culinary and ethnomedicinal use, characterization of its fruit-derived extract antiviral potential may have substantial translational and public health relevance.
While our results provide the first in vitro evidence that an aqueous extract of Rhus coriaria can inhibit Influenza A virus replication, this study was not designed to identify specific active constituents or to dissect the molecular mechanisms underlying the observed antiviral effects. Given the complex phytochemical nature of Rhus coriaria and the intrinsic limitations of in vitro systems, these aspects will require further investigations, including activity-guided fractionation and identification of active constituents; on the other hand, future work could clarify the mechanisms of action and identify targets and the replication cycle phases affected, also making use of more advanced or physiologically relevant models.
Altogether, these findings provide robust in vitro evidence that Rhus coriaria water extract interferes with Influenza A virus replication in human bronchial epithelial cells, supporting its further investigation as a natural source of antiviral compounds.

5. Conclusions

In conclusion, our results strongly suggest that Rhus coriaria represents a promising phytochemical platform for the development of novel anti-influenza strategies. Future work should focus on the identification of its active constituents and molecular targets, as well as validation in advanced cellular models, to translate these in vitro findings into potential therapeutic candidates. In addition, it will be important to characterize wild populations in order to select varieties carrying the highest levels of active compounds, with particular attention to regions such as the Middle East, where Rhus coriaria has a long tradition of use as a food spice and where the selection of wild plants has historically been guided by both culinary and medicinal purposes.

Author Contributions

Conceptualization, C.P., M.L.S.S. and P.C.; methodology, C.P., M.L.S.S. and P.C.; validation, C.P., M.L.S.S. and P.C.; investigation, F.F., L.L. and G.D.; resources, M.L.S.S., D.L. and M.D.A.; data curation, C.P., M.L.S.S., S.V. and P.C.; writing—original draft preparation, C.P. and P.C.; writing—review and editing, C.P., M.L.S.S., S.V., L.N. and P.C.; supervision and funding acquisition, L.N. and P.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Italian Ministry of Instruction, University and Research-MUR PRIN 2022HARH5W (P.C.), PRIN—2022 PNRR Prot. P2022WRRNT (L.N.), and by the Italian Ministry of Health-Ricerca Corrente (P.C., C.P., F.F., and D.L.).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Influenza (Flu). Available online: https://www.cdc.gov/flu (accessed on 1 February 2026).
  2. Krammer, F. The human antibody response to influenza A virus infection and vaccination. Nat. Rev. Immunol. 2019, 19, 383–397. [Google Scholar] [CrossRef]
  3. Bonomini, A.; Mercorelli, B.; Loregian, A. Antiviral strategies against influenza virus: An update on approved and innovative therapeutic approaches. Cell. Mol. Life Sci. 2025, 82, 75. [Google Scholar] [CrossRef]
  4. Govorkova, E.A.; Takashita, E.; Daniels, R.S.; Fujisaki, S.; Presser, L.D.; Patel, M.C.; Huang, W.; Lackenby, A.; Nguyen, H.T.; Pereyaslov, D.; et al. Global update on the susceptibilities of human influenza viruses to neuraminidase inhibitors and the cap-dependent endonuclease inhibitor baloxavir, 2018–2020. Antiviral Res. 2022, 200, 105281. [Google Scholar] [CrossRef] [PubMed]
  5. Holmes, E.C.; Hurt, A.C.; Dobbie, Z.; Clinch, B.; Oxford, J.S.; Piedra, P.A. Understanding the Impact of Resistance to Influenza Antivirals. Clin. Microbiol. Rev. 2021, 34, e00224-20. [Google Scholar] [CrossRef] [PubMed]
  6. Srivastava, R.; Dubey Neeraj, K.; Sharma, M.; Kharkwal, H.; Bajpai, R.; Srivastava, R. Boosting the human antiviral response in conjunction with natural plant products. Front. Nat. Prod. 2025, 3, 1470639. [Google Scholar] [CrossRef]
  7. Mahapatra, A.D.; Paul, I.; Dasgupta, S.; Roy, O.; Sarkar, S.; Ghosh, T.; Basu, S.; Chattopadhyay, D. Antiviral Potential and In Silico Insights of Polyphenols as Sustainable Phytopharmaceuticals: A Comprehensive Review. Chem. Biodivers. 2025, 22, e202401913. [Google Scholar] [CrossRef]
  8. De Angelis, M.; Della-Morte, D.; Buttinelli, G.; Di Martino, A.; Pacifici, F.; Checconi, P.; Ambrosio, L.; Stefanelli, P.; Palamara, A.T.; Garaci, E.; et al. Protective Role of Combined Polyphenols and Micronutrients against Influenza A Virus and SARS-CoV-2 Infection In Vitro. Biomedicines 2021, 9, 1721. [Google Scholar] [CrossRef]
  9. Checconi, P.; De Angelis, M.; Marcocci, M.E.; Fraternale, A.; Magnani, M.; Palamara, A.T.; Nencioni, L. Redox-Modulating Agents in the Treatment of Viral Infections. Int. J. Mol. Sci. 2020, 21, 4084. [Google Scholar] [CrossRef]
  10. Burkard, M.; Piotrowsky, A.; Leischner, C.; Detert, K.; Venturelli, S.; Marongiu, L. The Antiviral Activity of Polyphenols. Mol. Nutr. Food Res. 2025, 69, e70042. [Google Scholar] [CrossRef]
  11. Sun, S.; Liu, Z.; Lin, M.; Gao, N.; Wang, X. Polyphenols in health and food processing: Antibacterial, anti-inflammatory, and antioxidant insights. Front. Nutr. 2024, 11, 1456730. [Google Scholar] [CrossRef]
  12. Rathod, N.B.; Elabed, N.; Punia, S.; Ozogul, F.; Kim, S.K.; Rocha, J.M. Recent Developments in Polyphenol Applications on Human Health: A Review with Current Knowledge. Plants 2023, 12, 1217. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, S.; Wang, X.; Cheng, Y.; Gao, H.; Chen, X. A Review of Classification, Biosynthesis, Biological Activities and Potential Applications of Flavonoids. Molecules 2023, 28, 4982. [Google Scholar] [CrossRef] [PubMed]
  14. Fioravanti, R.; Celestino, I.; Costi, R.; Crucitti, G.C.; Pescatori, L.; Mattiello, L.; Novellino, E.; Checconi, P.; Palamara, A.T.; Nencioni, L.; et al. Effects of polyphenol compounds on influenza A virus replication and definition of their mechanism of action. Bioorg. Med. Chem. 2012, 20, 5046–5052. [Google Scholar] [CrossRef] [PubMed]
  15. Rayne, S.; Mazza, G. Biological activities of extracts from sumac (Rhus spp.): A review. Plant Foods Hum. Nutr. 2007, 62, 165–175. [Google Scholar] [CrossRef]
  16. Korkmaz, H. Could Sumac Be Effective on COVID-19 Treatment? J. Med. Food 2021, 24, 563–568. [Google Scholar] [CrossRef]
  17. Calabrò, A.; Ligotti, M.E.; Accardi, G.; Di Majo, D.; Caruso, C.; Candore, G.; Aiello, A. The Nutraceutical Properties of Rhus coriaria Linn: Potential Application on Human Health and Aging Biomedicine. Int. J. Mol. Sci. 2023, 24, 6206. [Google Scholar] [CrossRef]
  18. Shahrivari, S.; Zeebaree, S.M.S.; Alizadeh-Salteh, S.; Feizy, H.S.; Morshedloo, M.R. Phytochemical variations antioxidant, and antibacterial activities among zebaria sumac (Rhus coriaria var. zebaria) populations in Iraq. Sci. Rep. 2024, 14, 4818. [Google Scholar] [CrossRef]
  19. Gharabolagh, A.F.; Sabahi, F.; Karimi, M.; Kamalinejad, M.; Mirshahabi, H.; Nasad, S.D.M.; Ahmadi, N.A. Effects of Rhus coriaria L. (Sumac) Extract on Hepatitis B Virus Replication and Hbs Ag Secretion. J. Rep. Pharm. Sci. 2018, 7, e147601. [Google Scholar] [CrossRef]
  20. Parvez, M.K.; Al-Dosari, M.S.; Abdelwahid, M.A.S.; Alqahtani, A.S.; Alanzi, A.R. Novel anti-hepatitis B virus-active catechin and epicatechin from Rhus tripartita. Exp. Ther. Med. 2022, 23, 398. [Google Scholar] [CrossRef]
  21. Kurokawa, M.; Basnet, P.; Ohsugi, M.; Hozumi, T.; Kadota, S.; Namba, T.; Kawana, T.; Shiraki, K. Anti-herpes simplex virus activity of moronic acid purified from Rhus javanica in vitro and in vivo. J. Pharmacol. Exp. Ther. 1999, 89, 72–78. [Google Scholar] [CrossRef]
  22. Wang, R.R.; Gu, Q.; Wang, Y.H.; Zhang, X.M.; Yang, L.M.; Zhou, J.; Chen, J.J.; Zheng, Y.T. Anti-HIV-1 activities of compounds isolated from the medicinal plant Rhus chinensis. J. Ethnopharmacol. 2008, 117, 249–256. [Google Scholar] [CrossRef] [PubMed]
  23. Modi, M.; Nutan; Pancholi, B.; Kulshrestha, S.; Rawat, A.K.S.; Malhotra, S.; Gupta, S.K. Anti-HIV-1 activity, protease inhibition and safety profile of extracts prepared from Rhus parviflora. BMC Complement. Altern. Med. 2013, 13, 158. [Google Scholar] [CrossRef] [PubMed]
  24. Kim, Y.S.; Li, W.; Kim, J.H.; Chung, H.S.; Choi, J.G. Anti-Influenza Activity of an Ethyl Acetate Fraction of a Rhus verniciflua Ethanol Extract by Neuraminidase Inhibition. Oxid. Med. Cell Longev. 2020, 2020, 8824934. [Google Scholar] [CrossRef] [PubMed]
  25. Lin, Y.M.; Flavin, M.T.; Schure, R.; Chen, F.C.; Sidwell, R.; Barnard, D.L.; Huffman, J.H.; Kern, E.R. Antiviral activities of biflavonoids. Planta Med. 1999, 65, 120–125. [Google Scholar] [CrossRef]
  26. Belhassan, A.; Zaki, H.; Chtita, S.; Alaqarbeh, M.; Alsakhen, N.; Benlyas, M.; Lakhlifi, T.; Bouachrine, M. Camphor, Artemisinin and Sumac Phytochemicals as inhibitors against COVID-19: Computational approach. Comput. Biol. Med. 2021, 136, 104758. [Google Scholar] [CrossRef]
  27. Kayumov, M.; Marimuthu, P.; Razzokov, J.; Mukhamedov, N.; Asrorov, A.; Berdiev, N.S.; Ziyavitdinov, J.F.; Yashinov, A.; Oshchepkova, Y.; Salikhov, S.; et al. Computational and in vitro evaluation of sumac-derived ©Rutan compounds towards Sars-CoV-2 Mpro inhibition. Front. Pharmacol. 2025, 16, 1518463. [Google Scholar] [CrossRef]
  28. Salikhov, S.I.; Oshchepkova, Y.I.; Ziyavitdinov, J.F.; Ashurov, J.M.; Berdiev, N.S.; Kolundin, M.S.; Gaidarov, A.O.; Turgiev, A.S.; Yurlov, K.I.; Larichev, V.F.; et al. Sumac Polyphenols as Pan-Herpesvirus Inhibitors. Int. J. Mol. Sci. 2025, 26, 10398. [Google Scholar] [CrossRef]
  29. Mazzara, E.; Caprodossi, A.; Mustafa, A.M.; Maggi, F.; Caprioli, G. Phytochemical Investigation of Sumac (Rhus coriaria L.) Fruits from Different Sicilian Accessions. Foods 2023, 12, 4359. [Google Scholar] [CrossRef]
  30. MassBank. Available online: https://massbank.eu/MassBank (accessed on 5 January 2026).
  31. Abu-Reidah, I.M.; Ali-Shtayeh, M.S.; Jamous, R.M.; Arráez-Román, D.; Segura-Carretero, A. HPLC–DAD–ESI-MS/MS screening of bioactive components from Rhus coriaria L. (Sumac) fruits. Food Chem. 2015, 166, 179–191. [Google Scholar] [CrossRef]
  32. Badawy, S.A.; Hassan, A.R.; Abu Bakr, M.S.; Mohammed, A.E.I. UPLC-qTOF-MS/MS profiling of phenolic compounds in Fagonia arabica L. and evaluation of their cholinesterase inhibition potential through in-vitro and in-silico approaches. Sci. Rep. 2025, 15, 5244. [Google Scholar] [CrossRef]
  33. Romeo, F.V.; Ballistreri, G.; Fabroni, S.; Pangallo, S.; Nicosia, M.G.; Schena, L.; Rapisarda, P. Chemical Characterization of Different Sumac and Pomegranate Extracts Effective against Botrytis cinerea Rots. Molecules 2015, 20, 11941–11958. [Google Scholar] [CrossRef] [PubMed]
  34. Divya Priya, A.; Martin, A. UHPLC-MS/MS based comprehensive phenolic profiling, antimicrobial and antioxidant activities of Indian Rhodomyrtus tomentosa fruits. Sci. Rep. 2025, 15, 945. [Google Scholar] [CrossRef] [PubMed]
  35. Pellegrino, M.; Checconi, P.; Ceramella, J.; Prezioso, C.; Limongi, D.; Marra, M.; Mariconda, A.; Catalano, A.; De Angelis, M.; Nencioni, L.; et al. Antibacterial and Anti-Influenza Activities of N-Heterocyclic Carbene-Gold Complexes. Pharmaceuticals 2024, 17, 1680. [Google Scholar] [CrossRef] [PubMed]
  36. Reed, L.J.; Muench, H. A Simple Method of Estimation Fifty Percent End Points. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
  37. Winter, G.; Fields, S. Cloning of influenza cDNA ino M13: The sequence of the RNA segment encoding the A/PR/8/34 matrix protein. Nucleic Acids Res. 1980, 8, 1965–1974. [Google Scholar] [CrossRef]
  38. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
  39. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  40. Salikhov, S.I.; Abdurakhmonov, I.Y.; Oshchepkova, Y.I.; Ziyavitdinov, J.F.; Berdiev, N.S.; Aisa, H.A.; Shen, J.; Xu, Y.; Xu, H.E.; Jiang, X.; et al. Repurposing of Rutan showed effective treatment for COVID-19 disease. Front. Med. 2023, 10, 1310129. [Google Scholar] [CrossRef]
  41. Di Sotto, A.; Checconi, P.; Celestino, I.; Locatelli, M.; Carissimi, S.; De Angelis, M.; Rossi, V.; Limongi, D.; Toniolo, C.; Martinoli, L.; et al. Antiviral and Antioxidant Activity of a Hydroalcoholic Extract from Humulus lupulus L. Oxid. Med. Cell Longev. 2018, 2018, 5919237. [Google Scholar] [CrossRef]
  42. Cho, W.K.; Choi, H.J.; Ahmad, S.S.; Choi, I.; Ma, J.Y. Antiviral Effect of Amentoflavone Against Influenza Viruses. Int. J. Mol. Sci. 2024, 25, 12426. [Google Scholar] [CrossRef]
  43. Abbasalipour, H.; Hajizadeh Moghaddam, A.; Ranjbar, M. Sumac and gallic acid-loaded nanophytosomes ameliorate hippocampal oxidative stress via regulation of Nrf2/Keap1 pathway in autistic rats. J. Biochem. Mol. Toxicol. 2022, 36, e23035. [Google Scholar] [CrossRef]
  44. Nguyen, T.T.H.; Jung, J.H.; Kim, M.K.; Lim, S.; Choi, J.M.; Chung, B.; Kim, D.W.; Kim, D. The inhibitory effects of plant-derived polyphenols on the Main Protease of SARS Coronavirus 2 and Their Structure-Activity Relationship. Molecules 2021, 26, 1924. [Google Scholar] [CrossRef]
  45. Tian, Y.; Sang, H.; Liu, M.; Chen, F.; Huang, Y.; Li, L.; Liu, S.; Yang, J. Dihydromyricetin is a new inhibitor of influenza polymerase PB2 subunit and influenza-induced inflammation. Microbes Infect. 2020, 22, 254–262. [Google Scholar] [CrossRef]
  46. Wu, W.; Li, R.; Li, X.; He, J.; Jiang, S.; Liu, S.; Yang, J. Quercetin as an antiviral agent inhibits influenza A virus (IAV) entry. Viruses 2015, 8, 6. [Google Scholar] [CrossRef]
  47. Guo, Y.; Zhang, Q.; Zuo, Z.; Chu, J.; Xiao, H.; Javed, M.T.; He, C. Protocatechuic acid (PCA) induced a better antiviral effect by immune enhancement in SPF chickens. Microb. Pathog. 2018, 114, 233–238. [Google Scholar] [CrossRef]
  48. Nas, J.S.B.; Medina, P.M.B. Delphinidin-3-glucoside prolongs lifespan and healthspan in Caenorhabditis elegans with and without environmental stress. J. Appl. Pharm. Sci. 2024, 14, 494. [Google Scholar] [CrossRef]
  49. Alsamri, H.; Athamneh, K.; Pintus, G.; Eid, A.H.; Iratni, R. Pharmacological and antioxidant activities of Rhus coriaria L. (Sumac). Antioxidants 2021, 10, 73. [Google Scholar] [CrossRef] [PubMed]
Cimb 48 00207 g002
Figure 2. R. coriaria reduced Influenza virus mRNA level. qRT-PCR analysis in PR8-infected (0.1 m.o.i.) BEAS-2B cells treated with extract (0.1 mg/mL) at 6 h p.i. to quantify viral mRNA level of HA, NA and M2, normalized to GAPDH mRNA level. Data, representing the fold change relative to PR8-infected and untreated samples, are mean ± SD of four different experiments (n = 4), * p < 0.05.
Figure 2. R. coriaria reduced Influenza virus mRNA level. qRT-PCR analysis in PR8-infected (0.1 m.o.i.) BEAS-2B cells treated with extract (0.1 mg/mL) at 6 h p.i. to quantify viral mRNA level of HA, NA and M2, normalized to GAPDH mRNA level. Data, representing the fold change relative to PR8-infected and untreated samples, are mean ± SD of four different experiments (n = 4), * p < 0.05.
Cimb 48 00207 g002
Cimb 48 00207 g003
Figure 3. R. coriaria reduced Influenza virus proteins expression. (a) Western blot analysis with anti-Influenza polyclonal antibody, which recognized viral HA, NP and M1 (above), and with anti-PA monoclonal antibody (below) from cells lysates of PR8-infected (0.1 m.o.i.) BEAS-2B cells, treated with extract (0.1 mg/mL) for 24 h p.i. For each western blot, GAPDH was used as loading control. Densitometric analysis is shown in the graphs in (b), expressed as ratio of each viral protein to GAPDH. The western blot image shown is representative of the three experiments performed, while densitometric analysis values are the mean ± SD of the three (n = 3), * p < 0.05.
Figure 3. R. coriaria reduced Influenza virus proteins expression. (a) Western blot analysis with anti-Influenza polyclonal antibody, which recognized viral HA, NP and M1 (above), and with anti-PA monoclonal antibody (below) from cells lysates of PR8-infected (0.1 m.o.i.) BEAS-2B cells, treated with extract (0.1 mg/mL) for 24 h p.i. For each western blot, GAPDH was used as loading control. Densitometric analysis is shown in the graphs in (b), expressed as ratio of each viral protein to GAPDH. The western blot image shown is representative of the three experiments performed, while densitometric analysis values are the mean ± SD of the three (n = 3), * p < 0.05.
Cimb 48 00207 g003
Cimb 48 00207 g004
Figure 4. R. coriaria reduced HA expression. Confocal images of nuclei (DAPI), viral HA and their merge in PR8-infected (0.1 m.o.i.) BEAS-2B cells treated with extract (0.1 mg/mL) for 24 h. Scale bar = 50 μm.
Figure 4. R. coriaria reduced HA expression. Confocal images of nuclei (DAPI), viral HA and their merge in PR8-infected (0.1 m.o.i.) BEAS-2B cells treated with extract (0.1 mg/mL) for 24 h. Scale bar = 50 μm.
Cimb 48 00207 g004
Cimb 48 00207 g005
Figure 5. R. coriaria reduced Influenza PA expression. Confocal images of nuclei (DAPI), viral PA and their merge in PR8-infected (1 m.o.i.) BEAS-2B cells treated with extract (0.1 mg/mL) for 8 h. Scale bar = 50 μm.
Figure 5. R. coriaria reduced Influenza PA expression. Confocal images of nuclei (DAPI), viral PA and their merge in PR8-infected (1 m.o.i.) BEAS-2B cells treated with extract (0.1 mg/mL) for 8 h. Scale bar = 50 μm.
Cimb 48 00207 g005
Cimb 48 00207 g006
Figure 6. R. coriaria reduced Influenza-infected cell percentage. Quantification of HA-positive cells at 24 h p.i. (left) and PA-positive cells at 8 h p.i. (right), in BEAS-2B cells infected with PR8 (0.1 and 1 m.o.i., respectively) and treated or not with Rhus coriaria extract (0.1 mg/mL), expressed as percentage of infected cells on the total number of cells analyzed. Each grey dot represents the measurement obtained from a single independent field (n = 9 per condition), acquired as z-stacks in 4 × 4 tiled mode and processed as maximum-intensity projections under identical acquisition settings. The percentage of infected cells was determined by fluorescence analysis using ImageJ/Fiji. The total number of cells was determined by counting DAPI-stained nuclei. Data are shown as mean ± SD (n = 3). ** p < 0.005, *** p < 0.001.
Figure 6. R. coriaria reduced Influenza-infected cell percentage. Quantification of HA-positive cells at 24 h p.i. (left) and PA-positive cells at 8 h p.i. (right), in BEAS-2B cells infected with PR8 (0.1 and 1 m.o.i., respectively) and treated or not with Rhus coriaria extract (0.1 mg/mL), expressed as percentage of infected cells on the total number of cells analyzed. Each grey dot represents the measurement obtained from a single independent field (n = 9 per condition), acquired as z-stacks in 4 × 4 tiled mode and processed as maximum-intensity projections under identical acquisition settings. The percentage of infected cells was determined by fluorescence analysis using ImageJ/Fiji. The total number of cells was determined by counting DAPI-stained nuclei. Data are shown as mean ± SD (n = 3). ** p < 0.005, *** p < 0.001.
Cimb 48 00207 g006
Table 1. Identification and relative amounts of organic acids and phenolic compounds in R. coriaria water extract (negative ion mode).
Table 1. Identification and relative amounts of organic acids and phenolic compounds in R. coriaria water extract (negative ion mode).
RT[M-H]- (m/z)MS2 (m/z)Relative Composition (%)Organic Acids
0.71102.94958.960.38Malonic acid
0.91295.069771.01; 115.00; 133.011.85Malic acid hexoside
0.96205.035672.99; 99.01; 81.03; 125.0218.65Malic acid
0.9788.98843.021.33Lactic acid
1.73115.00471.011.42Fumaric acid
1.90191.056111.01; 87.010.81Citric acid
RT[M-H]- (m/z)MS2 (m/z)Relative Composition (%)Phenolic Compounds
1.98169.014125.0260.25Gallic acid
2.08125.025125.02; 97.07; 81.03; 69.032.69Pyrogallol
5.67223.025179.0350.95Sinapic acid
5.90153.020108.02; 109.031.75Protocatechuic acid
6.66179.035135.0450.45Caffeic acid
8.12595.095299.02; 317.03; 479.080.99Myricetin hexose-malic
Acid
8.21479.084151.00; 271.03; 287.02; 316.02; 317.032.24Myricetin-3-O-galactoside
9.17463.089301.040.62Quercetin-3-O-glucoside
9.47939.113169.01; 787.102.49Pentagalloyl-O-glucoside
9.58301.000129.00; 229.01; 245.012.71Ellagic acid
10.46317.03317.03; 179.00; 151.00; 137.020.33Myricetin
10.77301.036151.00; 107.01; 65.000.02Quercetin
9.37609.146151.00; 178.99; 255.030.07Rutin
RT: retention time; M-H: deprotonated molecular ion; m/z: mass-to-charge ratio; MS2: tandem mass spectrometry (fragmentation of the molecular ion).
Table 2. Identification and relative amounts of Anthocyanins in R. coriaria water extract (positive ion mode).
Table 2. Identification and relative amounts of Anthocyanins in R. coriaria water extract (positive ion mode).
RT[M+H]+ (m/z)MS2 (m/z)Relative Composition (%)Anthocyanins
8.90611.160303.059.81Delphinidin-3-O-rutinoside
9.92303.050121.03; 137.02; 153.0216.44Delphinidin
9.93449.108303.05 (287.05)64.02Cyanidin-3-O-glucoside (Delphinidin-3-O-rhamnoside)
10.85433.113287.058.33Cyanidin-3-O-rhamnoside
10.85287.055137.02; 241.051.41Cyanidin
RT: retention time; [M+H]+: protonated molecular ion; m/z: mass-to-charge ratio; MS2: tandem mass spectrometry (fragmentation of the molecular ion).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Prezioso, C.; Savo Sardaro, M.L.; Frezza, F.; Limongi, D.; Velotto, S.; Lupacchini, L.; D’Auria, G.; De Angelis, M.; Nencioni, L.; Checconi, P. Rhus coriaria Linn Extract as a Natural Inhibitor of Influenza A Virus Replication In Vitro. Curr. Issues Mol. Biol. 2026, 48, 207. https://doi.org/10.3390/cimb48020207

AMA Style

Prezioso C, Savo Sardaro ML, Frezza F, Limongi D, Velotto S, Lupacchini L, D’Auria G, De Angelis M, Nencioni L, Checconi P. Rhus coriaria Linn Extract as a Natural Inhibitor of Influenza A Virus Replication In Vitro. Current Issues in Molecular Biology. 2026; 48(2):207. https://doi.org/10.3390/cimb48020207

Chicago/Turabian Style

Prezioso, Carla, Maria Luisa Savo Sardaro, Flavio Frezza, Dolores Limongi, Salvatore Velotto, Leonardo Lupacchini, Giovanni D’Auria, Marta De Angelis, Lucia Nencioni, and Paola Checconi. 2026. "Rhus coriaria Linn Extract as a Natural Inhibitor of Influenza A Virus Replication In Vitro" Current Issues in Molecular Biology 48, no. 2: 207. https://doi.org/10.3390/cimb48020207

APA Style

Prezioso, C., Savo Sardaro, M. L., Frezza, F., Limongi, D., Velotto, S., Lupacchini, L., D’Auria, G., De Angelis, M., Nencioni, L., & Checconi, P. (2026). Rhus coriaria Linn Extract as a Natural Inhibitor of Influenza A Virus Replication In Vitro. Current Issues in Molecular Biology, 48(2), 207. https://doi.org/10.3390/cimb48020207

Article Metrics

Back to TopTop