Odontogenic Differentiation-Induced Tooth Regeneration by Psoralea corylifolia L.
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Herbal Extraction
2.3. Chemicals and Reagents
2.4. Cell Culture
2.5. Cell Proliferation Assay
2.6. Odontogenic Differentiation
2.7. Real-Time Polymerase Chain Reaction Analysis
2.8. Statistical Analysis
3. Results
3.1. Effect of P. corylifolia Extracts on Cell Viability and Odontogenic Differentiation in hDPSCs
3.2. Effect of Bakuchiol on Cell Viability and Odontogenic Differentiation in hDPSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
P. corylifolia | Psoralea Corylifolia Linn |
hDPSCs | human dental pulp stem cells |
GSK-3β | glycogen synthase kinase 3 beta |
MSCs | Mesenchymal stem cells |
HLA | human leukocyte antigen |
DMSO | Dimethyl sulfoxide |
CCK-8 | Cell counting kit-8 |
ARS | Alizarin Red S |
CPC | Cetylpyridinium chloride |
PCR | polymerase chain reactin |
SEM | standard error of the mean |
SMAD | small mothers against decapentaplegia |
References
- Neves, V.C.; Babb, R.; Chandrasekaran, D.; Sharpe, P.T. Promotion of natural tooth repair by small molecule GSK3 antagonists. Sci. Rep. 2017, 7, 39654. [Google Scholar] [CrossRef] [PubMed]
- Tapia, N.; Arauzo-Bravo, M.J.; Ko, K.; Scholer, H.R. Concise review: Challenging the pluripotency of human testis-derived ESC-like cells. Stem Cells 2011, 29, 1165–1169. [Google Scholar] [CrossRef] [PubMed]
- Blinka, S.; Rao, S. Nanog Expression in Embryonic Stem Cells—An Ideal Model System to Dissect Enhancer Function. Bioessays 2017, 39, 1700086. [Google Scholar] [CrossRef] [PubMed]
- Costa, M.; Sourris, K.; Lim, S.M.; Yu, Q.C.; Hirst, C.E.; Parkington, H.C.; Jokubaitis, V.J.; Dear, A.E.; Liu, H.B.; Micallef, S.J.; et al. Derivation of endothelial cells from human embryonic stem cells in fully defined medium enables identification of lysophosphatidic acid and platelet activating factor as regulators of eNOS localization. Stem Cell Res. 2013, 10, 103–117. [Google Scholar] [CrossRef]
- Furukawa, J.I.; Okada, K.; Shinohara, Y. Glycomics of human embryonic stem cells and human induced pluripotent stem cells. Glycoconj. J. 2017, 34, 807–815. [Google Scholar] [CrossRef]
- Liu, C.; Peng, G.; Jing, N. TGF-beta signaling pathway in early mouse development and embryonic stem cells. Acta Biochim. Biophys. Sin. 2018, 50, 68–73. [Google Scholar] [CrossRef]
- Papatsenko, D.; Waghray, A.; Lemischka, I.R. Feedback control of pluripotency in embryonic stem cells: Signaling, transcription and epigenetics. Stem Cell Res. 2018, 29, 180–188. [Google Scholar] [CrossRef]
- Tang, N.; Zhao, Y.; Feng, R.; Liu, Y.; Wang, S.; Wei, W.; Ding, Q.; An, M.S.; Wen, J.; Li, L. Lysophosphatidic acid accelerates lung fibrosis by inducing differentiation of mesenchymal stem cells into myofibroblasts. J. Cell. Mol. Med. 2014, 18, 156–169. [Google Scholar] [CrossRef]
- Patel, J.; Shafiee, A.; Wang, W.; Fisk, N.M.; Khosrotehrani, K. Novel isolation strategy to deliver pure fetal-origin and maternal-origin mesenchymal stem cell (MSC) populations from human term placenta. Placenta 2014, 35, 969–971. [Google Scholar] [CrossRef]
- Pisciotta, A.; Carnevale, G.; Meloni, S.; Riccio, M.; De Biasi, S.; Gibellini, L.; Ferrari, A.; Bruzzesi, G.; De Pol, A. Human dental pulp stem cells (hDPSCs): Isolation, enrichment and comparative differentiation of two sub-populations. BMC Dev. Biol. 2015, 15, 14. [Google Scholar] [CrossRef]
- Phung, S.; Lee, C.; Hong, C.; Song, M.; Yi, J.K.; Stevenson, R.G.; Kang, M.K.; Shin, K.H.; Park, N.H.; Kim, R.H. Effects of Bioactive Compounds on Odontogenic Differentiation and Mineralization. J. Dent. Res. 2017, 96, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Raoof, M.; Yaghoobi, M.M.; Derakhshani, A.; Kamal-Abadi, A.M.; Ebrahimi, B.; Abbasnejad, M.; Shokouhinejad, N. A modified efficient method for dental pulp stem cell isolation. Dent. Res. J. 2014, 11, 244–250. [Google Scholar]
- Rink, B.E.; Kuhl, J.; Esteves, C.L.; French, H.M.; Watson, E.; Aurich, C.; Donadeu, F.X. Reproductive stage and sex steroid hormone levels influence the expression of mesenchymal stromal cell (MSC) markers in the equine endometrium. Theriogenology 2018, 116, 34–40. [Google Scholar] [CrossRef] [PubMed]
- L Ramos, T.; Sanchez-Abarca, L.I.; Muntion, S.; Preciado, S.; Puig, N.; Lopez-Ruano, G.; Hernandez-Hernandez, A.; Redondo, A.; Ortega, R.; Rodriguez, C.; et al. MSC surface markers (CD44, CD73, and CD90) can identify human MSC-derived extracellular vesicles by conventional flow cytometry. Cell Commun. Signal. 2016, 14, 2. [Google Scholar] [CrossRef] [PubMed]
- Abu Tahir, M.; Pramod, K.; Ansari, S.H.; Ali, J. Current remedies for vitiligo. Autoimmun. Rev. 2010, 9, 516–520. [Google Scholar] [CrossRef]
- Chopra, B.; Dhingra, A.K.; Dhar, K.L. Psoralea corylifolia L. (Buguchi)—Folklore to modern evidence: Review. Fitoterapia 2013, 90, 44–56. [Google Scholar] [CrossRef]
- Badri, L.; Lama, V.N. Lysophosphatidic acid induces migration of human lung-resident mesenchymal stem cells through the beta-catenin pathway. Stem Cells 2012, 30, 2010–2019. [Google Scholar] [CrossRef]
- Chen, J.; Baydoun, A.R.; Xu, R.; Deng, L.; Liu, X.; Zhu, W.; Shi, L.; Cong, X.; Hu, S.; Chen, X. Lysophosphatidic acid protects mesenchymal stem cells against hypoxia and serum deprivation-induced apoptosis. Stem Cells 2008, 26, 135–145. [Google Scholar] [CrossRef]
- Liu, X.; Hou, J.; Shi, L.; Chen, J.; Sang, J.; Hu, S.; Cong, X.; Chen, X. Lysophosphatidic acid protects mesenchymal stem cells against ischemia-induced apoptosis in vivo. Stem Cells Dev. 2009, 18, 947–954. [Google Scholar] [CrossRef]
- Wang, X.Y.; Fan, X.S.; Cai, L.; Liu, S.; Cong, X.F.; Chen, X. Lysophosphatidic acid rescues bone mesenchymal stem cells from hydrogen peroxide-induced apoptosis. Apoptosis 2015, 20, 273–284. [Google Scholar] [CrossRef]
- Shuyu, E.; Lai, Y.J.; Tsukahara, R.; Chen, C.S.; Fujiwara, Y.; Yue, J.; Yu, J.H.; Guo, H.; Kihara, A.; Tigyi, G.; et al. Lysophosphatidic acid 2 receptor-mediated supramolecular complex formation regulates its antiapoptotic effect. J. Biol. Chem. 2009, 284, 14558–14571. [Google Scholar] [CrossRef]
- Huang, Y.; Liao, L.; Su, H.; Chen, X.; Jiang, T.; Liu, J.; Hou, Q. Psoralen accelerates osteogenic differentiation of human bone marrow mesenchymal stem cells by activating the TGF-beta/Smad3 pathway. Exp. Ther. Med. 2021, 22, 940. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.J.; Li, C.R.; Wang, L.Y.; Ziadlou, R.; Grad, S.; Zhang, Y.; Cheng, Y.; Lai, Y.X.; Yao, X.S.; Alini, M.; et al. Effect and mechanism of psoralidin on promoting osteogenesis and inhibiting adipogenesis. Phytomedicine 2019, 61, 152860. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.J.; Abulizi, A.; Zhao, G.L.; Wang, T.; Zhou, F.; Jiang, Z.Z.; Aibai, S.; Zhang, L.Y. Bakuchiol Contributes to the Hepatotoxicity of Psoralea corylifolia in Rats. Phytother. Res. 2017, 31, 1265–1272. [Google Scholar] [CrossRef]
- Chaudhuri, R.K.; Marchio, F. Bakuchiol in the management of acne-affected skin. Cosmet. Toilet. 2011, 126, 502. [Google Scholar]
- Chai, L.; Zhou, K.; Wang, S.; Zhang, H.; Fan, N.; Li, J.; Tan, X.; Hu, L.; Fan, X. Psoralen and Bakuchiol Ameliorate M-CSF Plus RANKL-Induced Osteoclast Differentiation and Bone Resorption Via Inhibition of AKT and AP-1 Pathways in Vitro. Cell. Physiol. Biochem. 2018, 48, 2123–2133. [Google Scholar] [CrossRef]
- Lee, S.J.; Yoo, M.; Go, G.Y.; Kim, D.H.; Choi, H.; Leem, Y.E.; Kim, Y.K.; Seo, D.W.; Ryu, J.H.; Kang, J.S.; et al. Bakuchiol augments MyoD activation leading to enhanced myoblast differentiation. Chem. Biol. Interact. 2016, 248, 60–67. [Google Scholar] [CrossRef]
- Weng, Z.B.; Gao, Q.Q.; Wang, F.; Zhao, G.H.; Yin, F.Z.; Cai, B.C.; Chen, Z.P.; Li, W.D. Positive skeletal effect of two ingredients of Psoralea corylifolia L. on estrogen deficiency-induced osteoporosis and the possible mechanisms of action. Mol. Cell. Endocrinol. 2015, 417, 103–113. [Google Scholar] [CrossRef]
- Assael, L.A. Oral bisphosphonates as a cause of bisphosphonate-related osteonecrosis of the jaws: Clinical findings, assessment of risks, and preventive strategies. J. Oral Maxillofac. Surg. 2009, 67, 35–43. [Google Scholar] [CrossRef]
- Feng, J.; Jing, J.; Li, J.; Zhao, H.; Punj, V.; Zhang, T.; Xu, J.; Chai, Y. BMP signaling orchestrates a transcriptional network to control the fate of mesenchymal stem cells in mice. Development 2017, 144, 2560–2569. [Google Scholar] [CrossRef]
- Liu, Z.; Lin, Y.; Fang, X.; Yang, J.; Chen, Z. Epigallocatechin-3-Gallate Promotes Osteo-/Odontogenic Differentiation of Stem Cells from the Apical Papilla through Activating the BMP-Smad Signaling Pathway. Molecules 2021, 26, 1580. [Google Scholar] [CrossRef] [PubMed]
- Malik, Z.; Alexiou, M.; Hallgrimsson, B.; Economides, A.N.; Luder, H.U.; Graf, D. Bone Morphogenetic Protein 2 Coordinates Early Tooth Mineralization. J. Dent. Res. 2018, 97, 835–843. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.; Choi, S.I.; Hong, E.; Kim, G.H. Psoralea corylifolia L. extract ameliorates nonalcoholic fatty liver disease in free-fatty-acid-incubated HEPG2 cells and in high-fat diet-fed mice. J. Food Sci. 2020, 85, 2216–2226. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.M.; Xie, C.J.; Wang, D.; Wei, Y.M.; Cai, J.; Cheng, S.S.; Yang, X.; Sui, A. Psc-AFP from Psoralea corylifolia L. overexpressed in Pichia pastoris increases antimicrobial activity and enhances disease resistance of transgenic tobacco. Appl. Microbiol. Biotechnol. 2017, 101, 1073–1084. [Google Scholar] [CrossRef] [PubMed]
- Yin, Z.; Zhang, W.; Zhang, J.; Liu, H.; Guo, Q.; Chen, L.; Wang, J.; Kang, W. Two Novel Polysaccharides in Psoralea corylifolia L. and anti-A549 Lung Cancer Cells Activity In Vitro. Molecules 2019, 24, 3733. [Google Scholar] [CrossRef] [PubMed]
- Szliszka, E.; Czuba, Z.P.; Sedek, L.; Paradysz, A.; Krol, W. Enhanced TRAIL-mediated apoptosis in prostate cancer cells by the bioactive compounds neobavaisoflavone and psoralidin isolated from Psoralea corylifolia. Pharmacol. Rep. 2011, 63, 139–148. [Google Scholar] [CrossRef]
- Lin, C.H.; Funayama, S.; Peng, S.F.; Kuo, C.L.; Chung, J.G. The ethanol extraction of prepared Psoralea corylifolia induces apoptosis and autophagy and alteres genes expression assayed by cDNA microarray in human prostate cancer PC-3 cells. Environ. Toxicol. 2018, 33, 770–788. [Google Scholar] [CrossRef]
- Li, Y.; Qin, X.; Li, P.; Zhang, H.; Lin, T.; Miao, Z.; Ma, S. Isobavachalcone isolated from Psoralea corylifolia inhibits cell proliferation and induces apoptosis via inhibiting the AKT/GSK-3beta/beta-catenin pathway in colorectal cancer cells. Drug Des. Dev. Ther. 2019, 13, 1449–1460. [Google Scholar] [CrossRef]
- Cai, X.Y.; Zhang, Z.J.; Xiong, J.L.; Yang, M.; Wang, Z.T. Experimental and molecular docking studies of estrogen-like and anti-osteoporosis activity of compounds in Fructus Psoraleae. J. Ethnopharmacol. 2021, 276, 114044. [Google Scholar] [CrossRef]
- Katsura, H.; Tsukiyama, R.I.; Suzuki, A.; Kobayashi, M. In vitro antimicrobial activities of bakuchiol against oral microorganisms. Antimicrob. Agents Chemother. 2001, 45, 3009–3013. [Google Scholar] [CrossRef]
- Li, W.D.; Yan, C.P.; Wu, Y.; Weng, Z.B.; Yin, F.Z.; Yang, G.M.; Cai, B.C.; Chen, Z.P. Osteoblasts proliferation and differentiation stimulating activities of the main components of Fructus Psoraleae corylifoliae. Phytomedicine 2014, 21, 400–405. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.H.; Ha, T.Y.; Ahn, J.; Kim, S. Estrogenic activities of Psoralea corylifolia L. seed extracts and main constituents. Phytomedicine 2011, 18, 425–430. [Google Scholar] [CrossRef] [PubMed]
- Ge, L.; Cheng, K.; Han, J. A Network Pharmacology Approach for Uncovering the Osteogenic Mechanisms of Psoralea corylifolia Linn. Evid. Based Complement. Alternat. Med. 2019, 2019, 2160175. [Google Scholar] [CrossRef] [PubMed]
- Cho, M.-J. The relationship between dementia and the number of remaining tooth of the elderly women on senior center. J. Digit. Converg. 2016, 14, 279–286. [Google Scholar] [CrossRef][Green Version]
- Choi, S.-S.; So, M.-S. Dental Caries of Factors the Oral Health Behaviors and Dental Health Services Utilization in the Middle-School Student’s-focusing on middle school student’s in Daegu. J. Korean Soc. Sch. Community Health Educ. 2011, 12, 35–44. [Google Scholar]
- Couble, M.-L.; Farges, J.-C.; Bleicher, F.; Perrat-Mabillon, B.; Boudeulle, M.; Magloire, H. Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif. Tissue Int. 2000, 66, 129–138. [Google Scholar] [CrossRef]
Name | Sequences (5′ → 3′) | |
---|---|---|
ALP | F | GACCTCCTCGGAAGACACTC |
R | TGAAGGGCTTCTTGTCTGTG | |
RUNX-2 | F | GGTTAATCTCCGCAGGTCACT |
R | CACTGTGCTGAAGAGGCTGTT | |
OC | F | GCAGCGAGGTAGTGAAGAGAC |
R | AGCAGAGCGACACCCTAGA | |
DMP-1 | F | CAAGACAGTGCCCAAGATAC |
R | TTCCCTCATCGTCCAACT | |
β-actin | F | GGCACCCAGCACAATGAAG |
R | TGCGGTGGACGATGGAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, H.-O.; Ahn, T.-Y.; Ju, J.-M.; Bae, S.-K.; Kim, H.-R.; Kim, D.-S. Odontogenic Differentiation-Induced Tooth Regeneration by Psoralea corylifolia L. Curr. Issues Mol. Biol. 2022, 44, 2300-2308. https://doi.org/10.3390/cimb44050156
Jang H-O, Ahn T-Y, Ju J-M, Bae S-K, Kim H-R, Kim D-S. Odontogenic Differentiation-Induced Tooth Regeneration by Psoralea corylifolia L. Current Issues in Molecular Biology. 2022; 44(5):2300-2308. https://doi.org/10.3390/cimb44050156
Chicago/Turabian StyleJang, Hye-Ock, Tea-Young Ahn, Ji-Min Ju, Soo-Kyung Bae, Hyung-Ryong Kim, and Da-Sol Kim. 2022. "Odontogenic Differentiation-Induced Tooth Regeneration by Psoralea corylifolia L." Current Issues in Molecular Biology 44, no. 5: 2300-2308. https://doi.org/10.3390/cimb44050156
APA StyleJang, H.-O., Ahn, T.-Y., Ju, J.-M., Bae, S.-K., Kim, H.-R., & Kim, D.-S. (2022). Odontogenic Differentiation-Induced Tooth Regeneration by Psoralea corylifolia L. Current Issues in Molecular Biology, 44(5), 2300-2308. https://doi.org/10.3390/cimb44050156