Calcium-Binding Protein and Polymorphism in Musa spp. Somaclones Resistant to Fusarium oxysporum
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Extraction and Quantification of Genomic DNA
2.3. Polymerase Chain Reaction and Molecular Characterization
2.4. Molecular Data Analysis and Sequencing
3. Results
3.1. Evaluation of Somaclones Based on the Electrophoretic Profile
3.2. Analysis of Polymorphic Bands and Sequencing
4. Discussion
4.1. Evaluation of Somaclones Based on Electrophoretic Profiles
4.2. Evaluation of Polymorphic Bands and Sequencing
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rijzaani, H.; Bayer, P.E.; Rouard, M.; Doležel, J.; Batley, J.; Edwards, D. The pangenome of banana highlights differences between genera and genomes. Plant Genome 2022, 15, e20100. [Google Scholar] [CrossRef] [Scilit]
- Fu, N.; Ji, M.; Rouard, M.; Yan, H.-F.; Ge, X.-J. Comparative plastome analysis of Musaceae and new insights into phylogenetic relationships. BMC Genom. 2022, 23, 223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- FAO—Food and Agriculture Organization of the United Nations. Faostat. 2024. Available online: https://www.fao.org/faostat/en/#data/QCL/visualize (accessed on 10 July 2024).
- Bebber, D.P. The long road to a sustainable banana trade. Plants People Planet 2023, 5, 662–671. [Google Scholar] [CrossRef] [Scilit]
- Castelan, F.P.; Saraiva, L.A.; Lange, F.; De Lapeyre de Bellaire, L.; Cordenunsi, B.R.; Chillet, M. Effects of Black Leaf Streak disease and Sigatoka disease on fruit quality and maturation process of bananas produced in the subtropical conditions of southern Brazil. Crop Prot. 2012, 35, 127–131. [Google Scholar] [CrossRef] [Scilit]
- Ocimati, W.; Bouwmeester, H.; Groot, J.C.J.; Tittonell, P.; Brown, D.; Blomme, G. The risk posed by Xanthomonas wilt disease of banana: Mapping of disease hotspots, fronts and vulnerable landscapes. PLoS ONE 2019, 14, e0213691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simbare, A.; Sane, C.A.B.; Nduwimana, I.; Niyongere, C.; Omondi, B.A. Diminishing farm diversity of East African highland bananas in Banana Bunchy Top Disease outbreak areas of Burundi—The effect of both disease and control approaches. Sustainability 2020, 12, 7467. [Google Scholar] [CrossRef] [Scilit]
- Segura-Mena, R.A.S.; Stoorvogel, J.J.; García-Bastidas, F.; Salacinas-Niez, M.; Kema, G.H.J.; Sandoval, J.A. Evaluating the potential of soil management to reduce the effect of Fusarium oxysporum f. sp. cubense in banana (Musa AAA). Eur. J. Plant Pathol. 2021, 160, 441–455. [Google Scholar] [CrossRef] [Scilit]
- Ploetz, R.C. Management of Fusarium wilt of banana: A review with special reference to tropical race 4. Crop Prot. 2015, 73, 7–15. [Google Scholar] [CrossRef] [Scilit]
- Warman, N.M.; Aitken, E.A.B. The movement of Fusarium oxysporum f. sp. cubense (Sub-Tropical Race 4) in susceptible cultivars of banana. Front. Plant Sci. 2018, 9, 1748. [Google Scholar] [CrossRef] [Scilit]
- Pegg, K.G.; Coates, L.M.; O’Neill, W.T.; Turner, D.W. The epidemiology of Fusarium Wilt of banana. Front. Plant Sci. 2019, 10, 1395. [Google Scholar] [CrossRef] [Scilit]
- Ghag, S.B.; Shekhawat, U.K.S.; Ganapathi, T.R. Fusarium wilt of banana: Biology, epidemiology and management. Int. J. Pest Manag. 2015, 61, 250–263. [Google Scholar] [CrossRef] [Scilit]
- Dita, M.A.; Barquero, M.; Heck, D.; Mizubuti, E.S.G.; Staver, C.P. Fusarium Wilt of banana: Current knowledge on epidemiology and research needs toward sustainable disease management. Front. Plant Sci. 2018, 9, 1468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Staver, C.; Pemsl, D.E.; Scheerer, L.; Perez-Vicent, L.F.; Dita, M. Ex ante assessment of returns on research investments to address the impact of Fusarium wilt tropical race 4 on global banana production. Front. Plant Sci. 2020, 11, 844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ploetz, R.C. Fusarium Wilt of banana is caused by several pathogens referred to as Fusarium oxysporum f. sp. cubense. Phytopathology 2006, 96, 653–656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peredo, E.L.; Arroyo-García, R.; Revilla, M.Á. Epigenetic changes detected in micropropagated hop plants. J. Plant Physiol. 2009, 166, 1101–1111. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, M.D.S.; Rocha, A.D.J.; Nascimento, F.D.S.; Oliveira, W.D.D.S.; Soares, J.M.D.S.; Rebouças, T.A.; Morais Lino, L.S.; Haddad, F.; Ferreira, C.F.; Santos-Serejo, J.A.D.; et al. The role of somaclonal variation in plant genetic improvement: A systematic review. Agronomy 2023, 13, 730. [Google Scholar] [CrossRef] [Scilit]
- Bairu, M.W.; Aremu, A.O.; Van Staden, J. Somaclonal variation in plants: Causes and detection methods. Plant Growth Regul. 2011, 63, 147–173. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, M.d.S.; de Moura, É.R.; Lino, L.S.M.; Amorim, E.P.; dos Santos-Serejo, J.A.; Haddad, F. Selection of somaclonal variants of the cultivar ‘Prata-Anã’ for resistance to Fusarium oxysporum f. sp. cubense race 1. Rev. Bras. Frutic. 2020, 42, e-620. [Google Scholar] [CrossRef] [Scilit]
- Maciejewski, P.; Ramm, A.; Moreira, R.M.; Oliveira, B.A.S.; Mattos, M.G.; Assis, A.M.; Schuch, M.W. In vitro subcultures of blueberry cultivars. Braz. J. Dev. 2020, 6, 46380–46389. [Google Scholar] [CrossRef] [Scilit]
- Rebouças, T.A.; Rocha, A.J.; Cerqueira, T.S.; Adorno, P.R.; Barreto, R.Q.; Ferreira, M.S.; Lino, L.S.M.; Amorim, V.B.O.; Santos-Serejo, J.A.; Haddad, F.; et al. Pre-selection of banana somaclones resistant to Fusarium oxysporum f. sp. cubense, subtropical race 4. Crop Prot. 2021, 147, 105692. [Google Scholar] [CrossRef] [Scilit]
- Oh, T.J.; Cullis, M.A.; Kunert, K.; Engelborghs, I.; Swennen, R.; Cullis, C.A. Genomic changes associated with somaclonal variation in banana (Musa spp.). Physiol. Plant. 2007, 129, 766–774. [Google Scholar] [CrossRef] [Scilit]
- Roux, N.; Chase, R.; Van Den Houwe, I.; Chao, C.-P.; Perrier, X.; Jacquemoud-Collet, J.P.; Sardos, J.; Rouard, M. Somaclonal variation in clonal crops: Containing the bad, exploring the good. In Mutation Breeding, Genetic Diversity and Crop Adaptation to Climate Change; Sivasankar, S., Ellis, N., Jankuloski, L., Ingelbrecht, I., Eds.; CABI: Oxfordshire, UK, 2021; pp. 355–365. ISBN 978-1-78924-910-1. Available online: https://hdl.handle.net/10568/116597 (accessed on 26 October 2023).
- Arvas, Y.E.; Kocaçalişkan, İ.; Ordu, E.; Erişen, S. Comparative retrotransposon analysis of mutant and non-mutant rice varieties grown at different salt concentrations. Biotechnol. Biotechnol. Equip. 2022, 36, 25–34. [Google Scholar] [CrossRef] [Scilit]
- Häkkinen, M.; Teo, C.H.; Othman, Y.R. Genome constitution for Musa beccarii (Musaceae) varieties. J. Syst. Evol. 2007, 45, 69–74. [Google Scholar]
- Teo, C.H.; Tan, S.H.; Ho, C.L.; Faridah, Q.Z.; Othman, Y.R.; Heslop-Harrison, J.S.; Kalendar, R.N.; Schulman, A.H. Genome constitution and classification using retrotransposon-based markers in the orphan crop banana. J. Plant Biol. 2005, 48, 96–105. [Google Scholar] [CrossRef] [Scilit]
- De Carvalho Santos, T.T.; de Oliveira Amorim, V.B.; dos Santos-Serejo, J.A.; Silva Ledo, C.A.; Haddad, F.; Ferreira, C.F.; Amorim, E.P. Genetic variability among autotetraploid populations of banana plants derived from wild diploids through chromosome doubling using SSR and molecular markers based on retrotransposons. Mol. Breed. 2019, 39, 95. [Google Scholar] [CrossRef] [Scilit]
- Saraswathi, M.S.; Uma, S.; Ramaraj, S.; Durai, P.; Mustaffa, M.M.; Kalaiponmani, K.; Chandrasekar, A. Inter retrotransposon based genetic diversity and phylogenetic analysis among the Musa germplasm accessions. J. Plant Biochem. Biotechnol. 2020, 29, 114–124. [Google Scholar] [CrossRef] [Scilit]
- Du, C.; Swigoňová, Z.; Messing, J. Retrotranspositions in orthologous regions of closely related grass species. BMC Evol. Biol. 2006, 6, 62. [Google Scholar] [CrossRef] [Scilit]
- Kalendar, R.; Flavell, A.J.; Ellis, T.H.N.; Sjakste, T.; Moisy, C.; Schulman, A.H. Analysis of plant diversity with retrotransposon-based molecular markers. Heredity 2011, 106, 520–530. [Google Scholar] [CrossRef] [Scilit]
- Kalendar, R.; Grob, T.; Regina, M.; Suoniemi, A.; Schulman, A. IRAP and REMAP: Two new retrotransposon-based DNA fingerprinting techniques. Theor. Appl. Genet. 1999, 98, 704–711. [Google Scholar] [CrossRef] [Scilit]
- Jing, H.; Esfandani-Bozchaloyi, S. Genetic diversity and gene-pool of Medicago polymorpha L. based on retrotransposon-based markers. Caryologia 2022, 75, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Koroluk, A.; Paczos-Grzęda, E.; Sowa, S.; Boczkowska, M.; Toporowska, J. Diversity of Polish Oat Cultivars with a Glance at Breeding History and Perspectives. Agronomy 2022, 12, 2423. [Google Scholar] [CrossRef] [Scilit]
- Dongare, M.D.; Alex, S.; Soni, K.B.; Sindura, K.P.; Nair, D.S.; Stephen, R.; Jose, E. Cross-species transferability of IRAP retrotransposon markers and polymorphism in black pepper (Piper nigrum L.). Genet. Resour. Crop Evol. 2023, 70, 2593–2605. [Google Scholar] [CrossRef] [Scilit]
- Razi, M.; Amiri, M.E.; Darvishzadeh, R.; Doulati Baneh, H.; Alipour, H.; Martínez-Gómez, P. Assessment of genetic diversity of cultivated and wild Iranian grape germplasm using retrotransposon-microsatellite amplified polymorphism (REMAP) markers and pomological traits. Mol. Biol. Rep. 2020, 47, 7593–7606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Villano, C.; Corrado, G.; Basile, B.; Di Serio, E.; Mataffo, A.; Ferrara, E.; Aversano, R. Morphological and Genetic Clonal Diversity within the ‘Greco Bianco’ Grapevine (Vitis vinifera L.) Variety. Plants 2023, 12, 515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minaei, S.; Mohammadi, S.A.; Sabouri, A.; Dadras, A.R. High genetic diversity in Aegilops tauschii Coss. accessions from North Iran as revealed by IRAP and REMAP markers. J. Genet. Eng. Biotechnol. 2022, 20, 86. [Google Scholar] [CrossRef] [Scilit]
- Holasou, H.A.; Rahmati, F.; Rahmani, F.; Imani, M.; Talebzadeh, Z. Elucidate Genetic Diversity and Population Structure of Bread Wheat (Triticum aestivum L.) Cultivars Using IRAP and REMAP Markers. J. Crop Sci. Biotechnol. 2019, 22, 139–151. [Google Scholar] [CrossRef] [Scilit]
- Valadez-Moctezuma, E.; Arroyo-Álvarez, E.; Samah, S. Activation of transposable elements and insertional polymorphism in Opuntia offspring as assessed by inter-retrotransposon amplified polymorphism markers. Plant Biosyst.-Int. J. Deal. All Asp. Plant Biol. 2018, 153, 450–460. [Google Scholar] [CrossRef] [Scilit]
- Rashid, K.; Othman, R.Y.; Ali, B.S.B.K.S.; Yusof, Y.M.; Nezhadahmadi, A. The Aplication of IRAP Markers in the Breeding of Papaya (Carica papaya L.). Indian J. Sci. Technol. 2014, 7, 1720–1728. [Google Scholar] [CrossRef] [Scilit]
- Shingote, P.R.; Amitha Mithra, S.V.; Sharma, P.; Devanna, N.B.; Arora, K.; Holkar, S.K.; Khan, S.; Singh, J.; Kumar, S.; Sharma, T.R.; et al. LTR retrotransposons and highly informative ISSRs in combination are potential markers for genetic fidelity testing of tissue culture-raised plants in sugarcane. Mol. Breed. 2019, 39, 25. [Google Scholar] [CrossRef] [Scilit]
- Mirani, A.A.; Teo, C.H.; Markhand, G.S.; Abul-Soad, A.A.; Harikrishna, J.A. Detection of somaclonal variations in tissue cultured date palm (Phoenix dactylifera L.) using transposable element-based markers. Plant Cell Tissue Organ Cult. 2000, 141, 119–130. [Google Scholar] [CrossRef] [Scilit]
- Nasri, F.; Zakizadeh, H.; Vafaee, Y.; Mozafari, A.A. In vitro mutagenesis of Chrysanthemum morifolium cultivars using ethylmethanesulphonate (EMS) and mutation assessment by ISSR and IRAP markers. Plant Cell Tissue Organ Cult. 2022, 149, 657–673. [Google Scholar] [CrossRef] [Scilit]
- Muhammad, A.J.; Othman, F.Y. Characterization of fusarium wilt-resistant and fusarium wilt-susceptible somaclones of banana cultivar rastali (Musa AAB) by random amplified polymorphic DNA and retrotransposon markers. Plant Mol. Biol. Rep. 2005, 23, 241–249. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, C.F.; Gutierrez, D.L.; Kreuze, J.F.; Iskra-Caruana, M.L.; Chabannes, M.; Barbosa, A.C.O.; Santos, T.A.; Silva, A.G.S.; Santos, R.M.F.; Amorim, E.P.; et al. Rapid plant DNA and RNA extraction protocol using a bench drill. Genet. Mol. Res. 2019, 18, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Baumel, A.; Ainouche, M.; Kalendar, R.; Schulman, A.H. Retrotransposons and genomic stability in populations of the young allopolyploide species Spartina anglica C.E. Hubbard (Poaceae). Mol. Biol. Evol. 2002, 19, 1218–1227. [Google Scholar] [CrossRef] [Scilit]
- Shepherd, K. Banana Breeding—Past and Present. Acta Hortic. 1987, 196, 37–44. [Google Scholar] [CrossRef] [Scilit]
- Amorim, E.P.; Amorim, V.B.O.; Silva, S.O.; Pillay, M. Quality improvement of cultivated Musa. In Banana Breeding: Progress and Challenges; Michael Pillay, A.T., Ed.; CRC Press: New York, NY, USA, 2011; pp. 252–280. ISBN 978-1-4398-0018-8. [Google Scholar] [CrossRef] [Scilit]
- Saraswathi, M.S.; Uma, S.; Prasanya Selvam, K.; Ramaraj, S.; Durai, P.; Mustaffa, M.M. Assessing the robustness of IRAP and RAPD marker systems to study intra-group diversity among Cavendish (AAA) clones of banana. J. Hortic. Sci. Biotechnol. 2011, 86, 7–12. [Google Scholar] [CrossRef] [Scilit]
- Shelke, R.G.; Das, A.B. Analysis of genetic diversity in 21 genotypes of indian banana using RAPDs and IRAPs markers. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2015, 85, 1027–1038. [Google Scholar] [CrossRef] [Scilit]
- Hou, B.H.; Tsai, Y.H.; Chiang, M.H.; Tsao, S.M.; Huang, S.H.; Chao, C.P.; Chen, H.M. Cultivar-specific markers, mutations, and chimerisim of Cavendish banana somaclonal variants resistant to Fusarium oxysporum f. sp. cubense tropical race 4. BMC Genom. 2022, 23, 470. [Google Scholar] [CrossRef] [Scilit]
- Kao, Y.L.; Deavours, B.E.; Phelps, K.K.; Walker, R.A.; Reddy, A.S.N. Bundling of microtubules by motor and tail domains of a kinesin-like calmodulin-binding protein from Arabidopsis: Regulation by Ca2+/calmodulin. Biochem. Biophys. Res. Commun. 2000, 267, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Reddy, V.S.; Day, I.S.; Thomas, T.; Reddy, A.S.N. KIC, a novel Ca2+ binding protein with one EF-hand Motif, interacts with a microtubule motor protein and regulates trichome morphogenesis. Plant Cell 2004, 16, 185–200. [Google Scholar] [CrossRef] [Scilit]
- Konzack, S.; Rischitor, P.E.; Enke, C.; Fischer, R. The role of the kinesin motor KipA in microtubule organization and polarized growth of Aspergillus nidulans. Mol. Biol. Cell 2005, 16, 497–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lecourieux, D.; Ranjeva, R.; Pugin, A. Calcium in plant defence-signalling pathways. New Phytol. 2006, 171, 249–269. [Google Scholar] [CrossRef] [Scilit]
- Lu, L.; Rong, W.; Zhou, R.; Huo, N.; Zhang, Z. TaCML36, a wheat calmodulin-like protein, positively participates in an immune response to Rhizoctonia cerealis. Crop J. 2019, 7, 608–618. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, J.A.; Albuquerque, A.; Materatski, P.; Patanita, M.; Varanda, C.M.R.; Félix, M.d.R.; Campos, M.D. Tomato response to Fusarium spp. Infection under field conditions: Study of potential genes involved. Horticulturae 2022, 8, 433. [Google Scholar] [CrossRef] [Scilit]
- Postel, S.; Kemmerling, B. Plant systems for recognition of pathogen-associated molecular patterns. Semin. Cell Dev. Biol. 2009, 20, 1025–1031. [Google Scholar] [CrossRef] [Scilit]
- Meng, H.; Sun, M.; Jiang, Z.; Liu, Y.; Sun, Y.; Liu, D.; Jiang, C.; Ren, M.; Yuan, G.; Yu, W.; et al. Comparative transcriptome analysis reveals resistant and susceptible genes in tobacco cultivars in response to infection by Phytophthora nicotianae. Sci Rep. 2021, 11, 809. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Sui, Y.; Yu, C.; Wang, X.; Zhang, W.; Wang, B.; Yan, J.; Duan, L. Coronatine-Induced Maize Defense against Gibberella Stalk Rot by Activating Antioxidants and Phytohormone Signaling. J. Fungi 2023, 9, 1155. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Ramakrishnan, M.; Vinod, K.K.; Kalendar, R.; Yrjälä, K.; Zhou, M. Development and deployment of high-throughput retrotransposon-based markers reveal genetic diversity and population structure of asian bamboo. Forests 2020, 11, 31. [Google Scholar] [CrossRef] [Scilit]
- Gong, X.; Xu, Y.; Li, H.; Chen, X.; Song, Z. Antioxidant activation, cell wall reinforcement, and reactive oxygen species regulation promote resistance to waterlogging stress in hot pepper (Capsicum annuum L.). BMC Plant Biol. 2022, 22, 425. [Google Scholar] [CrossRef] [Scilit]
- An, M.; Zhou, T.; Guo, Y.; Zhao, X.; Wu, Y. Molecular regulation of host defense responses mediated by biological anti-TMV agent ningnanmycin. Viruses 2019, 11, 815. [Google Scholar] [CrossRef] [Scilit]
- Bao, Y.; Chen, C.; Fu, L.; Chen, Y. Comparative transcriptome analysis of Rosa chinensis ‘Old Blush’ provides insights into the crucial factors and signaling pathways in salt stress response. Agronomy 2021, 113, 3031–3050. [Google Scholar] [CrossRef] [Scilit]
- Zeng, H.; Xu, L.; Singh, A.; Wang, H.; Du, L.; Poovaiah, B.W. Involvement of calmodulin and calmodulin-like proteins in plant responses to abiotic stresses. Front. Plant Sci. 2015, 6, 600. [Google Scholar] [CrossRef] [Scilit] [PubMed]


| Treatment | Origin Research Center | Degree of Resistance | |
|---|---|---|---|
| C | Control (‘Grande Naine’) | Embrapa Mandioca e Fruticultura | MR |
| 1 | Embrapa 14—T1B2P2 | Embrapa Mandioca e Fruticultura | HR |
| 2 | Embrapa 14—T1B2P3 | Embrapa Mandioca e Fruticultura | HR |
| 3 | Embrapa 14—T1B2P6 | Embrapa Mandioca e Fruticultura | HR |
| 4 | Embrapa 15—T2B1P1 | Embrapa Mandioca e Fruticultura | HR |
| 5 | Embrapa 15—T2B1P5 | Embrapa Mandioca e Fruticultura | HR |
| 6 | Embrapa 15—T2B1P7 | Embrapa Mandioca e Fruticultura | HR |
| 7 | Embrapa 16—T3B2P4 | Embrapa Mandioca e Fruticultura | HR |
| 8 | Embrapa 16—T3B2P6 | Embrapa Mandioca e Fruticultura | HR |
| 9 | Embrapa 16—T3B2P8 | Embrapa Mandioca e Fruticultura | HR |
| 10 | Embrapa 17—T4B1P2 | Embrapa Mandioca e Fruticultura | R |
| 11 | Embrapa 17—T4B1P4 | Embrapa Mandioca e Fruticultura | R |
| 12 | Embrapa 17—T4B1P6 | Embrapa Mandioca e Fruticultura | R |
| Primers | Family | Sequence (5′-3′) | Reference |
|---|---|---|---|
| 5′LTR2 ← | Bare 1 | 5′-ATCATTGCCTCTAGGGCATAATTC-3′ | [26] |
| 3′LTR → | Bare 1 | 5′-TGTTTCCCATGCGACGTTCCCCAACA-3′ | [26] |
| Sukkula | Sukkula | 5′-GATAGGGTCGCATCTTGGGCGTGAC-3′ | [26] |
| Nikita → | Nikita | 5′-CGCATTTGTTCAAGCCTAAACC-3′ | [26] |
| LTR6149 → | Bare 1 | 5′-CTCGCTCGCCCACTACATCAACCGCGTTTATT-3′ | [26] |
| LTR6150 ← | Bare 1 | 5′-CTGGTTCGGCCCATGTCTATGTATCCACACATGTA-3′ | [26] |
| C0795 | Bare 1 | 5′-TCCCATGCGACGTTCCCC-3′ | [46] |
| C0945 | Sabrina | 5′-GCAAGCTTCCG TTCCGC-3′ | [46] |
| Primers | Sequence (5′-3′) | Reference |
|---|---|---|
| SSR | [31] | |
| 8081 → | (GA)9C | [31] |
| 8082 → | (CT)9G | [31] |
| 8385 → | (CAC)7G | [31] |
| 8386 → | (GTG)7C | [31] |
| 8387 → | (CA)10G | [31] |
| 8564 → | (CAC)T7 | [31] |
| 8565 → | GT(CAC)7 | [31] |
| LTR | ||
| LTR7286 ← | GGAATTCATAGGATGGATAATAAACGATTATC | [31] |
| Name | Seqassem | Size (bp) | BLAST: ID | Function |
|---|---|---|---|---|
|
1AF Primer forward: LTR6149 (T1B2P6) 1AR Primer reverse: Nikita | >CTGCAAACACGACCTCCCTCTCGATCGCCTTCTCCAGCCACGCCTCGGCGTCCGCCATCATCTCCGGGCTCAGCCTCACCATCAGCACGCAGAACTCCTTCTCGTCGAGCGCCCCGTCCCCGTCCATGTCCCCTTCCCTCACCATCGCCGCCGCATCCTCCGCCGTCATCCCCGCCATCCCCAGCGCCGCCGCGTTCCTCCTCAGGCTCTCCGGCGTTATGACCCCCCTCCCGGGCTCCGCCAGCAACCGGAAGCCCCCGCaCAGCTCCGACACGAACTGCTCCGCTTCCAGCCTCTCGGCCATCACCGGCACCAAGTCCTCGTACTCCTCCGACTCCGTCGCAGCTGCGTGCTTCTCTTCCTCCATCGCCAGACCTTCCAAGTCTCTGTTGATGCTGCARARATGGTTTAGGCTTG | Approximately 400 | Musa acuminata subsp. malaccensis isolate AA chromosome 15 Sequence ID: XM_065104944 | calcium-binding protein KIC-like |
|
2AF Primer forward: 3′LTR (T1B2P2) 2AR Primer reverse: Nikita | >GGTGTTAACTATTACTATATAGTAAATAGGGCTCTCGAACAACACTTGAGGAATCACTCACTCCTACTTAGCTACTATCTGAACTCACTCCTACAGTTGCTCACAAGAACCGGAGCAGTCAAACTAGGGACAAGAACAAGAAAAGGACTACTATCTTCTTGCCAACCCTTAATACAGGACTTGTAATAACTCTGGAACCTCTCTCTCCACTACTTGGGAAAGCCAATATTAGATGAGATGAGCCTCATTCCGCAAGTAAGAATGAAGTTAGGGTACTAGAATTAGCAGTGCCCCCGGGCATCTAGAATTAGCAGTGCTAGTTATAAAGTAAGG | Approximately 300 | Musa acuminata subsp. malaccensis strain Doubled-haploi. Score: 544 Evalue: 8.3 × 10−150 Accession:HG996478.1 | |
|
3AF Primer forward: Sukkula (T1B2P2) 3AR Primer reverse: LTR6150 | >ACCAGTAGCAGCCCATTCAGACCCAGATTTCTTGGCCGGCGGTGGCATTGCCCAGGAGCTCAGGAAAGCTAGGCAGTGCAATAGCCCGGGTCAGGGGGTGGTACCACCTGGGCTTAGTCTCCGAGCAAGACTGGGCAGTGGTACCACTTGGGCTAAATCTCTGAGCGAGACTGGGCAGTGGTACCGCCCCTATCAGGCAGTGGTACTGCCTGAGCTCGGTCTCCGAGAGGTAGTACTGCCCAGTTATATTGGTAGTACCGCCAGGACCTCGGAAATCTAGGAGATGACACATTTGAGCTCCAAATTCAAATCAGTTGGGGGCTATATGTAATATCCCTCACTTTTAAAAATTTATTAATAAGGATTTATATGTAAATTGGAGGACCTATATGTAAATATAGAAATTTTAAGGATTAAACTGTTAAGTTGCAAAAAGAAAAAAAAATTAAAGAAAACCGAAGAGGGAAAAGAAGAAAGAAAGAAGAGGGAGAAGAGAAGAAAAGAAGAAGAAGAAGAGAGGGAAGAGGGAGCGGGATGAGAAAGATAGCTGCAGTAGATAGGGCTGCAGCGCCTCTGTTTCGTGTAGGAGGAAACARAGGAGTACATGTGTGGATACATASACATGGGCSGAACCASACAAA | Approximately 600 | Musa acuminata subsp. malaccensis isolate AA chromosome 14 GenBank: CP126383.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sampaio, J.R.; Oliveira, W.D.d.S.; Nascimento, F.d.S.; Junior, L.C.d.S.; Rebouças, T.A.; Moreira, R.F.C.; Ramos, A.P.d.S.; Santos-Serejo, J.A.d.; Amorim, E.P.; Ferreira, C.F. Calcium-Binding Protein and Polymorphism in Musa spp. Somaclones Resistant to Fusarium oxysporum. Curr. Issues Mol. Biol. 2024, 46, 12119-12132. https://doi.org/10.3390/cimb46110719
Sampaio JR, Oliveira WDdS, Nascimento FdS, Junior LCdS, Rebouças TA, Moreira RFC, Ramos APdS, Santos-Serejo JAd, Amorim EP, Ferreira CF. Calcium-Binding Protein and Polymorphism in Musa spp. Somaclones Resistant to Fusarium oxysporum. Current Issues in Molecular Biology. 2024; 46(11):12119-12132. https://doi.org/10.3390/cimb46110719
Chicago/Turabian StyleSampaio, Juliana Rodrigues, Wanderley Diaciso dos Santos Oliveira, Fernanda dos Santos Nascimento, Luiz Carlos de Souza Junior, Tamyres Amorim Rebouças, Ricardo Franco Cunha Moreira, Andresa Priscila de Souza Ramos, Janay Almeida dos Santos-Serejo, Edson Perito Amorim, and Claudia Fortes Ferreira. 2024. "Calcium-Binding Protein and Polymorphism in Musa spp. Somaclones Resistant to Fusarium oxysporum" Current Issues in Molecular Biology 46, no. 11: 12119-12132. https://doi.org/10.3390/cimb46110719
APA StyleSampaio, J. R., Oliveira, W. D. d. S., Nascimento, F. d. S., Junior, L. C. d. S., Rebouças, T. A., Moreira, R. F. C., Ramos, A. P. d. S., Santos-Serejo, J. A. d., Amorim, E. P., & Ferreira, C. F. (2024). Calcium-Binding Protein and Polymorphism in Musa spp. Somaclones Resistant to Fusarium oxysporum. Current Issues in Molecular Biology, 46(11), 12119-12132. https://doi.org/10.3390/cimb46110719

