Expression Localization of the KRT32 Gene and Its Association of Genetic Variation with Wool Traits
Abstract
:1. Introduction
2. Materials and Methods
2.1. Collection of Wool, Blood and Tissue Samples from Sheep Samples
2.2. RT-qPCR Analysis
2.3. Immunofluorescence Analysis
2.4. PCR Amplification and Genotyping
2.5. Statistics and Analysis
3. Results
3.1. Expression of KRT32 mRNA in the Skin of Different Tissues and Stages of Gansu Alpine Fine-Wool Sheep
3.2. Expression Localization and Distribution Density of KRT32 Encoding Protein in SKIN Tissues of Gansu Alpine Fine-Wool Sheep of Various Ages
3.3. Genotyping and Polymorphism Analysis
3.4. Analysis of the Association of SNPs with Wool Traits
3.5. Haplotype Reconstruction of Gene SNPs and Association Analysis of Haplotype Combinations with Wool Traits
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhou, Q.; Wang, W.; Zhang, Y.; Hurren, C.J.; Li, Q. Analyzing the thermal and hygral behavior of wool and its impact on fabric dimensional stability for wool processing and garment manufacturing. Text. Res. J. 2020, 90, 2175–2183. [Google Scholar] [CrossRef]
- Bear, R.S.; Rugo, H.J. The results of x-ray diffraction studies on keratin fibers. Ann. N. Y. Acad. Sci. 1951, 53, 627–648. [Google Scholar] [CrossRef] [PubMed]
- Koehn, H.; Clerens, S.; Deb-Choudhury, S.; Morton, J.D.; Dyer, J.M.; Plowman, J.E. Higher sequence coverage and improved confidence in the identification of cysteine-rich proteins from the wool cuticle using combined chemical and enzymatic digestion. J. Proteom. 2009, 73, 323–330. [Google Scholar] [CrossRef] [PubMed]
- Parbhu, A.N.; Bryson, W.G.; Lal, R. Disulfide bonds in the outer layer of keratin fibers confer higher mechanical rigidity: Correlative nano-indentation and elasticity measurement with an AFM. Biochemistry 1999, 38, 11755–11761. [Google Scholar] [CrossRef] [PubMed]
- Sajid, L.; Azmami, O.; El Ahmadi, Z.; Benayada, A.; Majid, S.; Gmouh, S. Introduction of raw palm fibers in the textile industry by development of nonwoven composite materials based on Washingtonia palm fibers. J. Text. Inst. 2021, 112, 1717–1729. [Google Scholar] [CrossRef]
- Liu, G.; Liu, R.; Tang, X.; Cao, J.; Zhao, S.; Yu, M. Expression profiling reveals genes involved in the regulation of wool follicle bulb regression and regeneration in sheep. Int. J. Mol. Sci. 2015, 16, 9152–9166. [Google Scholar] [CrossRef]
- Plowman, J.E.; Deb-Choudhury, S.; Bryson, W.G.; Clerens, S.; Dyer, J.M. Protein expression in orthocortical and paracortical cells of merino wool fibers. J. Agric. Food Chem. 2009, 57, 2174–2180. [Google Scholar] [CrossRef] [PubMed]
- Plowman, J.E. The proteomics of keratin proteins. J. Chromatogr. B 2007, 849, 181–189. [Google Scholar] [CrossRef]
- Sulayman, A.; Tursun, M.; Sulaiman, Y.; Huang, X.; Tian, K.; Tian, Y.; Xu, X.; Fu, X.; Mamat, A.; Tulafu, H. Association analysis of polymorphisms in six keratin genes with wool traits in sheep. Asian-Australas. J. Anim. Sci. 2018, 31, 775–783. [Google Scholar] [CrossRef]
- Bao, Q.; Zhang, X.; Bao, P.; Liang, C.; Guo, X.; Yin, M.; Chu, M.; Yan, P. Genome-wide identification, characterization, and expression analysis of keratin genes (KRTs) family in yak (Bos grunniens). Gene 2022, 818, 146247. [Google Scholar] [CrossRef]
- Zhou, H.; Hickford, J.G.; Fang, Q. A two-step procedure for extracting genomic DNA from dried blood spots on filter paper for polymerase chain reaction amplification. Anal. Biochem. 2006, 354, 159–161. [Google Scholar] [CrossRef] [PubMed]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Chai, W.Q.; Zhou, H.T.; Forrest, R.H.J.; Gong, H.; Hodge, S.; Hickford, J.G.H. Polymorphism of KRT83 and its association with selected wool traits in Merino-cross lambs. Small Rumin. Res. 2017, 155, 6–11. [Google Scholar] [CrossRef]
- Chai, W.; Zhou, H.; Gong, H.; Wang, J.; Luo, Y.; Hickford, J.G.H. Nucleotide variation in the ovine KRT31 promoter region and its association with variation in wool traits in Merino-cross lambs. J. Agric. Sci. 2019, 157, 182–188. [Google Scholar] [CrossRef]
- Pillemer, L.; Ecker, E.E.; Wells, J.R. The Specificity of Keratins. J. Exp. Med. 1939, 69, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Frater, R. Immunological studies on wool proteins. Aust. J. Biol. Sci. 1968, 21, 815–819. [Google Scholar] [CrossRef] [PubMed]
- Pillemer, L.; Ecker, E.E.; Martiensen, E.W. The Specificity of Kerateine Derivatives. J. Exp. Med. 1939, 70, 387–397. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.D.; Wildermoth, J.E.; Wallace, O.A.M.; Gordon, S.W.; Maqbool, N.J.; Maclean, P.H.; Nixon, A.J.; Pearson, A.J. Annotation of sheep keratin intermediate filament genes and their patterns of expression. Exp. Dermatol. 2011, 20, 582–588. [Google Scholar] [CrossRef] [PubMed]
- Rajendran, R.L.; Gangadaran, P.; Kwack, M.H.; Oh, J.M.; Hong, C.M.; Sung, Y.K.; Lee, J.; Ahn, B.C. Application of extracellular vesicles from mesenchymal stem cells promotes hair growth by regulating human dermal cells and follicles. World J. Stem. Cells 2022, 14, 527–538. [Google Scholar] [CrossRef]
- Chen, J.; Jaeger, K.; Den, Z.; Koch, P.J.; Sundberg, J.P.; Roop, D.R. Mice expressing a mutant Krt75 (K6hf) allele develop hair and nail defects resembling pachyonychia congenita. J. Investig. Dermatol. 2008, 128, 270–279. [Google Scholar] [CrossRef]
- Chai, W.Q.; Zhou, H.T.; Gong, H.; Hickford, J.G.H. Variation in the ovine promoter region affects wool traits. Small Rumin. Res. 2022, 206, 106586. [Google Scholar] [CrossRef]
- Li, X.D.; Liu, X.M.; Fan, Y.H.; Li, S.T.; Yu, M.N.; Qian, M.C.; Chen, Y.L.; Chen, H.Q.; Li, X.C.; Liu, B.; et al. Development of a target capture sequencing SNP genotyping platform for genetic analysis and genomic breeding in rapeseed. Crop. J. 2023, 11, 499–510. [Google Scholar] [CrossRef]
- Wu, Z.L.; Chen, S.Y.; Jia, X.B.; Lai, S.J. Association of a synonymous mutation of the PGAM2 gene and growth traits in rabbits. Czech J. Anim. Sci. 2015, 60, 139–144. [Google Scholar] [CrossRef]
- Xu, D.; Wang, X.J.; Wang, W.M.; Zhang, D.Y.; Li, X.L.; Zhang, Y.K.; Zhao, Y.; Cheng, J.B.; Zhao, L.M.; Wang, J.H.; et al. Detection of single nucleotide polymorphism in HTR4 and its relationship with growth traits in sheep. Anim. Biotechnol. 2023, 34, 4600–4607. [Google Scholar] [CrossRef]
- Cheng, J.B.; Zhang, X.X.; Li, F.D.; Yuan, L.F.; Zhang, D.Y.; Zhang, Y.K.; Song, Q.Z.; Li, X.L.; Zhao, Y.; Xu, D.; et al. Detecting Single Nucleotide Polymorphisms in MEF2B and UCP3 and Elucidating Their Association with Sheep Growth Traits. DNA Cell Biol. 2021, 40, 1554–1562. [Google Scholar] [CrossRef]
- Cesarato, N.; Wehner, M.; Ghughunishvili, M.; Schmidt, A.; Axt, D.; Thiele, H.; Lentze, M.J.; Has, C.; Geyer, M.; Basmanav, F.B.; et al. Four hypotrichosis families with mutations in the gene LSS presenting with and without neurodevelopmental phenotypes. Am. J. Med. Genet. Part A 2021, 185, 3900–3904. [Google Scholar] [CrossRef]
- Sharma, Y.; Miladi, M.; Dukare, S.; Boulay, K.; Caudron-Herger, M.; Gross, M.; Backofen, R.; Diederichs, S. A pan-cancer analysis of synonymous mutations. Nat. Commun. 2019, 10, 2569. [Google Scholar] [CrossRef]
- Kimchi-Sarfaty, C.; Oh, J.M.; Kim, I.W.; Sauna, Z.E.; Calcagno, A.M.; Ambudkar, S.V.; Gottesman, M.M. A “silent” polymorphism in the MDR1 gene changes substrate specificity. Science 2007, 315, 525–528. [Google Scholar] [CrossRef]
- Andken, B.B.; Lim, I.; Benson, G.; Vincent, J.J.; Ferenc, M.T.; Heinrich, B.; Jarzylo, L.A.; Man, H.Y.; Deshler, J.O. 3′-UTR SIRF: A database for identifying clusters of whort interspersed repeats in 3′ untranslated regions. BMC Bioinform. 2007, 8, 274. [Google Scholar] [CrossRef] [PubMed]
- Matoulkova, E.; Michalova, E.; Vojtesek, B.; Hrstka, R. The role of the 3′ untranslated region in post-transcriptional regulation of protein expression in mammalian cells. RNA Biol. 2012, 9, 563–576. [Google Scholar] [CrossRef] [PubMed]
- Kuersten, S.; Goodwin, E.B. The power of the 3′ UTR: Translational control and development. Nat. Rev. Genet. 2003, 4, 626–637. [Google Scholar] [CrossRef]
- Day, L.; Abdelhadi Ep Souki, O.; Albrecht, A.A.; Steinhofel, K. Accessibility of microRNA binding sites in metastable RNA secondary structures in the presence of SNPs. Bioinformatics 2014, 30, 343–352. [Google Scholar] [CrossRef]
- Horne, B.D.; Camp, N.J. Principal component analysis for selection of optimal SNP-sets that capture intragenic genetic variation. Genet. Epidemiol. 2004, 26, 11–21. [Google Scholar] [CrossRef]
- McGregor, B.A.; Doughty, A.; Thompson, J.; Naebe, M.; Tester, D. Effects of variation in wool fiber curvature and yarn hairiness on sensorial assessment of knitted fabrics. Text. Res. J. 2015, 85, 1153–1166. [Google Scholar] [CrossRef]
Gene | GenBank Accession No. | Primer Sequence (5′-3′) | Product Size (bp) | Annealing Temperature (°C) |
---|---|---|---|---|
KRT32 | XM_0040112899.5 | F: GGACAGTGAGGACTGCAAGTT | 185 | 60 |
R: GCACACAAGGCACACAGACG | ||||
β-actin | NM_001009784 | F: AGCCTTCCTTCCTGGGCATGGA | 113 | 60 |
R: GGACAGCACCGTGTTGGCGTAGA |
Gene | Exon | Forward (5′→3′) | Reverse (5′→3′) | Product Length (bp) | Tm/°C |
---|---|---|---|---|---|
KRT32 (XM_004012899.5) | 1 | TTAGCAGCTTCCTCTGGGATTGAGTC | GGGAAGTTTCTTTTCCCTGAATGTAGC | 670 | 62 |
6 | TTTTAGTTGTTTGAGAAACTTCCACACTG | CACCATGAGTACCTGCCTGACTTCTC | 468 | 60 | |
7 | GAGCCGTTGGAAAGCACAAAGG | TTCGTCTGGAGCCCAACTGAGC | 612 | 60 |
SNP | Primer | Primer Sequences (5′–3′) | Fluorescent Signal | Genotype |
---|---|---|---|---|
g.21455859 T>C | Ft | GAAGGTGACCAAGTTCATGCTCTGCAGCCTTTCCGACGT | FAM | T |
Fc | GAAGGTCGGAGTCAACGGATTTGCAGCCTTTCCGACGC | HEX | C | |
R | GACAGAGGAGGATCAGGGTCAG | / | / | |
g.21455953 G>A | Rc | GAAGGTGACCAAGTTCATGCTCAGGCTGGCAGATGTAACCC | FAM | G |
Rt | GAAGGTCGGAGTCAACGGATTCCAGGCTGGCAGATGTAACCT | HEX | A | |
F | GACCCTGATCCTCCTCTGTCAG | / | / | |
g.21455976 T>C | Ft | GAAGGTGACCAAGTTCATGCTCATCTGCCAGCCTGGGGT | FAM | T |
Fc | GAAGGTCGGAGTCAACGGATTATCTGCCAGCCTGGGGC | HEX | C | |
R | GCTAGTTGGGTGGTAGGTGGTG | / | / | |
g.21456106 G>A | Rc | GAAGGTGACCAAGTTCATGCTCAGCCAGGCGGCTGTTC | FAM | G |
Rt | GAAGGTCGGAGTCAACGGATTCAGCCAGGCGGCTGTTT | HEX | A | |
F | GCAACGAGAAGGAGACCCTG | / | / | |
g.21460798 G>A | Fg | GAAGGTGACCAAGTTCATGCTGCAGGGCCTGGTCACCG | FAM | G |
Fa | GAAGGTCGGAGTCAACGGATTGCAGGGCCTGGTCACCA | HEX | A | |
R | GGTCACAGCGGATCTCAGCC | / | / | |
g.21460884 A>G | Fg | GAAGGTGACCAAGTTCATGCTGCAGGGCCTGGTCACCG | FAM | A |
Fa | GAAGGTCGGAGTCAACGGATTGCAGGGCCTGGTCACCA | HEX | G | |
R | GGTCACAGCGGATCTCAGCC | / | / | |
g.21463485 T>C | Ft | GAAGGTGACCAAGTTCATGCTCTGGTGCTTCCTGAGGCTGT | FAM | T |
Fc | GAAGGTCGGAGTCAACGGATTGGTGCTTCCTGAGGCTGC | HEX | C | |
R | GCCCTGCTCTTTTGGTGG | / | / | |
g.21463503 C>G | Rg | GAAGGTGACCAAGTTCATGCTCTGCTCTTTTGGTGGCCG | FAM | C |
Rc | GAAGGTCGGAGTCAACGGATTCTGCTCTTTTGGTGGCCC | HEX | G | |
F | ACTGGGTGGCTGGTGCTTC | / | / |
Names | Days | Corneum | Inner Root Sheath | Outer Root Sheath | Hair Medulla | Sebaceous Gland | Dermal Papilla |
---|---|---|---|---|---|---|---|
KRT32 | 1 | +++ | +++ | +++ | ++++ | ++ | +++ |
30 | +++ | ++++ | ++++ | ++++ | ++++ | ++++ | |
60 | +++ | ++++ | ++++ | ++++ | ++++ | ++++ | |
90 | +++ | ++++ | ++++ | ++++ | ++++ | ++++ | |
180 | +++ | ++++ | ++++ | ++++ | ++++ | ++++ | |
270 | +++ | ++++ | ++++ | ++++ | ++++ | ++++ |
Gene | SNP | Locus | Polymorphism Information Content (PIC) | Genotype Frequency (n) | Gene Frequency | |||
---|---|---|---|---|---|---|---|---|
KRT32 | SNP1 | g.21455859 T>C | 0.3669 | TT 0.223 (50) | TC 0.375 (84) | CC 0.402 (90) | T 0.410 | C 0.589 |
SNP2 | g.21455953 G>A | 0.3742 | GG 0.231 (53) | GA 0.480 (110) | AA 0.288 (66) | G 0.472 | A 0.528 | |
SNP3 | g.21455976 T>C | 0.3565 | TT 0.140 (32) | TC 0.452 (103) | CC 0.408 (93) | T 0.366 | C 0.634 | |
SNP4 | g.21456106 G>A | 0.3742 | GG 0.231 (53) | GA 0.480 (110) | AA 0.288 (66) | G 0.472 | A 0.528 | |
SNP5 | g.21460798 G>A | 0.3565 | GG 0.140 (32) | GA 0.452 (103) | AA 0.408 (93) | G 0.366 | A 0.634 | |
SNP6 | g.21460884 A>G | 0.3607 | AA 0.153 (35) | AG 0.459 (105) | GG 0.389 (89) | A 0.382 | G 0.618 | |
SNP7 | g.21463485 T>C | 0.2621 | TT 0.712 (163) | TC 0.248 (59) | CC 0.031 (7) | T 0.840 | C 0.159 | |
SNP8 | g.21463503 C>G | 0.1079 | CC 0.887 (205) | CG 0.103 (24) | GG 0.008 (2) | C 0.939 | G 0.061 |
SNPs | Genotype (n) | MFD (µm) | FDSD (µm) | CVFD | CF (%) | MSL (mm) | MSS (cN/dT) | MFC (o/mm) |
---|---|---|---|---|---|---|---|---|
SNP1 | TC (84) | 22.10 ± 2.86 | 5.69 ± 1.11 | 25.70 ± 3.17 a | 88.20 ± 11.37 | 72.81 ± 15.33 | 14.89 ± 6.33 | 106.44 ± 11.50 ab |
TT (50) | 21.79 ± 2.80 | 5.42 ± 0.90 | 24.85 ± 3.16 ab | 89.68 ± 10.29 | 71.78 ± 12.74 | 13.43 ± 5.74 | 109.48 ± 11.00 a | |
CC (90) | 22.72 ± 3.00 | 5.60 ± 1.08 | 24.62 ± 3.16 b | 86.36 ± 12.64 | 73.28 ± 14.25 | 14.40 ± 5.95 | 102.98 ± 12.12 b | |
SNP2 | GA (110) | 22.14 ± 2.90 | 5.62 ± 1.13 | 24.85 ± 3.35 | 88.23 ± 11.47 | 72.97 ± 15.07 | 14.57 ± 6.21 | 105.24 ± 11.52 ab |
GG (53) | 21.91 ± 2.80 | 5.47 ± 0.90 | 24.47 ± 2.42 | 89.25 ± 10.29 | 72.17 ± 12.60 | 13.67 ± 5.73 | 108.38 ± 11.12 a | |
AA (66) | 22.79 ± 2.91 | 5.65 ± 1.01 | 24.44 ± 2.88 | 85.91 ± 12.85 | 73.52 ± 14.27 | 14.90 ± 5.66 | 102.48 ± 12.24 b | |
SNP3 | TC (103) | 22.08 ± 2.87 | 5.65 ± 1.09 | 25.53 ± 3.05 a | 88.30 ± 11.34 | 72.86 ± 15.13 | 14.80 ± 6.30 | 107.26 ± 11.23 a |
TT (32) | 21.64 ± 2.65 | 5.38 ± 0.80 | 24.86 ± 2.43 ab | 90.41 ± 9.51 | 71.75 ± 12.22 | 13.17 ± 5.60 | 108.36 ± 11.89 a | |
CC (93) | 22.75 ± 2.99 | 5.62 ± 1.07 | 24.67 ± 3.12 b | 86.22 ± 12.52 | 73.45 ± 14.11 | 14.57 ± 5.66 | 102.81 ± 12.00 b | |
SNP4 | GA (110) | 22.188 ± 2.88 | 5.62 ± 1.33 | 25.29 ± 3.38 | 88.15 ± 11.42 | 72.70 ± 15.36 | 14.66 ± 6.22 | 105.83 ± 11.66 ab |
GG (53) | 21.91 ± 2.80 | 5.47 ± 0.89 | 24.92 ± 2.38 | 89.24 ± 10.29 | 72.17 ± 12.59 | 13.67 ± 5.73 | 108.82 ± 11.10 a | |
AA (66) | 22.79 ± 2.99 | 5.65 ± 1.01 | 24.80 ± 2.87 | 85.90 ± 12.85 | 73.51 ± 14.32 | 14.90 ± 5.66 | 102.87 ± 12.22 b | |
SNP5 | GA (103) | 22.08 ± 2.87 | 5.64 ± 1.09 | 25.53 ± 3.05 a | 88.30 ± 11.33 | 72.86 ± 15.14 | 14.79 ± 6.30 | 107.25 ± 11.23 a |
GG (32) | 21.64 ± 2.65 | 5.38 ± 0.80 | 24.86 ± 2.43 ab | 90.41 ± 9.51 | 71.75 ± 12.22 | 13.17 ± 5.60 | 108.36 ± 11.89 a | |
AA (93) | 22.75 ± 2.90 | 5.62 ± 1.07 | 24.67 ± 3.13 b | 86.21 ± 12.52 | 73.45 ± 14.11 | 14.57 ± 5.66 | 102.80 ± 12.00 b | |
SNP6 | AG (35) | 22.08 ± 2.95 | 5.62 ± 1.08 | 25.42 ± 3.06 | 88.21 ± 11.51 | 72.43 ± 15.22 | 14.69 ± 6.25 | 107.60 ± 11.17 a |
AA (105) | 21.66 ± 2.59 | 5.41 ± 0.81 | 24.96 ± 2.40 | 90.40 ± 9.39 | 72.31 ± 12.00 | 13.59 ± 5.98 | 107.91 ± 11.69 a | |
GG (89) | 22.75 ± 2.94 | 5.64 ± 1.08 | 24.73 ± 3.15 | 86.28 ± 12.48 | 73.80 ± 14.03 | 14.53 ± 5.58 | 102.29 ± 11.93 b | |
SNP7 | TC (59) | 22.38 ± 3.10 | 5.45 ± 0.91 | 24.36 ± 2.31 b | 87.46 ± 12.60 | 75.20 ± 14.59 | 15.09 ± 5.79 | 103.46 ± 12.20 |
TT (163) | 22.24 ± 2.83 | 5.65 ± 1.08 | 25.37 ± 3.21 a | 87.93 ± 11.21 | 72.21 ± 14.13 | 14.20 ± 6.04 | 106.20 ± 11.60 | |
CC (7) | 22.24 ± 3.68 | 5.48 ± 1.40 | 24.43 ± 2.81 ab | 87.57 ± 15.22 | 71.00 ± 14.79 | 15.21 ± 5.06 | 109.30 ± 12.14 | |
SNP8 | CG (24) | 23.175 ± 3.72 a | 5.59 ± 1.41 | 24.10 ± 2.37 | 83.67 ± 16.90 b | 75.83 ± 14.43 | 16.15 ± 6.48 | 102.00 ± 13.12 |
CC (205) | 22.20 ± 2.80 ab | 5.60 ± 1.04 | 25.20 ± 3.06 | 88.28 ± 10.83 a | 72.60 ± 14.25 | 14.26 ± 5.86 | 106.01 ± 11.59 | |
GG (2) | 19.15 ± 0.64 b | 4.85 ± 0.07 | 25.35 ± 1.34 | 87.80 ± 11.65 ab | 72.00 ± 4.24 | 11.37 ± 3.63 | 105.58 ± 11.79 |
Haplotype | SNP2 | SNP3 | SNP4 | SNP5 | Frequency/% | Haplotype Combination | Frequency/% | Haplotype Combination | Frequency/% |
---|---|---|---|---|---|---|---|---|---|
H1 | A | C | A | A | 52.8 | H1H1 | 28.9 | H2H2 | 14.0 |
H2 | G | T | G | G | 36.6 | H1H2 | 37.2 | H2H3 | 7.9 |
H3 | G | C | G | A | 6.1 | H1H3 | 10.5 | H3H3 | 1.4 |
H4 | G | T | G | A | 4.5 |
Genes | Haplotype Combination | MFD (µm) | FDSD (µm) | CVFD | CF (%) | MSL (mm) | MSS (cN/dT) | MFC (o/mm) |
---|---|---|---|---|---|---|---|---|
KRT32 | H1H1 | 22.79 ± 0.37 | 5.65 ± 0.13 | 24.80 ± 0.35 | 85.91 ± 1.58 | 73.51 ± 1.76 | 14.90 ± 0.69 | 102.87 ± 1.50 ab |
H1H2 | 22.08 ± 0.31 | 5.68 ± 0.12 | 25.67±±0.34 | 88.28 ± 1.23 | 73.08 ± 1.68 | 14.98 ± 0.69 | 106.36 ± 1.24 ab | |
H1H3 | 22.50 ± 0.64 | 5.45 ± 0.26 | 24.11 ± 0.79 | 87.58 ± 2.49 | 72.63 ± 2.93 | 13.28 ± 1.16 | 103.27 ± 2.46 ab | |
H2H2 | 21.64 ± 0.47 | 5.38 ± 0.14 | 24.86 ± 0.43 | 90.41 ± 1.68 | 71.75 ± 2.16 | 13.16 ± 0.99 | 108.36 ± 2.10 a | |
H2H3 | 22.07 ± 0.73 | 5.50 ± 0.25 | 24.83 ± 0.57 | 88.39 ± 2.76 | 71.83 ± 3.29 | 13.90 ± 1.44 | 111.48 ± 2.17 a | |
H3H3 | 23.90 ± 1.45 | 6.23 ± 0.29 | 26.20 ± 1.06 | 82.00 ± 5.03 | 73.67 ± 2.27 | 17.67 ± 2.65 | 97.70 ± 3.74 b | |
p value | 0.094 | 0.0880 | 0.136 | 0.122 | 0.309 | 0.103 | 0.029 |
Haplotype | SNP6 | SNP7 | Frequency/% | Haplotype Combination | Frequency/% | Haplotype Combination | Frequency/% |
---|---|---|---|---|---|---|---|
H1 | G | T | 46.4 | H1H1 | 20.0 | H2H2 | 15.3 |
H2 | A | T | 38.1 | H1H2 | 35.8 | H2H3 | 10.0 |
H3 | G | C | 15.5 | H1H3 | 15.7 | H3H3 | 3.1 |
Genes | Haplotype Combination | MFD (µm) | FDSD (µm) | CVFD | CF (%) | MSL (mm) | MSS (cN/dT) | MFC (o/mm) |
---|---|---|---|---|---|---|---|---|
KRT32 | H1H1 | 22.48 ± 0.38 ab | 5.69 ± 1.17 | 25.27 ± 0.54 | 87.63 ± 1.58 ab | 73.46 ± 2.01 | 13.68 ± 0.81 | 103.21 ± 1.66 ab |
H1H2 | 22.36 ± 0.34 ab | 5.73 ± 0.13 | 25.61 ± 0.36 | 87.04 ± 1.34 ab | 71.46 ± 1.69 | 14.75 ± 0.70 | 107.14 ± 1.28 a | |
H1H3 | 23.19 ± 0.55 a | 5.59 ± 0.16 | 24.10 ± 0.40 | 84.31 ± 2.34 b | 74.78 ± 2.45 | 15.48 ± 0.96 | 99.76 ± 2.06 b | |
H2H2 | 21.66 ± 0.44 ab | 5.41 ± 0.14 | 24.96 ± 0.41 | 90.40 ± 1.59 ab | 72.31 ± 2.03 | 13.59 ± 1.01 | 107.91 ± 1.98 a | |
H2H3 | 21.10 ± 0.49 b | 5.23 ± 0.16 | 24.77 ± 0.45 | 92.39 ± 1.66 a | 75.87 ± 3.07 | 14.48±±1.24 | 109.25 ± 1.99 a | |
H3H3 | 22.24 ± 1.39 ab | 5.48 ± 0.53 | 24.43 ± 1.06 | 87.57 ± 2.75 ab | 71.00 ± 5.59 | 15.21 ± 1.91 | 109.30 ± 0.78 a | |
p value | 0.026 | 0.174 | 0.153 | 0.027 | 0.339 | 0.373 | 0.005 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Zhao, F.; He, Z.; Sun, H.; Xi, Q.; Yu, X.; Ding, Y.; An, Z.; Wang, J.; Liu, X.; et al. Expression Localization of the KRT32 Gene and Its Association of Genetic Variation with Wool Traits. Curr. Issues Mol. Biol. 2024, 46, 2961-2974. https://doi.org/10.3390/cimb46040185
Chen Z, Zhao F, He Z, Sun H, Xi Q, Yu X, Ding Y, An Z, Wang J, Liu X, et al. Expression Localization of the KRT32 Gene and Its Association of Genetic Variation with Wool Traits. Current Issues in Molecular Biology. 2024; 46(4):2961-2974. https://doi.org/10.3390/cimb46040185
Chicago/Turabian StyleChen, Zhanzhao, Fangfang Zhao, Zhaohua He, Hongxian Sun, Qiming Xi, Xueqin Yu, Yuan Ding, Ze An, Jiqing Wang, Xiu Liu, and et al. 2024. "Expression Localization of the KRT32 Gene and Its Association of Genetic Variation with Wool Traits" Current Issues in Molecular Biology 46, no. 4: 2961-2974. https://doi.org/10.3390/cimb46040185