qRT-PCR Reference Gene Selection for the Discoloration of Tender Leaves in Hawk Tea (Litsea coreana)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Total RNA Extraction and cDNA Synthesis
2.3. Selection of Candidate Reference Genes and Primer Synthesis
2.4. Quantitative PCR Program and Data Analysis
3. Results
3.1. Primer Specificity Analysis
3.2. Candidate Reference Gene Expression Profile
3.3. Stability Evaluation of Candidate Reference Genes
3.3.1. Analysis of ΔCT Method
3.3.2. NormFinder Analysis
3.3.3. BestKeeper Analysis
3.3.4. GeNormGene Analysis
3.3.5. RefFinder Analysis
3.4. Identification of Reference Genes Through Screening
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lee, D.W.; Gould, K.S. Why Leaves Turn Red. Am. Sci. 2002, 90, 524–531. [Google Scholar] [CrossRef]
- Hughes, N.M. Winter leaf reddening in ‘evergreen’ species. New Phytol. 2011, 190, 573–581. [Google Scholar] [CrossRef] [PubMed]
- Lev-Yadun, S.; Yamazaki, K.; Holopainen, J.K.; Sinkkonen, A. Spring versus autumn leaf colours: Evidence for different selective agents and evolution in various species and floras. Flora 2012, 207, 80–85. [Google Scholar] [CrossRef]
- Sinkkonen, A.; Somerkoski, E.; Paaso, U.; Holopainen, J.K.; Rousi, M.; Mikola, J. Genotypic variation in yellow autumn leaf colours explains aphid load in silver birch. New Phytol. 2012, 195, 461–469. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Nieves, S.; Yang, Y.; Timoneda, A.; Wang, M.; Feng, T.; Smith, S.A.; Brockington, S.F.; Maeda, H.A. Relaxation of tyrosine pathway regulation underlies the evolution of betalain pigmentation in Caryophyllales. New Phytol. 2018, 217, 896–908. [Google Scholar] [CrossRef]
- Jaiswal, P.S.; Kaur, N.; Randhawa, G.S. Identification of Reference Genes for qRT-PCR Gene Expression Studies during Seed Development and under Abiotic Stresses in Cyamopsis tetragonoloba. Crop Sci. 2019, 59, 252–265. [Google Scholar] [CrossRef]
- Naseema Rasheed, R.; Suhara Beevy, S. Reliable reference gene selection for quantitative real-time PCR (qRT-PCR) in floral developmental phases of dioecious species Coccinia grandis. Gene 2024, 900, 148143. [Google Scholar] [CrossRef]
- Li, C.; Xu, J.; Deng, Y.; Sun, H.; Li, Y. Selection of reference genes for normalization of cranberry (Vaccinium macrocarpon Ait.) gene expression under different experimental conditions. PLoS ONE 2019, 14, e0224798. [Google Scholar] [CrossRef] [PubMed]
- Xiao, F.; Zheng, Y.; Chen, J.; Zhao, C.; Chen, H.; Wang, L.; Liu, S. Selection and validation of reference genes in all-red Amaranth (Amaranthus tricolor L.) seedlings under different culture conditions. J. Hortic. Sci. Biotechnol. 2021, 96, 604–613. [Google Scholar] [CrossRef]
- Wu, Y.; Zhang, C.; Yang, H.; Lyu, L.; Li, W.; Wu, W. Selection and Validation of Candidate Reference Genes for Gene Expression Analysis by RT-qPCR in Rubus. Int. J. Mol. Sci. 2021, 22, 10533. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.-L.; Yuan, X.-Y.; Zhang, J.; Sun, W.-H.; Liu, Z.-J.; Zou, S.-Q. Comprehensive transcriptome analysis of reference genes for fruit development of Euscaphis konishii. PeerJ 2020, 8, e8474. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Wang, D.; Tan, G.T.; Van Hung, N.; Cuong, N.M.; Pezzuto, J.M.; Fong, H.H.S.; Soejarto, D.D.; Zhang, H. Litsea Species as Potential Antiviral Plant Sources. Am. J. Chin. Med. 2016, 44, 275–290. [Google Scholar] [CrossRef]
- Kamle, M.; Mahato, D.K.; Lee, K.E.; Bajpai, V.K.; Gajurel, P.R.; Gu, K.S.; Kumar, P. Ethnopharmacological Properties and Medicinal Uses of Litsea cubeba. Plants 2019, 8, 150. [Google Scholar] [CrossRef]
- Tian, S.; Li, Y.; Xiao, L.; Ran, T. The complete chloroplast genome sequence of Litsea coreana var. lanuginosa (Lauraceae): Genome structure and phylogenetic analysis. Mitochondrial DNA Part B-Resour. 2022, 7, 1617–1618. [Google Scholar] [CrossRef]
- Qin, Z.; Feng, K.; Wang, W.-S.; Wang, W.-Z.; Wang, Y.-J.; Lu, J.-L.; Li, E.-W.; Niu, S.-B.; Jiao, Y.-G. Comparative study on the essential oils of six Hawk tea (Litsea coreana Levl. var. lanuginosa) from China: Yields, chemical compositions and biological activities. Ind. Crop Prod. 2018, 124, 126–135. [Google Scholar] [CrossRef]
- Gou, L.; Wang, C.; Ni, S.; Zhong, X. Active components in water extracts from leaf of Litsea coreana var. lanuginosa and its effects on scavenging sodium nitrite and blocking nitrosamine synthesis. J. Plant Resour. Environ. 2016, 25, 102–104. [Google Scholar] [CrossRef]
- Jia, X.; Dong, L.; Yang, Y.; Yuan, S.; Zhang, Z.; Yuan, M. Preliminary structural characterization and antioxidant activities of polysaccharides extracted from Hawk tea (Litsea coreana var. lanuginosa). Carbohyd Polym. 2013, 95, 195–199. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Yao, X.; Chen, H.; Lu, L. High-quality chromosome-level genome assembly of Litsea coreana L. provides insights into Magnoliids evolution and flavonoid biosynthesis. Genomics 2022, 114, 110394. [Google Scholar] [CrossRef]
- Xu, T.; Hu, S.; Liu, Y.; Sun, K.; Luo, L.; Zeng, L. Hawk Tea Flavonoids as Natural Hepatoprotective Agents Alleviate Acute Liver Damage by Reshaping the Intestinal Microbiota and Modulating the Nrf2 and NF-κB Signaling Pathways. Nutrients 2022, 14, 3662. [Google Scholar] [CrossRef] [PubMed]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef]
- Hellemans, J.; Vandesompele, J. Selection of reliable reference genes for RT-qPCR analysis. Methods Mol. Biol. 2014, 1160, 19–26. [Google Scholar] [CrossRef] [PubMed]
- Dong, Z.; Chen, P.; Zhang, N.; Huang, S.; Zhang, H.; Wang, S.; Li, X.; Guo, Y.; Wang, Z. Evaluation of reference genes for quantitative real-time PCR analysis of gene expression in Hainan medaka (Oryzias curvinotus). Gene Rep. 2019, 14, 94–99. [Google Scholar] [CrossRef]
- Maldonado-Taipe, N.; Patirange, D.S.R.; Schmöckel, S.M.; Jung, C.; Emrani, N. Validation of suitable genes for normalization of diurnal gene expression studies in Chenopodium quinoa. PLoS ONE 2021, 16, e0233821. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.; Hao, P.; Shu, W.; Wang, G.; Xie, Z.; Gu, C.; Zhang, S. Phylogenetic and Expression Analyses of With-No-Lysine Kinase Genes Reveal Novel Gene Family Diversity in Fruit Trees. Hortic. Plant J. 2019, 5, 47–58. [Google Scholar] [CrossRef]
- Knopkiewicz, M.; Wojtaszek, P. Validation of reference genes for gene expression analysis using quantitative polymerase chain reaction in pea lines (Pisum sativum) with different lodging susceptibility. Ann. Appl. Biol. 2019, 174, 86–91. [Google Scholar] [CrossRef]
- Chen, H.; Hu, B.; Zhao, L.; Shi, D.; She, Z.; Huang, X.; Priyadarshani, S.V.G.N.; Niu, X.; Qin, Y. Differential Expression Analysis of Reference Genes in Pineapple (Ananas comosus L.) during Reproductive Development and Response to Abiotic Stress, Hormonal Stimuli. Trop. Plant Biol. 2019, 12, 67–77. [Google Scholar] [CrossRef]
- Luo, M.-T.; Qubie, J.-Z.; Feng, M.-K.; Qubie, A.X.; He, B.; Hailai, Y.-B.; Li, W.-B.; Yang, Z.-M.; Li, Y.; Yan, X.-J.; et al. Selection and validation of reference genes for quantitative real-time PCR analysis in Paeonia veitchii. China J. Chin. Mater. Medica 2023, 48, 5759–5766. [Google Scholar] [CrossRef]
- Chen, M.-D.; Wang, B.; Li, Y.-P.; Zeng, M.-J.; Liu, J.-T.; Ye, X.-R.; Zhu, H.-S.; Wen, Q.-F. Reference gene selection for qRT-PCR analyses of luffa (Luffa cylindrica) plants under abiotic stress conditions. Sci. Rep. 2021, 11, 3161. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Zhang, G.; Chen, Y.; Bai, Q.; Gao, C.; Zeng, L.; Li, Z.; Cheng, Y.; Chen, J.; Sun, X.; et al. Selection of Reference Genes for qPCR Analyses of Gene Expression in Ramie Leaves and Roots across Eleven Abiotic/Biotic Treatments. Sci. Rep. 2019, 9, 20004. [Google Scholar] [CrossRef]
- Zhang, K.; Fan, W.; Chen, D.; Jiang, L.; Li, Y.; Yao, Z.; Yang, Y.; Qiu, D. Selection and validation of reference genes for quantitative gene expression normalization in Taxus spp. Sci. Rep. 2020, 10, 22205. [Google Scholar] [CrossRef] [PubMed]
- Qu, R.; Miao, Y.; Cui, Y.; Cao, Y.; Zhou, Y.; Tang, X.; Yang, J.; Wang, F. Selection of reference genes for the quantitative real-time PCR normalization of gene expression in Isatis indigotica fortune. BMC Mol. Biol. 2019, 20, 9. [Google Scholar] [CrossRef]
- Tajti, J.; Pál, M.; Janda, T. Validation of Reference Genes for Studying Different Abiotic Stresses in Oat (Avena sativa L.) by RT-qPCR. Plants 2021, 10, 1272. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Zhang, R.; Zhou, Z. Identification and Validation of Reference Genes for Gene Expression Analysis in Schima superba. Genes 2021, 12, 732. [Google Scholar] [CrossRef] [PubMed]
- Linardić, M.; Braybrook, S.A. Identification and selection of optimal reference genes for qPCR-based gene expression analysis in Fucus distichus under various abiotic stresses. PLoS ONE 2021, 16, e0233249. [Google Scholar] [CrossRef] [PubMed]
- Lv, Y.; Li, Y.; Liu, X.; Xu, K. Identification of Ginger (Zingiber officinale Roscoe) Reference Genes for Gene Expression Analysis. Front. Genet. 2020, 11, 586098. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Zhang, P.; Lin, W.; Zheng, X.; Cai, M.; Peng, C. Sequencing of anthocyanin synthesis-related enzyme genes and screening of reference genes in leaves of four dominant subtropical forest tree species. Gene 2019, 716, 144024. [Google Scholar] [CrossRef]
- Chen, M.; Wang, Q.; Li, Y.; Gao, L.; Lv, F.; Yang, R.; Wang, P. Candidate reference genes for quantitative gene expression analysis in Lagerstroemia indica. Mol. Biol. Rep. 2021, 48, 1677–1685. [Google Scholar] [CrossRef]
- Zhu, X.; Wang, B.; Wang, X.; Wei, X. Screening of stable internal reference gene of Quinoa under hormone treatment and abiotic stress. Physiol. Mol. Biol. Plants 2021, 27, 2459–2470. [Google Scholar] [CrossRef] [PubMed]
- Fang, P.; Lu, R.; Sun, F.; Lan, Y.; Shen, W.; Du, L.; Zhou, Y.; Zhou, T. Assessment of reference gene stability in Rice stripe virus and Rice black streaked dwarf virus infection rice by quantitative Real-time PCR. Virol. J. 2015, 12, 175. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Name | Primer (Forward/Reverse) | Size/bp |
---|---|---|---|
18S rRNA gene (18S rRNA) | nc1-18S rRNA-F | CGTCACTGCAACTCTCTCCA | 130 |
nc1-18S rRNA-R | GGCGTGGTTGTTGACTTTCC | ||
Ubiquitin-conjugating C (UBC) | nc2-UBC-F3 | TCACTGGAAAGACCATAACGCT | 108 |
nc2-UBC-R3 | TTAGACGTTGCTGATCCGGG | ||
Actin (ACT) | nc3-ACT-F | CCCATCCCGACCATTACACC | 106 |
nc3-ACT-R | GAACTGGGATGGTCAAGGCA | ||
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | nc4-GAPDH-F | GGGATCTCTGATGGGTCCCT | 188 |
nc4-GAPDH-R | AGGGATGATGTTGAGGTGGT | ||
Elongation Factor1-alpha (EF1-α) | nc5-EF1-α-F | TGATCCAGCAAAGGAGGCAG | 107 |
nc5-EF1-α-R | GGGAGGTGTGGCAATCAAGA | ||
Tubulin beta (TUB) | nc6-TUB-F | TGGCAACTCCACCTCAATCC | 187 |
nc6-TUB-R | CGCTGTTGCATCCTGGTACT | ||
Ribosomal protein l (RPL) | nc7-RPL-F | GCAGCGGACAGAAAGAAGGA | 114 |
nc7-RPL-R | CTTTCCTGTGCTGGAGCTGA | ||
Anthocyanidin synthase (ANS) | nc18-ANS-1(Mei)-F | GCCCTCACCTTCATCCTCAC | 126 |
nc18-ANS-1(Mei)-R | GAGGATCTCAAGGCTGTCGC |
Rank | Stability of Tender Leaves at Different Stages | Stability of Tender Leaves of Different Colors | Stability of Different Tender Leaf Colors at Different Stages | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Red Tender Leaves at Different Stages | Green Tender Leaves at Different Stages | Stage 1 Tender Leaves of Different Colors | Stage 2 Tender Leaves of Different Colors | Stage 3 Tender Leaves of Different Colors | ||||||||
Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | |
1 | ACT | 0.35 | RPL | 0.54 | EF1-α | 0.48 | ACT | 0.57 | EF1-α | 0.66 | ACT | 0.66 |
2 | UBC | 0.37 | ACT | 0.58 | ACT | 0.49 | EF1-α | 0.57 | ACT | 0.74 | RPL | 0.74 |
3 | RPL | 0.38 | 18SrRNA | 0.62 | GAPDH | 0.51 | GAPDH | 0.62 | RPL | 0.76 | EF1-α | 0.75 |
4 | 18SrRNA | 0.39 | EF1-α | 0.68 | RPL | 0.56 | 18SrRNA | 0.7 | 18SrRNA | 0.81 | 18SrRNA | 0.75 |
5 | GAPDH | 0.48 | UBC | 0.73 | 18SrRNA | 0.62 | RPL | 0.77 | GAPDH | 0.82 | GAPDH | 0.77 |
6 | EF1-α | 0.5 | GAPDH | 0.75 | TUB | 1.02 | TUB | 1.04 | TUB | 0.91 | TUB | 1.02 |
7 | TUB | 0.59 | TUB | 0.8 | UBC | 1.05 | UBC | 1.18 | UBC | 1.27 | UBC | 1.17 |
Rank | Stability of Tender Leaves at Different Stages | Stability of Tender Leaves of Different colors | Stability of Different Tender Leaf Colors at Different Stages | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Red Tender Leaves at Different Stages | Green Tender Leaves at Different Stages | Stage 1 Tender Leaves of Different Colors | Stage 2 Tender Leaves of Different Colors | Stage 3 Tender Leaves of Different Colors | ||||||||
Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | |
1 | ACT | 0.155 | RPL | 0.174 | EF1-α | 0.093 | ACT | 0.088 | EF1-α | 0.175 | ACT | 0.1 |
2 | RPL | 0.183 | ACT | 0.287 | ACT | 0.093 | EF1-α | 0.136 | ACT | 0.359 | 18SrRNA | 0.395 |
3 | UBC | 0.201 | 18SrRNA | 0.376 | GAPDH | 0.107 | GAPDH | 0.21 | 18SrRNA | 0.502 | EF1-α | 0.397 |
4 | 18SrRNA | 0.206 | EF1-α | 0.493 | RPL | 0.252 | 18SrRNA | 0.349 | RPL | 0.513 | RPL | 0.452 |
5 | GAPDH | 0.39 | UBC | 0.596 | 18SrRNA | 0.373 | RPL | 0.561 | GAPDH | 0.579 | GAPDH | 0.478 |
6 | EF1-α | 0.414 | GAPDH | 0.604 | TUB | 0.988 | TUB | 0.972 | TUB | 0.762 | TUB | 0.919 |
7 | TUB | 0.533 | TUB | 0.687 | UBC | 1.016 | UBC | 1.134 | UBC | 1.205 | UBC | 1.095 |
Rank | Stability of Tender Leaves at Different Stages | Stability of Tender Leaves of Different Colors | Stability of Different Tender Leaf Colors at Different Stages | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Red Tender Leaves at Different Stages | Green Tender Leaves at Different Stages | Stage 1 Tender Leaves of Different Colors | Stage 2 Tender Leaves of Different Colors | Stage 3 Tender Leaves of Different Colors | ||||||||||||||
Gene | SD | CV | Gene | SD | CV | Gene | SD | CV | Gene | SD | CV | Gene | SD | CV | Gene | SD | CV | |
1 | EF1-α | 0.5 | 2.09 | EF1-α | 0.64 | 2.63 | EF1-α | 0.13 | 0.56 | EF1-α | 0.54 | 2.24 | 18SrRNA | 0.66 | 2.44 | EF1-α | 0.56 | 2.32 |
2 | 18SrRNA | 0.72 | 2.74 | 18SrRNA | 0.95 | 3.64 | GAPDH | 0.15 | 0.55 | 18SrRNA | 0.65 | 2.47 | EF1-α | 0.84 | 3.39 | 18SrRNA | 0.83 | 3.19 |
3 | RPL | 0.8 | 2.83 | RPL | 1.02 | 3.43 | ACT | 0.18 | 0.79 | TUB | 0.7 | 2.83 | RPL | 1.12 | 3.74 | ACT | 0.92 | 3.81 |
4 | UBC | 0.81 | 2.91 | ACT | 1.08 | 4.43 | 18SrRNA | 0.23 | 0.91 | ACT | 0.73 | 3.02 | UBC | 1.13 | 4.03 | RPL | 1 | 3.44 |
5 | ACT | 0.86 | 3.6 | TUB | 1.09 | 4.21 | RPL | 0.34 | 1.2 | GAPDH | 0.77 | 2.71 | TUB | 1.15 | 4.36 | TUB | 1.1 | 4.37 |
6 | TUB | 0.94 | 3.87 | UBC | 1.22 | 4.57 | UBC | 0.76 | 2.87 | RPL | 0.86 | 3 | ACT | 1.31 | 5.22 | UBC | 1.12 | 4.09 |
7 | GAPDH | 1.05 | 3.75 | GAPDH | 1.31 | 4.54 | TUB | 0.84 | 3.49 | UBC | 1.06 | 3.86 | GAPDH | 1.41 | 4.74 | GAPDH | 1.17 | 4.11 |
Rank | Stability of Tender Leaves at Different Stages | Stability of Tender Leaves of Different Colors | Stability of Different Tender Leaf Colors at Different Stages | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Red Tender Leaves at Different Stages | Green Tender Leaves at Different Stages | Stage 1 Tender Leaves of Different Colors | Stage 2 Tender Leaves of Different Colors | Stage 3 Tender Leaves of Different Colors | ||||||||
Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | |
1 | UBC | 0.142 | 18SrRNA | 0.45 | ACT | 0.187 | GAPDH | 0.177 | GAPDH | 0.355 | ACT | 0.397 |
2 | ACT | 0.142 | RPL | 0.45 | EF1-α | 0.187 | ACT | 0.177 | ACT | 0.355 | GAPDH | 0.397 |
3 | RPL | 0.244 | EF1-α | 0.503 | GAPDH | 0.215 | EF1-α | 0.269 | RPL | 0.521 | RPL | 0.502 |
4 | 18SrRNA | 0.291 | ACT | 0.536 | RPL | 0.262 | 18SrRNA | 0.378 | EF1-α | 0.58 | EF1-α | 0.588 |
5 | EF1-α | 0.337 | UBC | 0.569 | 18SrRNA | 0.349 | RPL | 0.485 | TUB | 0.626 | 18SrRNA | 0.618 |
6 | GAPDH | 0.377 | GAPDH | 0.62 | TUB | 0.525 | TUB | 0.616 | 18SrRNA | 0.686 | TUB | 0.704 |
7 | TUB | 0.438 | TUB | 0.67 | UBC | 0.674 | UBC | 0.776 | UBC | 0.854 | UBC | 0.837 |
Rank | Stability of Tender Leaves at Different Stages | Stability of Tender Leaves of Different Colors | Stability of Different Tender Leaf Colors at Different Stages | Evaluation | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Red Tender Leaves at Different Stages | Green Tender Leaves at Different Stages | Stage 1 Tender Leaves of Different Colors | Stage 2 Tender Leaves of Different Colors | Stage 3 Tender Leaves of Different Colors | |||||||||
Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | Gene | Stability Values | ||
1 | ACT | 1.5 | RPL | 1.32 | EF1-α | 1 | ACT | 1.41 | EF1-α | 1.68 | ACT | 1.32 | 7 |
2 | UBC | 2.21 | 18SrRNA | 2.06 | ACT | 1.86 | EF1-α | 1.86 | ACT | 2.21 | EF1-α | 2.45 | 6 |
3 | RPL | 2.71 | EF1-α | 2.63 | GAPDH | 2.71 | GAPDH | 2.59 | 18SrRNA | 2.91 | 18SrRNA | 2.99 | 5 |
4 | 18SrRNA | 3.36 | ACT | 2.83 | RPL | 4.23 | 18SrRNA | 3.36 | RPL | 3.22 | RPL | 3.13 | 4 |
5 | EF1-α | 3.66 | UBC | 5.23 | 18SrRNA | 4.73 | TUB | 5.05 | GAPDH | 3.64 | GAPDH | 3.64 | 3 |
6 | GAPDH | 5.69 | GAPDH | 6.24 | TUB | 6.24 | RPL | 5.23 | TUB | 5.48 | TUB | 5.73 | 2 |
7 | TUB | 6.74 | TUB | 6.44 | UBC | 6.74 | UBC | 7 | UBC | 6.09 | UBC | 6.74 | 1 |
Rank | Gene | Value |
---|---|---|
1 | ACT | 37 |
2 | EF1-α | 34 |
3 | 18SrRNA | 27 |
4 | RPL | 26 |
5 | GAPDH | 20 |
6 | UBC | 13 |
7 | TUB | 11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dai, Q.; Lu, M.; Yang, X.; Lei, C.; Huang, F.; Hu, X.; Huang, X.; Nie, X.; Chen, D.; Huang, S.; et al. qRT-PCR Reference Gene Selection for the Discoloration of Tender Leaves in Hawk Tea (Litsea coreana). Curr. Issues Mol. Biol. 2025, 47, 131. https://doi.org/10.3390/cimb47020131
Dai Q, Lu M, Yang X, Lei C, Huang F, Hu X, Huang X, Nie X, Chen D, Huang S, et al. qRT-PCR Reference Gene Selection for the Discoloration of Tender Leaves in Hawk Tea (Litsea coreana). Current Issues in Molecular Biology. 2025; 47(2):131. https://doi.org/10.3390/cimb47020131
Chicago/Turabian StyleDai, Qianli, Min Lu, Ximeng Yang, Chenggong Lei, Feiyi Huang, Xueping Hu, Xin Huang, Xiaolong Nie, Daojing Chen, Sicheng Huang, and et al. 2025. "qRT-PCR Reference Gene Selection for the Discoloration of Tender Leaves in Hawk Tea (Litsea coreana)" Current Issues in Molecular Biology 47, no. 2: 131. https://doi.org/10.3390/cimb47020131
APA StyleDai, Q., Lu, M., Yang, X., Lei, C., Huang, F., Hu, X., Huang, X., Nie, X., Chen, D., Huang, S., & Zhu, H. (2025). qRT-PCR Reference Gene Selection for the Discoloration of Tender Leaves in Hawk Tea (Litsea coreana). Current Issues in Molecular Biology, 47(2), 131. https://doi.org/10.3390/cimb47020131