Next Article in Journal
Tumor Molecular and Microenvironment Characteristics in EBV-Associated Malignancies as Potential Therapeutic Targets: Focus on Gastric Cancer
Next Article in Special Issue
Evaluation of Antidiabetic, Antioxidant and Anti-Hyperlipidemic Effects of Solanum indicum Fruit Extract in Streptozotocin-Induced Diabetic Rats
Previous Article in Journal
Oral Administration of Myelin Oligodendrocyte Glycoprotein Attenuates Experimental Autoimmune Encephalomyelitis through Induction of Th2/Treg Cells and Suppression of Th1/Th17 Immune Responses
Previous Article in Special Issue
Nutraceutical Prevention of Diabetic Complications—Focus on Dicarbonyl and Oxidative Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Essential Oil of Carvone Chemotype Lippia alba (Verbenaceae) Regulates Lipid Mobilization and Adipogenesis in Adipocytes

by
Katherin Bonilla-Carvajal
1,
Elena E. Stashenko
2 and
Natalia Moreno-Castellanos
3,*
1
Department of Basic Sciences, Health Faculty, Universidad Industrial de Santander, Bucaramanga 680002, Colombia
2
Centro Nacional de Investigaciones para la Agroindustrialización de Especies Vegetales Aromáticas y Medicinales Tropicales/CENIVAM. Chemistry School, Science Faculty, Universidad Industrial de Santander, Bucaramanga 680002, Colombia
3
Research Group-Centro de Investigación en Ciencia y Tecnología de Alimentos/CICTA, Department of Basic Sciences, Health Faculty, Universidad Industrial de Santander, Bucaramanga 680002, Colombia
*
Author to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2022, 44(11), 5741-5755; https://doi.org/10.3390/cimb44110389
Submission received: 4 October 2022 / Revised: 28 October 2022 / Accepted: 29 October 2022 / Published: 18 November 2022
(This article belongs to the Special Issue Natural Products as Potential Sources of Antidiabetic Compounds)

Abstract

:
Obesity is characterized by an expansion of adipose tissue due to excessive accumulation of triglycerides in adipocytes, causing hypertrophy and hyperplasia, followed by hypoxia, alterations in adipocyte functionality, and chronic inflammation. However, current treatments require changes in lifestyle that are difficult to achieve and some treatments do not generate sustained weight loss over time. Therefore, we evaluated the effect of the essential oil (EO) of Lippia alba (Verbenaceae) carvone chemotype on viability, lipid mobilization, and adipogenesis of adipocytes in two normal and pathological cellular models in vitro. In 3T3-L1 adipocytes, a normal and a pathological model of obesity were induced, and then the cells were treated with L. alba carvone chemotype EO to evaluate cell viability, lipid mobilization, and adipogenesis. L. alba carvone chemotype EO does not decrease adipocyte viability at concentrations of 0.1, 1, and 5 µg/mL; furthermore, there was evidence of changes in lipid mobilization and adipogenesis, leading to a reversal of adipocyte hypertrophy. These results could be due to effects produced by EO on lipogenic and lipolytic pathways, as well as modifications in the expression of adipogenesis genes. L. alba carvone chemotype EO could be considered as a possible treatment for obesity, using the adipocyte as a therapeutic target.

1. Introduction

Adipocytes are endocrine cells of adipose tissue (AT) that store energy in the form of triglycerides within lipid droplets and release adipokines that participate in homeostatic balance, which are crucial in vascularization and immune response. However, when there is excess energy, adipocytes increase in size (hypertrophy) and quantity (hyperplasia), and adipogenesis and lipid mobilization are altered, causing changes that compromise adipocyte functionality and lead to the development of obesity [1,2].
Specifically, alteration of adipocyte functionality such as lipid mobilization leads to alterations in triglyceride accumulation (lipogenesis) and its positive stimulation pathways such as lipoprotein lipase (Lpl), insulin, and leptin, as well as its inhibition pathways such as AMPK [3,4,5,6]. Additionally, triglyceride hydrolysis (lipolysis) and its activation pathways such as hormone-sensitive lipase (HSL), triglyceride lipase (ATGL), and monoglyceride lipase (MGL), and the inhibitory pathways such as lipase, insulin, and AMPK, are altered as well [4,5,6,7]. In this context, altered lipid mobilization favors the adipocyte disbalance which, together with hypertrophy and hyperplasia, induces reticulum and mitochondrial stress in adipocytes [8], together leading to a state of chronic inflammation that evokes altered adipokines secretion, fibrosis, hypoxia, and induction of cell death [1].
All these modifications lead to the development of obesity pathogenesis. It is considered an epidemic disease with great importance in public health due to the frequency of its presence in the world population and the economic cost it represents for the health systems of different countries [9]. In addition, obesity is currently considered an epidemic of the 21st century since it is expected to maintain a constant increase in its rates in children, adolescents, and adults [9].
Therapies currently used to reduce obesity are mainly based on lifestyle modifications, medications, and bariatric surgery. However, most of them do not induce a sustained weight reduction over time, generating high costs for different countries, individuals, and public health [8]. In this line, it is important to search for new methods that can reduce the effects on adipocyte morphology and functionality as a target to treat obesity. Therefore, natural pharmacological interventions for obesity are necessary and well recognized by the clinical community. In this sense, therapies aimed at reversing hypertrophy, hyperplasia, and reversing the adipocyte effects of obesity may potentially affect obesity management.
The essential oils (EOs) distilled from aromatic plants have been confirmed to provide an effect like current therapeutic approaches, and previous studies demonstrated the reversal of obesity in Wistar rats fed high carbohydrate diets [10]. EOs have many biological properties, including antioxidant activity from having redox properties, allowing them to neutralize free radicals, and anti-inflammatory, by inhibiting the release of histamine and the activation of inflammatory mediators [11,12,13,14]. Recently, the effects of some compounds present in medicinal plants on adipocytes have been evaluated with a favorable effect on these cells [15,16,17,18,19,20,21,22,23,24,25,26,27], adipocyte number, and oxidative stress [28,29,30,31]. Moreover, recent data indicate that aqueous extracts of some EOs could improve metabolic alterations [15,32].
Some of these plants have been shown to have antidiabetic, antioxidant, and anti-inflammatory properties [3,6,10,11,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33], including Lippia spp, which has been confirmed in previous studies to influence adipocyte functionality by decreasing lipogenesis, reversing the hypertrophic state, and generating changes in lipolysis and adipogenesis [33]. Specifically, Lippia citriodora showed an effect on some important genes in adipogenesis (CCAAT/enhancer-binding protein Alpha (Cebpa) and Peroxisome Proliferator- activated receptor gamma (Pparg)) and, therefore, modifies lipid accumulation, decreases adipocyte hypertrophy, and affects adipokine release after treatment for 48 h at concentrations of 50 to 400 µg/mL in 3T3-L1 adipocytes [33]. In addition, Lippia alba is known in traditional medicine for its antidiarrheal, antifungal, anticholesterolemic, and analgesic properties [33]. Previous studies have also confirmed its anti-inflammatory/antioxidant properties [32], and hypocholesterolemia properties with high anti-obesity potential have been demonstrated [15]. Likewise, previous research has shown that L. alba chemotypes present many monoterpenes, which have been shown to affect the mevalonate pathway through which different molecules such as cholesterol are produced and, therefore, could have a hypolipidemic capacity [33]. Therefore, considering the properties of L. alba and the importance of adipocytes in the development of the pathophysiology of obesity, this study proposes for the first-time adipocytes as a target using L. alba carvone chemotype for obesity treatment.

2. Materials and Methods

2.1. Characterization

2.1.1. Sample Preparation

Lippia alba (Verbenaceae family) plants were grown under controlled agricultural conditions (temperature 26–28 °C, relative humidity 75–80%) in the experimental plots at CENIVAM (Centro de Investigación para agroindustrialización de especies vegetales aromáticas y medicinales tropicales) in the Industrial University of Santander (Bucaramanga, Colombia). The vegetable material belonging to the L. alba carvone chemotype was gathered in the flowering phenological stage and only healthy, undamaged plants (stems, leaves, and flowers) were used for the hydro-distillation carried out for two hours in a classical Clevenger apparatus, as described elsewhere [19]. Essential oil (0.8% yield) was dried with sodium sulphate, weighed (50 mg), and dissolved in dichloromethane (1 mL) for chromatographic analysis.

2.1.2. GC/MS Analysis

Analysis was performed on a GC 6890 Plus gas chromatograph (Agilent Technologies, Palo Alto, CA, USA), equipped with a mass selective detector MSD 5973 Network (Agilent Technologies, Palo Alto, CA, USA) that used electron ionization [(ionization with electrons (IE), 70 eV]. Helium (99.995%, AP gas, Messer, Bogotá, Colombia) was used as carrier gas, with initial inlet pressure of 113.5 kPa; its volumetric flow rate was kept constant (1 mL/min) during the chromatographic run. The injection volume was 2 μL in split mode (30:1) and the injector temperature was kept at 250 °C.
Compound separation was carried out in two capillary columns, one with polar stationary phase of poly (ethylene glycol) (DB-WAX, J & W Scientific, Folsom, CA, USA) of 60 m × 0.25 mm (i.d.) × 0.25 μm (df) [internal diameter, mm (i.d.), and stationary phase thickness, µm (df)] and another with non-polar stationary phase phenyl-poly(methyl siloxane), 5%-Ph-PDMS (DB-5MS, J & W Scientific, Folsom, CA, USA) of the same dimensions. The oven temperature was programmed from 50 °C (5 min) to 150 °C (7 min), at 4 °C/min, and then up to 230 °C (50 min) at 4 °C/min when the polar column was used. With the non-polar column (DB-5MS), the temperature of the chromatographic oven was programmed from 45 °C (5 min) to 150 °C (2 min) at 4 °C/min, then up to 300 °C (10 min), at 5 °C/min. The temperature of the GC-MS transfer line was set at 230 °C when the polar column was used, and at 300 °C for the non-polar column. The temperatures of the ionization chamber and the quadrupole were 250 °C and 150 °C, respectively. The mass range for the acquisition of ionic currents was mass/charge ratio (m/z) 45–450 µ, with an acquisition speed of 3.58 scan/s. Data were processed with MSDChemStation G1701DA software (Agilent Technologies, Palo Alto, CA, USA). Compound identification was based on their linear retention indices (LRI), calculated from the retention times of the compound of interest and those of the C6–C25 and C8–C40 n-alkanes present in commercial mixtures (Sigma-Aldrich, San Luis, MO, USA), according to Equation (1):
LRI = ( 100   ×   n ) + 100   × [ t Rx   t Rn t RN     t Rn ]
  • LRI = Linear retention index for the compound of interest.
  • n, N = Number of carbon atoms of the n-alkane that elutes before (n), or after (N) the compound of interest (x).
  • tRX = Retention time of the compound of interest (min).
  • tRN, tRn = Retention times of the n-alkanes that elute before (n) or after (N) the compound of interest (x) (min).
For tentative identification, experimental mass spectra were compared to those in Adams (2007), NIST (2017), and Wiley (2008) spectral databases. Confirmatory identification of some compounds was obtained by comparison of their LRIs and mass spectra with those of available standard substances.

2.2. Cell Culture

Mature 3T3-L1 adipocytes obtained from the American Type Culture Collection (ATCC CRL-3242) were seeded at 3 × 103 cells/cm2 and cultured according to the protocol described previously [34]. Briefly, adipocyte medium containing Dulbecco’s Modified Eagle’s Medium [Dulbecco′s Modified Eagle′s Medium (DMEM, Sigma-Aldrich, San Luis, MO, USA)] with 100 mg/dL glucose (v/v), 2% L-glutamine (m/v), 1% antibiotic–antimycotic (v/v), 1.5 g/L sodium bicarbonate (m/v), and 10% fetal bovine serum (v/v) (FBS, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) was added. All cultures were incubated at 37 °C, with 5% CO2, until 80% confluence; after 3 days of culture, differentiation was initiated using DMEM enriched with 0.5 mmol/L 3-isobutyl-1-methylxanthine [IBMX, (Sigma-Aldrich, San Luis, MO, USA)], 0.2 μmol/L (m/v) dexamethasone (Sigma-Aldrich, San Luis, MO, USA), 2 µmol/L (m/v) rosiglitazone, and 1 µg/mL (m/v) insulin. After the 3-day induction period, the medium was changed every 3 days with DMEM but without IBMX, rosiglitazone, and without dexamethasone during the remaining 8 days of adipocyte differentiation. On day 10 of differentiation, all experiments were performed. For all the experimental tests, the seeding density of 3000 cells/cm2 was used.
Mature adipocytes were treated or not with different concentrations (0.1, 1, 5, and 10 μg/mL) of EOs distilled from carvone chemotype L. alba. Simultaneously, the in vitro obesity model (high glucose and high insulin—HGHI) characterized and described before [35] was used to evaluate the same parameters as a pathological condition mimicking obesity in vitro with or without the EO.

2.3. High Glucose—High Insulin Induction Model (HGHI)

To induce the pathological model of obesity and insulin resistance in adipocytes in vitro, we used the protocol previously established in Bonilla-Carvajal et al., 2022 [35]. Briefly, DMEM medium was added with 450 mg/dL glucose (v/v) and insulin at 106 pmol/L (m/v) for 24 h.

2.4. Evaluation of Cytotoxicity by MTT

Mature adipocytes that were untreated (normal model) and those with a pathological state—HGHI (HGHI model)—were exposed to carvone chemotype L. alba EO at different concentrations of 0.1, 1, 5, and 10 µg/mL during 8 h; once the cells were treated with EO, the MTT [3-(4.5-dimethylthiazol-2-yl)-2.5-diphenyltetrazole bromide] assay was performed as previously described [34,36]. Briefly, the cells were treated with an MTT solution at a concentration of 0.5 g/L (m/v) for 5 h at 37 °C, then the MTT solution was removed and dimethyl sulfoxide (DMSO) was added. Finally, the absorbance was read at 570 nm in the spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

2.5. Cell Size

Briefly, following the protocol previously established by Bonilla-Carvajal et al., 2022 [35], pathological and normal model cells were exposed to carvone chemotype L. alba EO at different concentrations of 0.1, 1, and 5 µg/mL, and then the samples were stained with Oil Red O to measure the diameter by light microscopy. At least 30 adipocytes were selected by each experiment and per each replicate for cell size measurement. According to the protocol described above, cells were fixed in 4% (m/v) paraformaldehyde (PFA) at room temperature in phosphate-buffered saline [PBS 0.01 mmol/l, pH 7.4] for 15 min, washed with 60% (v/v) isopropanol (Sigma-Aldrich, San Luis, MO, USA) and stained with Oil Red O (Sigma-Aldrich, San Luis, MO, USA) for 30 min. The cells were observed with a Leica DM500 optical microscope (Leica, Wetzlar, Alemania) and the images obtained were analyzed with Image J software.

2.6. Lipogenesis (Lipid Synthesis) and Lipolysis (Lipid Breakdown)

Triglyceride content (lipogenesis) and glycerol release (lipolysis) were measured in mature adipocytes treated or not with the HGHI model, following the previously described protocol [34]. Specifically, to evaluate lipogenesis, mature adipocytes previously exposed to the normal or pathological model and stimuli or not with carvone chemotype L. alba EO at different concentrations of 0.1, 1, and 5 µg/mL were used to measure lipolysis, and the cell culture medium was used to measure lipolysis. Once treated with the EO, the culture medium was removed and stored for lipolysis quantification. To evaluate lipogenesis, the adipocytes were washed with PBS 1X, then fixed with PFA at 4% (m/v), and once removed, with isopropanol at 60% (v/v), and were allowed to dry for 15 min. Finally, Oil Red O (Sigma-Aldrich, San Luis, MO, USA) (v/v) was added for 30 min, to be revealed with isopropanol at 100% (v/v). Finally, the samples were read at 540 nm (Thermo Fisher, Waltham, MA, USA).
Regarding lipolysis, in all the samples extracellular glycerol was measured using a colorimetric technique where a Free Glycerol Reagent (Sigma-Aldrich, San Luis, MO, USA) (v/v) kit (Sigma-Aldrich, San Luis, MO, USA) was used, as previously employed [22]. Finally, the glycerol reagent was added, incubated for 15 min at room temperature, and finally read at 540 nm (Thermo Fisher, Waltham, MA, USA).

2.7. Adipogenesis

Mature adipocytes were exposed to both cellular models (normal and pathological) and subsequently treated with the carvone chemotype L. alba EO at different concentrations of 0.1, 1, and 5 µg/mL, and were used to perform adipogenesis evaluation. For this purpose, RNA extraction from adipocytes was performed using Trizol (Ambion-Invitrogen, Waltham, MA, USA) and purified with the RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA). Integrity and quantification were performed using NanoDrop One (Thermo Fisher Scientific, Waltham, MA, USA), and gene expression of factors important in adipocyte phenotype was determined by real-time PCR. Primers and probes were designed using Biosearch Technologies software, using Forward (F) and Reverse (R) for preadipocyte factor 1 (Pref-1) F: TGCGTGGACCTGGAGAAAG, and R: TGGCAGGGAGAACCATTGATC, for Lipoprotein-lipase (Lpl) F: GGCTCTCTGCCTGAGTTGTAGAAAG and R: TCTTGGCTCTCTCTGACCTTGTTGA, for Peroxisome Proliferator- activated receptor gamma (Pparg) F: GAACCCAGAGTCTGCTGCTGATCTCTG and R: TCAGCGGGAAGGACTTTATGTATATG, and, finally, for CCAAT/enhancer-binding protein Alpha (Cebpa) F: GCGGGAACGCAACGCAACAACATC and R: CGGTCATTGTCACTGGTCAAC. Measurements were performed on days 0, 3, 6, and 10 of adipocyte differentiation using both cell models and treated or not with the EO. Cells were harvested for real-time PCR (BIORAD, CFX 96, Hercules, CA, USA) gene expression studies of the different markers of importance during adipocyte differentiation (Lpl, Pref-1, Cebpa, Pparg). All results were normalized for the expression of 18S rRNA (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative data analysis was performed with Gen5 software (Agilent, Santa Clara, CA, USA).

2.8. Statistical Analysis

Data are expressed as the mean  ±  SEM of six replicates of at least three independent experiments. Statistical differences between mean values were analyzed using one-way ANOVA followed by Tukey’s post hoc test. A p value  <  0.05 was considered statistically significant. The statistical analyses were performed using the SPSS/Windows software (v15.0, Chicago, IL, USA) and GraphPad prism software (v7.0, La Jolla, CA, USA).

3. Results

3.1. Characterization of the Essential Oil of Carvone Chemotype L. alba EO

The typical chromatograms of the L. alba carvone chemotype essential oil, obtained by GC/MS on both non-polar DB-5MS (60 m) and polar DB-WAX (60 m) columns, appear in Figures S1 and S2 of the Supplementary Materials. The relative GC (%) amount of each L. alba EO component is registered in Table 1, from which one can observe that the main EO compound was carvone (37.3%), followed by limonene (31.5%), germacrene (11.8%), and β-bourbonene (2.6%), as described elsewhere [19].

3.2. Viability

In our study we found, as evidenced in Figure 1, that cells treated with the EO studied at concentrations of 0.1, 1, and 5 µg/mL have cell viability higher than 96% compared to the control (not treated with EO). However, the concentration of 10 µg/mL produced in adipocytes a significant cell viability reduction (p = 0.0001), decreasing up to 40% compared to the control. Therefore, according to ISO 10993-5 [40], a moderate decrease in viability was obtained in adipocytes treated with a concentration of 10 µg/mL. However, with the concentrations of 0.1, 1, and 5 µg/mL, we did not identify a cytotoxic effect on adipocytes.

3.3. Cell Size

To identify changes after the EO treatment, cell size was measured (Figure 2a). Normal adipocytes treated with the EO showed a diameter of 0.12 mm (84%), while the control of the normal model without EO treatment had a diameter of 0.15 mm (100%). Therefore, the cell diameter in adipocytes treated with the carvone chemotype L. alba EO significantly decreased (p = <0.0001) up to 16% with respect to the control. Likewise, pathological adipocytes (stimulus with the HGHI model) showed a diameter of 0.14 mm (99%) after treatment with the EO, while the control for pathological adipocytes (not treated with the EO) obtained a diameter of 0.19 mm (128%). Therefore, the cell diameter decreased significantly (p = <0.0001) in the pathological adipocytes (HGHI model) by 28% after carvone treatment compared to the control of the HGHI model.
Furthermore, this significant decrease in adipocyte diameter was also evident in Oil Red O-stained images (Figure 2b), where changes in the size and number of lipid droplets can be observed in both cell models after the L. alba EO treatment. Therefore, it was evident that treatment with carvone chemotype L. alba chemotype EO decreases adipocyte diameter in the normal model and the HGHI model. However, in the HGHI model, a greater reversal of adipocyte hypertrophy was evident.

3.4. Lipogenesis

We evaluated lipogenesis for which triglyceride accumulation in adipocyte lipid droplets was quantified. As shown in Figure 3, adipocyte lipogenesis significantly decreased after treatment with the carvone chemotype L. alba EO at concentrations of 1 (p = <0.0001; 73%) and 5 (p = <0.0001; 64%) µg/mL with respect to the control. Similarly, in pathological adipocytes (HGHI model), a significant decrease in lipogenesis was evidenced after treatment with the EOs at concentrations 0.1 (p = <0.0001; 35%), 1 (p = <0.0001; 36%), and 5 (p = <0.0001; 61%) µg/mL, with respect to the control.
Furthermore, to confirm this decrease in triglyceride accumulation, the relationship between cell diameter and triglyceride accumulation was calculated (Figure 3b). We found a significant decrease after treatment with the carvone chemotype L. alba EO in normal adipocytes (p = 0.0007; 84%) and in pathological adipocytes (HGHI model) (p = 0.0006; 78%) with respect to the controls of each cell model.
The above results suggest that treatment with the carvone chemotype L. alba EO produces a decrease in triglyceride accumulation in the adipocytes of the normal model and the pathological model of hypertrophic adipocytes (HGHI).

3.5. Lipolysis

To evaluate the lipid breakdown process, lipolysis was determined. We found that after treatment with the carvone chemotype L. alba EO, there was a significant decrease in lipolysis in normal adipocytes. Specifically, a dose-dependent lipolysis value of 89% at 0.1 µg/mL concentration (p = 0.0009), 82% at 1 µg/mL concentration (p = <0.0001), and 81% at 5 µg/mL concentration (p = <0.0001) was obtained, as shown in Figure 4. Furthermore, in pathological adipocytes (HGHI model), a reduction of lipolysis was also evidenced, obtaining a value of 51% at a concentration of 0.1 (p = 0.0013), compared to control cells (Figure 4). Therefore, the carvone chemotype L. alba EO generates a dose-dependent decrease in lipolysis both in normal and pathological adipocytes.

3.6. Adipogenesis

When evaluating the differentiation of adipocytes after treatment with the carvone chemotype L. alba EO, as shown in Figure 5a, for the adipocytes of the normal model, the expression of Pref-1 decreased in all the concentrations of EO used (0.1, 1, and 5 µg/mL) in the different days of differentiation (0, 3, 6, and 10; p = <0.0001), compared to the control. Furthermore, in adipocytes previously treated with the HGHI model, there was also a decrease in Pref-1 expression on all differentiation days evaluated after treatment with the carvone chemotype L. alba EO chemotype at concentrations 0.1, 1, and 5 µg/mL (p = <0.0001 for all the concentrations). Thus, the carvone chemotype L. alba EO negatively affects dose-dependent Pref-1 expression in the normal model and the pathological model of obesity and insulin resistance.
Upon further evaluation of adipogenesis, we quantified Pparg expression (Figure 5b), finding that adipocytes in the normal model showed an increase in Pparg expression on day 3 of differentiation after treatment with the carvone chemotype L. alba EO in all concentrations used (0.1, 1, and 5 µg/mL; p = <0.0001). Likewise, in adipocytes previously treated with the HGHI pathological model, an increase in Pparg expression was evidenced at day 6 of differentiation in cells treated with the carvone chemotype L. alba EO at all concentrations used (0.1, 1, and 5 µg/mL; p = <0.0001) with respect to the control model. Therefore, the carvone chemotype L. alba EO increases Pparg expression at different days of adipogenesis in both cell models used.
The expression of Cebpa was measured and we found, as shown in Figure 5c, that in the adipocytes of the normal model, the highest Cebpa expression was evidenced on day 3 in cells treated with EO at all concentrations used (0.1, 1, and 5 µg/mL; p = <0.0001). In addition, in the adipocytes of the pathological HGHI model, on day 6 an increase in Cebpa expression was observed after treatment with the carvone chemotype L. alba EO at 0.1, 1, and 5 µg/mL (p = 0.0001 for all the concentrations). Therefore, the carvone chemotype L. alba EO increases Cebpa expression in the normal model and the pathological model of obesity and insulin resistance.
Finally, we determined the effect of the carvone chemotype L. alba EO on Lpl expression, finding, as shown in Figure 5d, that adipocytes from the normal model show an increase in Lpl expression on differentiation day 3 after treatment with the carvone chemotype L. alba EO at 0.1, 1, and 5 µg/mL treatment (p = <0.0001 for all the concentrations). Similarly, in the adipocytes of the pathological HGHI model, an increase in Lpl expression was evidenced on day 6 after EO treatment in all concentrations used (0.1, 1, and 5 µg/mL; p = <0.0001). Thus, EO increases Lpl expression in adipocytes of the normal model and the pathological model of obesity and insulin resistance.

4. Discussion

Obesity is characterized by an expansion of adipose tissue due to hypertrophy and hyperplasia produced in adipocytes [1,2], causing alterations in adipocyte functionality and inflammation, which is directly related to metabolic disease [3]. Because of this, several studies focus their attention on natural treatments that have effects on the pathophysiology of the adipocyte and promote sustained weight loss over time [41]. Therefore, our study investigated the effects of the carvone chemotype L. alba EO on cell viability, lipid mobilization, and adipogenesis in normal adipocytes and in pathological adipocytes simulating a state of obesity and insulin resistance (in vitro HGHI model).
Previous studies have shown that carvone not only demonstrates antioxidant, antimicrobial, anticancer, and anti-inflammatory properties [20,21,22,42], but that the S-carvone isomer reduces obesity induced by a high-fat diet and insulin resistance; it inhibits the inflammation that causes obesity by blocking the expression of genes such as Pparg, transcriptional factor sterol regulatory element-binding protein 1 c (Srebp1c), acetyl-CoA carboxylase 1 (Acc1), and fatty acid synthase (Fas), which are important in the process of lipogenesis. [20].
Another important chemical component identified in the characterization of the carvone chemotype L. alba EO was limonene. In previous research, limonene has been shown to reverse hypertrophy in white and brown adipocytes, as well as to reduce the levels of triglycerides, total cholesterol, low-density lipoproteins (LDL), and glucose in the blood of mice [23]. It has also been shown that limonene improves mitochondrial biogenesis and lipolysis, and induces a phenotype like brown adipocytes, thus having effects on lipid metabolism [21,22,23,24]. Therefore, it could be possible that the chemical components of the carvone chemotype L. alba EO could be involved in the results obtained in this study by having effects on lipid mobilization and adipogenesis of adipocytes.
In our study, we found that a concentration of 10 μg/mL of EO significantly decreased viability. These results contrast with previous studies where L. alba was used and showing that higher concentrations (139.5, 164.9, and 375.5 μg/mL) maintain cell viability [43,44]. This could be explained by the cell lines used (HeLa and Vero cells) [44], which differ from the adipocytes used in this study. However, it is essential to note that lower doses of one of the carvone chemotypes (0.1, 1, and 5 μg/mL) do not affect adipocyte cell viability, this could be due to the major chemical components of the carvone chemotype L. alba EO, since previous studies using limonene (31.5%) [21] alone as a treatment in 3T3-L1 adipocytes did not affect cell viability [22,23].
Furthermore, recognizing that obesity produces a state of adipocyte hypertrophy, we evaluated the effects after treatment with the carvone chemotype L. alba EO, finding a decrease in adipocyte diameter and lipid droplet content, leading to the reversal of adipocyte hypertrophy. These changes in cell size could be because the amount of triacylglycerol (TAG) stored in the adipocyte lipid droplet depends on lipid mobilization, the balance between lipogenesis and lipolysis [4,5]. Therefore, it is evident that treatment with the carvone chemotype L. alba EO decreases adipocyte hypertrophy in both adipocyte models (normal and HGHI). It is notable that in the pathological model a greater reversal of adipocyte hypertrophy was evident. These results could be due to the chemical compounds of the carvone chemotype L. alba EO (37.3%) [21] because, in previous studies where monoterpenes such as limonene were used as treatment, inhibition of lipid accumulation and therefore a decrease in the size of adipocytes and lipid droplets was observed, by enhancing mitochondrial biogenesis, increasing HSL protein levels and causing changes in adipogenesis [4,21,24].
It is also important to note that when the intake of hypercaloric foods is exceeded, and other factors such as lack of physical activity are added, an excessive increase in lipogenesis is generated, leading to an imbalance of homeostasis and, in consequence, increasing adiposity, typical of obesity [4]. In our study, we observed that lipogenesis (lipid accumulation) of adipocytes of the normal and pathological HGHI model was significantly reduced; our results were like results previously described where the effect of different natural extracts such as Fraxinus rhynchophylla and Oroxylum indicum was evaluated, and where inhibition of lipogenesis and adipogenesis were observed [25]. This could be because L. alba EO causes chronic activation of adenosine monophosphate-activated kinase (AMPK) [26], which would decrease lipogenesis and promote adequate lipid mobilization [4]. This has already been demonstrated in previous studies where it was shown that limonene, an important chemical component of the carvone chemotype L. alba EO [21], has been shown to reduce the accumulation of triglycerides in adipocytes by increasing the expression of HSL (hormone-sensitive lipase), FAS, and AMPK [33]. Other plant extracts, such as Citrus paradisi, which has limonene among its active components, have been shown to regulate lipid metabolism through the expression of carnitine palmitoyl-transferase 1a (CPT1a) in an animal model [27]. Therefore, the above results suggest that the carvone chemotype L. alba EO induced a large decrease in triglyceride accumulation in both adipocyte models. However, it is relevant to note that in the lipogenesis study, a more significant decrease in triglyceride accumulation was observed in the pathological adipocytes after EO treatment. This could be explained by the fact that the carvone chemotype L. alba EO had a more substantial reduction of severe hypertrophy, as previously investigated with other extracts using in vivo and in vitro obesity models [28,29].
In this work, we were also able to determine the effect of the carvone chemotype L. alba EO on lipolysis, where we observed a decrease in lipolysis in both models. These results could be because treatment with the EO would influence the AMPK pathway, generating a decrease in lipogenesis and lipolysis [5,6] to maintain energy homeostasis, which is necessary for adipocyte survival. Briefly, AMPK activation would suppress lipolysis by inhibiting HSL, thus preventing diacylglycerol (DAG) hydrolysis [7]. Therefore, the carvone chemotype L. alba EO generates a dose-dependent decrease in lipolysis in adipocyte cell models. In addition, it is important to highlight that this decrease in lipolysis obtained in our study contrasts with other studies [21], where an increase in lipolysis in adipocytes after treatment with limonene was evidenced. However, this could be because limonene was only one of several chemical components that make up the carvone chemotype L. alba EO of this study, and therefore this effect would be caused by the synergistic behavior of all the components.
On the other hand, considering that adipogenesis is related to lipid mobilization in the adipocyte [41,45], we evaluated whether carvone treatment with the carvone chemotype L. alba EO influences adipogenesis in adipocytes from normal and pathological adipocytes in vitro. We evaluated whether carvone treatment with the carvone chemotype L. alba EO has an effect on adipogenesis in adipocytes from normal and pathological adipocytes in vitro, for which we quantified the expression of Pref 1, Pparg, Cebpa, and Lpl in normal and HGHI cell models.
When evaluating Pref-1 expression, we found that after treatment with the carvone chemotype L. alba EO, there is a decrease in Pref-1 expression in both models. This indicates that EO treatment could stimulate early adipocyte differentiation, both in the normal and the pathological state, as previous studies have shown that Pref-1 was a marker of the pre-adipocyte state [46]. To continue with the evaluation of adipogenesis in the adipocyte, we found an increase in Pparg expression since day 3, and in the pathological model since day 6, with respect to the control. Considering that Pparg expression activity positively feeds back on Pparg activity, and that these two factors enhance each other’s expression and maintain the differentiated state [47,48], Cebpa expression was evaluated and had a similar behavior to Pparg. Previous studies have shown that not only is Pparg an activator of differentiation, but it also stimulates the expression of Cebpa [48] by performing a synergistic process in which, when expressed together, they stimulated adipogenesis [47,48]. Furthermore, this increased expression of Pparg induced adipocyte differentiation, while Cebpa participated in adipocyte proliferation and insulin sensitivity [49]. We concluded in our study that in pathological adipocytes there was a late differentiation of adipocytes compared to adipocytes of the normal model by increasing Pparg expression, which would stimulate Cebpa expression, which as previously demonstrated would lead to a higher activation of Pparg expression [47,49].
The above results were related to those observed when evaluating Lpl expression, where we found an increased expression of Lpl in the normal model since day 3 and in the pathological model since day 6, compared to the control. Taking into account that Lpl expression stimulates insulin sensitivity [50], this process of late differentiation of adipocytes in the pathological adipocytes is reflected in a decrease in lipogenesis and lipolysis; furthermore, in this process there could be involved the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) signalling pathway of adipogenesis, which promotes the activity of Cebpa and Pparg activators, in addition to the AMPK pathway that has been shown to reduce Pparg and Cebpa expression.
Therefore, treatment with the carvone chemotype L. alba EO influences adipocyte differentiation by inducing an increase in Pparg, Cebpa, and Lpl expression at different days of differentiation. This could be related to limonene in the carvone chemotype L. alba EO. From the results obtained in previous studies, it was evident that this chemical compound could positively regulate Pparg [23] and Cebpa, triggering an increase in adipogenesis through the Akt signalling pathway in adipocytes [22], which would lead to the reversal of the dysfunctional state of adipose tissue, and thus prevent the state of cellular senescence and inflammation characteristic of obesity. This is in addition to normalizing lipid mobilization, thereby regulating the production of adipokines and cytokines, and thus preventing the onset of metabolic disease, insulin resistance, and diabetes [22].
For all the above-described reasons, the results obtained in our study make it evident that treatment with the carvone chemotype L. alba EO substantially favors a reversal of the pathological state of obesity by influencing lipid mobilization, reduced hypertrophy, and, change the differentiation state of adipocytes.

5. Conclusions

The carvone chemotype L. alba EO induces a reversion of the pathological state of the adipocyte, causing changes in lipid mobilization and adipogenesis. Therefore, the carvone chemotype L. alba EO could be considered as a possible treatment for obesity, using the adipocyte as a therapeutic target. These studies allow continuity to future in vivo studies, where the L. alba EO treatment could be evaluated in animal models of obesity, focusing on adipocytes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cimb44110389/s1, Figure S1: Chromatographic profile (GC/MS, full scan) of Lippia alba carvone chemotype essential oil. DB-5MS (60 m) column, split 1:30, MSD (EI, 70 eV); Figure S2: Chromatographic profile (GC/MS, full scan) of Lippia alba carvone chemotype, essential oil. DB-WAX (60 m) column, split 1:30, MSD (EI, 70 eV).

Author Contributions

K.B.-C., E.E.S. and N.M.-C.: methodology and investigation; K.B.-C., E.E.S. and N.M.-C.: writing—original draft preparation; N.M.-C.: supervision and project administration. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the research support program of the “Vicerrectoría de Investigación of the Universidad Industrial de Santander for Project 2536” and the contributions of the international mobility program for professors of the “Vicerrectoría de Investigación of the Universidad Industrial de Santander”, Colombia.

Institutional Review Board Statement

This article does not contain any studies with human participants or animals performed by any authors.

Informed Consent Statement

Not applicable.

Acknowledgments

The authors thank Raquel Elvira-Ocazionez of the Universidad de Santander, Colombia, for infrastructure support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Maria, M.M.; Alberto, D.R.; Rocio, G.R.; Yolanda, J.G.; Natalia, R.M.; Socorro, G.N.; Vázquez-Martínez, R.; Peinado, J.R. Adipobiology for Novel Therapeutic Approaches in Metabolic Syndrome. Curr. Vasc. Pharmacol. 2013, 11, 954–967. [Google Scholar]
  2. Beg, M.; Chauhan, P.; Varshney, S.; Shankar, K.; Rajan, S.; Saini, D.; Srivastava, M.N.; Yadav, P.P.; Gaikwad, A.N. A withanolide coagulin-L inhibits adipogenesis modulating Wnt/beta-catenin pathway and cell cycle in mitotic clonal expansion. Phytomedicine 2014, 21, 406–414. [Google Scholar] [CrossRef] [PubMed]
  3. Jack, B.U.; Malherbe, C.J.; Mamushi, M.; Muller, C.J.; Joubert, E.; Louw, J.; Pheiffer, C. Adipose tissue as a possible therapeutic target for polyphenols: A case for Cyclopia extracts as anti-obesity nutraceuticals. Biomed. Pharmacother. 2019, 120, 109439. [Google Scholar] [CrossRef] [PubMed]
  4. Bolsoni-Lopes, A.; Alonso-Vale, M.I.C. Lipolysis and lipases in white adipose tissue—An update. Arch. Endocrinol. Metab. 2015, 59, 335–342. [Google Scholar] [CrossRef] [Green Version]
  5. Li, Y.; Li, Z.; Ngandiri, D.A.; Llerins Perez, M.; Wolf, A.; Wang, Y. The Molecular Brakes of Adipose Tissue Lipolysis. Front. Physiol. 2022, 13, 826314. [Google Scholar] [CrossRef]
  6. Daval, M.; Foufelle, F.; Ferré, P. Functions of AMP-activated protein kinase in adipose tissue. J. Physiol. 2006, 574 Pt 1, 55–62. [Google Scholar] [CrossRef]
  7. Gaidhu, M.P.; Ceddia, R.B. The Role of Adenosine Monophosphate Kinase in Remodeling White Adipose Tissue Metabolism. Exerc. Sport Sci. Rev. 2011, 39, 102–108. [Google Scholar] [CrossRef]
  8. Furukawa, S.; Fujita, T.; Shimabukuro, M.; Iwaki, M.; Yamada, Y.; Nakajima, Y.; Nakayama, O.; Makishima, M.; Matsuda, M.; Shimomura, I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Invest. 2004, 114, 1752–1761. [Google Scholar] [CrossRef]
  9. Pêgo-Fernandes, P.M.; Bibas, B.J.; Deboni, M. Obesity: The greatest epidemic of the 21st century? Sao Paulo Med. J. 2011, 129, 283–284. [Google Scholar] [CrossRef] [Green Version]
  10. Aranaz, P.; Romo-Hualde, A.; Navarro-Herrera, D.; Zabala, M.; López-Yoldi, M.; González-Ferrero, C.; Gil, A.G.; Martínez, J.A.; Vizmanos, J.L.; Milagro, F.I.; et al. Low doses of cocoa extract supplementation ameliorate diet-induced obesity and insulin resistance in rats. Food Funct. 2019, 10, 4811–4822. [Google Scholar] [CrossRef]
  11. Hussain, K.; Abbas, R.; Abbas, A.; Samiullah, K.; Ahmed, T.; Siddique, F.; Mohsin, M.; Rehman, A.; Rahman, A.U.L.; Waqas, M.U. Anticoccidial potential of Ageratum conyzoides and its effect on Blood parameters of experimentally infected Broiler Chickens. J. Hell. Vet. Med. Soc. 2021, 72, 3085–3090. [Google Scholar] [CrossRef]
  12. Jamil, M.; Aleem, M.T.; Shaukat, A.; Khan, A.; Mohsin, M.; Rehman, T.U.; Abbas, R.Z.; Saleemi, M.K.; Khatoon, A.; Babar, W.; et al. Medicinal Plants as an Alternative to Control Poultry Parasitic Diseases. Life 2022, 12, 449. [Google Scholar] [CrossRef] [PubMed]
  13. Choi, D.H.; Han, J.H.; Hong, M.; Lee, S.Y.; Lee, S.U.; Kwon, T.H. Antioxidant and lipid-reducing effects of Rosa rugosa root extract in 3T3-L1 cell. Food Sci. Biotechnol. 2022, 31, 121–129. [Google Scholar] [CrossRef] [PubMed]
  14. Kim, B.M.; Cho, B.O.; Jang, S.I. Anti-obesity effects of Diospyros lotus leaf extract in mice with high-fat diet-induced obesity. Int. J. Mol. Med. 2019, 43, 603–613. [Google Scholar] [CrossRef] [Green Version]
  15. Rayalam, S.; Della-Fera, M.A.; Baile, C.A. Phytochemicals and regulation of the adipocyte life cycle. J. Nutr. Biochem. 2008, 19, 717–726. [Google Scholar] [CrossRef] [PubMed]
  16. Herranz-Lopez, M.; Fernández-Arroyo, S.; Pérez-Sanchez, A.; Barrajón-Catalán, E.; Beltrán-Debón, R.; Menendez, J.; Alonso-Villaverde, C.; Segura-Carretero, A.; Joven, J.; Micol, V. Synergism of plant-derived polyphenols in adipogenesis: Perspectives and implications. Phytomedicine 2012, 19, 253–261. [Google Scholar] [CrossRef]
  17. Wang, L.; Waltenberger, B.; Pferschy-Wenzig, E.-M.; Blunder, M.; Liu, X.; Malainer, C.; Blazevic, T.; Schwaiger, S.; Rollinger, J.M.; Heiss, E.H.; et al. Natural product agonists of peroxisome proliferator-activated receptor gamma (PPARγ): A review. Biochem. Pharmacol. 2014, 92, 73–89. [Google Scholar] [CrossRef] [Green Version]
  18. Silva-Vazquez, R.; Duran-Melendez, L.A.; Estrada, E.S.; Xie, M.; Dunford, T.; Goad, C. Antioxidant Activity of Essential Oils from Various Mexican Oregano Ecotypes and Oil Fractions Obtained by Distillation. 2017. Available online: https://www.jscimedcentral.com/Chemistry/chemistry-5-1046.pdf (accessed on 3 August 2022).
  19. Gómez-Sequeda, N.; Cáceres, M.; Stashenko, E.E.; Hidalgo, W.; Ortiz, C. Antimicrobial and Antibiofilm Activities of Essential Oils against Escherichia coli O157:H7 and Methicillin-Resistant Staphylococcus aureus (MRSA). Antibiotics 2020, 9, 730. [Google Scholar] [CrossRef]
  20. Alsanea, S.; Liu, D. BITC and S-Carvone Restrain High-fat Diet-induced Obesity and Ameliorate Hepatic Steatosis and Insulin Resistance. Pharm. Res. 2017, 34, 2241–2249. [Google Scholar] [CrossRef]
  21. Lone, J.; Yun, J.W. Monoterpene limonene induces brown fat-like phenotype in 3T3-L1 white adipocytes. Life Sci. 2016, 153, 198–206. [Google Scholar] [CrossRef]
  22. Soundharrajan, I.; Kim, D.H.; Srisesharam, S.; Kuppusamy, P.; Choi, K.C. R-Limonene Enhances Differentiation and 2-Deoxy-D-Glucose Uptake in 3T3-L1 Preadipocytes by Activating the Akt Signaling Pathway. Evid. Based Complement Altern. Med. 2018, 2018, 4573254. [Google Scholar] [CrossRef] [PubMed]
  23. Wu, C.-C.; Huang, Y.-W.; Hou, C.-Y.; Chen, Y.-T.; Dong, C.-D.; Chen, C.-W.; Singhania, R.-R.; Leang, J.-Y.; Hsieh, S.-L. The Anti-Obesity Effects of Lemon Fermented Products in 3T3-L1 Preadipocytes and in a Rat Model with High-Calorie Diet-Induced Obesity. Nutrients 2021, 13, 2809. [Google Scholar] [CrossRef] [PubMed]
  24. Ngamdokmai, N.; Paracha, T.U.; Waranuch, N.; Chootip, K.; Wisuitiprot, W.; Suphrom, N.; Insumrong, K.; Ingkaninan, K. Effects of Essential Oils and Some Constituents from Ingredients of Anti-Cellulite Herbal Compress on 3T3-L1 Adipocytes and Rat Aortae. Pharmaceuticals 2021, 14, 253. [Google Scholar] [CrossRef]
  25. Hengpratom, T.; Lowe, G.M.; Thumanu, K.; Suknasang, S.; Tiamyom, K.; Eumkeb, G. Oroxylum indicum (L.) Kurz extract inhibits adipogenesis and lipase activity in vitro. BMC Complement Altern. Med. 2018, 18, 177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Cheng, C.Y.; Yang, A.J.; Ekambaranellore, P.; Huang, K.C.; Lin, W.W. Anti-obesity action of INDUS810, a natural compound from Trigonella foenum-graecum: AMPK-dependent lipolysis effect in adipocytes. Obes. Res. Clin. Pract. 2018, 12, 562–569. [Google Scholar] [CrossRef] [PubMed]
  27. Gamboa-Gómez, C.I.; Rocha-Guzmán, N.E.; Gallegos-Infante, J.A.; Moreno-Jiménez, M.R.; Vázquez-Cabral, B.D.; González-Laredo, R.F. Plants with potential use on obesity and its complications. EXCLI J. 2015, 14, 809–831. [Google Scholar]
  28. Yun, J.W. Possible anti-obesity therapeutics from nature—A review. Phytochemistry 2010, 71, 1625–1641. [Google Scholar] [CrossRef]
  29. González-Castejón, M.; Rodriguez-Casado, A. Dietary phytochemicals and their potential effects on obesity: A review. Pharmacol. Res. 2011, 64, 438–455. [Google Scholar] [CrossRef]
  30. Linde, G.A.; Colauto, N.B.; Albertó, E.; Gazim, Z.C. Quimiotipos, Extracción, Composición y Aplicaciones del Aceite Esencial de Lippia alba. Rev. Bras. Plantas Med. 2016, 18, 191–200. [Google Scholar] [CrossRef] [Green Version]
  31. Howitz, K.T.; Sinclair, D.A. Xenohormesis: Sensing the Chemical Cues of Other Species. Cell 2008, 133, 387–391. [Google Scholar] [CrossRef] [Green Version]
  32. Dhifi, W.; Bellili, S.; Jazi, S.; Bahloul, N.; Mnif, W. Essential Oils’ Chemical Characterization and Investigation of Some Biological Activities: A Critical Review. Medicines 2016, 3, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Herranz-Lopez, M.; Barrajon-Catalan, E.; Segura-Carretero, A.; Menendez, J.A.; Joven, J.; Micol, V. Lemon verbena (Lippia citriodora) polyphenols alleviate obesity-related disturbances in hypertrophic adipocytes through AMPK-dependent mechanisms. Phytomedicine. 2015, 22, 605–614. [Google Scholar] [CrossRef] [PubMed]
  34. Moreno–Castellanos, N.R.; Angel–Martin, A.; Mantilla–Mora, G. Effects of oleic (18: 1n-9) and palmitic (16:0) fatty acids on the metabolic state of adipocytes. Salud UIS 2021, 53. Available online: https://revistas.uis.edu.co/index.php/revistasaluduis/article/view/11597 (accessed on 3 August 2022). [CrossRef]
  35. Bonilla-Carvajal, K.; Ángel-Martín, A.; Moreno-Castellanos, N. Hipertrofia y resistencia a la insulina en un modelo in vitro de obesidad y DMT2 inducida por alta glucosa e insulina. Salud UIS 2022, 54. Available online: https://revistas.uis.edu.co/index.php/revistasaluduis/article/view/12576 (accessed on 3 August 2022). [CrossRef]
  36. Sánchez-Cardona, Y.; Echeverri-Cuartas, C.E.; López, M.E.L.; Moreno-Castellanos, N. Chitosan/Gelatin/PVA Scaffolds for Beta Pancreatic Cell Culture. Polymers 2021, 13, 2372. [Google Scholar] [CrossRef] [PubMed]
  37. Adams, R. Identification of Essential Oil Components by Gas Chromatography/Mass Spectrometry, 4th ed.; Allured Publishing Corporation: Wheaton, IL, USA, 2007; ISBN 1932633219. Available online: https://www.amazon.com.br/Identification-Essential-Components-Chromatography-Spectrometry/dp/1932633219 (accessed on 19 September 2022).
  38. Babushok, V.I.; Linstrom, P.J.; Zenkevich, I.G. Retention Indices for frequently reported compounds of plant essential oils. J. Phys. Chem. Ref. Data 2011, 40, 043101. [Google Scholar] [CrossRef] [Green Version]
  39. “NIST Database”. Version 2.3, Database, Agilent Format. 2017. Available online: https://www.sisweb.com/software/ms/nist.htm (accessed on 19 September 2022).
  40. International Organization for Standardization (ISO). Biological Evaluation of Medical Devices. Part 5: Tests for In Vitro Cytotoxicity; ISO: Geneva, Switzerland, 2009. [Google Scholar]
  41. De Cássia da Silveira e Sá, R.; Andrade, L.N.; De Sousa, D.P. A Review on Anti-Inflammatory Activity of Monoterpenes. Molecules 2013, 18, 1227–1254. [Google Scholar] [CrossRef]
  42. Jing, L.; Zhang, Y.; Fan, S.; Gu, M.; Guan, Y.; Lu, X.; Huang, C.; Zhou, Z. Preventive and ameliorating effects of citrus D-limonene on dyslipidemia and hyperglycemia in mice with high-fat diet-induced obesity. Eur. J. Pharmacol. 2013, 715, 46–55. [Google Scholar] [CrossRef]
  43. Gomes, D.S.; Negrão-Corrêa, D.A.; Miranda, G.S.; Rodrigues, J.G.M.; Guedes, T.J.F.L.; Junior, W.D.L.; Filho, J.C.F.D.S.; Nizio, D.A.D.C.; Blank, A.F.; Feitosa, V.L.C.; et al. Lippia alba and Lippia gracilis essential oils affect the viability and oviposition of Schistosoma mansoni. Acta Trop. 2022, 231, 106434. [Google Scholar] [CrossRef]
  44. Ocazionez, R.E.; Meneses, R.; Torres, F.Á.; Stashenko, E. Virucidal activity of Colombian Lippia essential oils on dengue virus replication in vitro. Memórias Do Inst. Oswaldo Cruz. 2010, 105, 304–309. [Google Scholar] [CrossRef] [Green Version]
  45. Jakab, J.; Miškić, B.; Mikšić, Š.; Juranić, B.; Ćosić, V.; Schwarz, D.; Včev, A. Adipogenesis as a Potential Anti-Obesity Target: A Review of Pharmacological Treatment and Natural Products. Diabetes Metab. Syndr. 2021, 14, 67–83. [Google Scholar] [CrossRef] [PubMed]
  46. Sul, H.S. Minireview: Pref-1: Role in Adipogenesis and Mesenchymal Cell Fate. Mol. Endocrinol. 2009, 23, 1717–1725. [Google Scholar] [CrossRef] [PubMed]
  47. Ji, S.; Doumit, M.E.; Hill, R.A. Regulation of Adipogenesis and Key Adipogenic Gene Expression by 1, 25-Dihydroxyvitamin D in 3T3-L1 Cells. PLoS ONE 2015, 10, e0126142. [Google Scholar]
  48. Ghaben, A.L.; Scherer, P.E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 2019, 20, 242–258. [Google Scholar] [CrossRef] [PubMed]
  49. Sheng, X.; Zhang, Y.; Gong, Z.; Huang, C.; Zang, Y.Q. Improved Insulin Resistance and Lipid Metabolism by Cinnamon Extract through Activation of Peroxisome Proliferator-Activated Receptors. PPAR Res. 2008, 2008, e581348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Zechner, R.; Strauss, J.; Frank, S.; Wagner, E.; Hofmann, W.; Kratky, D.; Hiden, M. The role of lipoprotein lipase in adipose tissue development and metabolism. Int. J. Obes. 2000, 24, S53–S56. [Google Scholar] [CrossRef]
Figure 1. Cell viability of adipocytes treated with ascending concentrations (0.1, 1, 5, and 10 µg/mL) of L. alba carvone chemotype essential oil (EO) measured by MTT. Values are mean ± SEM. *** p < 0.001 vs. control (not treated with EO).
Figure 1. Cell viability of adipocytes treated with ascending concentrations (0.1, 1, 5, and 10 µg/mL) of L. alba carvone chemotype essential oil (EO) measured by MTT. Values are mean ± SEM. *** p < 0.001 vs. control (not treated with EO).
Cimb 44 00389 g001
Figure 2. Adipocyte cell size. (a) Cell area percentage of adipocytes treated with 5 µg/mL of the carvone chemotype Lippia alba EO from normal and pathological model-HGHI; (b) triglyceride staining by Oil Red-O in normal adipocytes and the pathological model of obesity and insulin resistance (HGHI) in vitro, treated and untreated (control) with the carvone chemotype Lippia alba EO. *** p < 0.001 with respect to control model without EO; +++ p < 0.001 with respect to the pathological model without EO treatment; ### p < 0.001 with respect to control model treated with EO.
Figure 2. Adipocyte cell size. (a) Cell area percentage of adipocytes treated with 5 µg/mL of the carvone chemotype Lippia alba EO from normal and pathological model-HGHI; (b) triglyceride staining by Oil Red-O in normal adipocytes and the pathological model of obesity and insulin resistance (HGHI) in vitro, treated and untreated (control) with the carvone chemotype Lippia alba EO. *** p < 0.001 with respect to control model without EO; +++ p < 0.001 with respect to the pathological model without EO treatment; ### p < 0.001 with respect to control model treated with EO.
Cimb 44 00389 g002
Figure 3. Lipogenesis of adipocytes treated with the carvone chemotype L. alba EO. (a) Intracellular accumulation of triglycerides after treatment with increasing concentrations (0.1; 1; 5 µg/mL) of the carvone chemotype L. alba EO in normal adipocytes and the pathological model of obesity and insulin resistance (HGHI) in vitro. (b) The ratio of cell diameter/TG content of adipocytes treated with 5 µg/mL of the carvone chemotype L. alba EO in normal and pathological models in vitro. *** p < 0.001 with respect to control model without EO; +++ p < 0.001 with respect to the pathological model without EO treatment; # p < 0.05; and ### p < 0.001 with respect to control model treated with EO.
Figure 3. Lipogenesis of adipocytes treated with the carvone chemotype L. alba EO. (a) Intracellular accumulation of triglycerides after treatment with increasing concentrations (0.1; 1; 5 µg/mL) of the carvone chemotype L. alba EO in normal adipocytes and the pathological model of obesity and insulin resistance (HGHI) in vitro. (b) The ratio of cell diameter/TG content of adipocytes treated with 5 µg/mL of the carvone chemotype L. alba EO in normal and pathological models in vitro. *** p < 0.001 with respect to control model without EO; +++ p < 0.001 with respect to the pathological model without EO treatment; # p < 0.05; and ### p < 0.001 with respect to control model treated with EO.
Cimb 44 00389 g003
Figure 4. Lipolysis of the adipocyte. Free glycerol of the carvone chemotype L. alba EO. *** p < 0.001 vs. control (not treated with EO) of the HGHI model; *** p < 0.001 with respect to control model without EO; + p < 0.05; and ++ p < 0.01 with respect to the pathological model without EO treatment; ### p < 0.001 with respect to control model treated with EO.
Figure 4. Lipolysis of the adipocyte. Free glycerol of the carvone chemotype L. alba EO. *** p < 0.001 vs. control (not treated with EO) of the HGHI model; *** p < 0.001 with respect to control model without EO; + p < 0.05; and ++ p < 0.01 with respect to the pathological model without EO treatment; ### p < 0.001 with respect to control model treated with EO.
Cimb 44 00389 g004
Figure 5. Adipogenesis. Expression of (a) Pref-1, (b) Pparg, (c) Cebpa, and (d) Lpl in adipocytes in normal and pathological models at differentiation days zero, 3, 6, 10 and treated or not with the carvone chemotype L. alba EO. ** p < 0.01; and *** p < 0.001; ++ p < 0.01; and +++ p < 0.001 with respect to the pathological model without EO treatment.
Figure 5. Adipogenesis. Expression of (a) Pref-1, (b) Pparg, (c) Cebpa, and (d) Lpl in adipocytes in normal and pathological models at differentiation days zero, 3, 6, 10 and treated or not with the carvone chemotype L. alba EO. ** p < 0.01; and *** p < 0.001; ++ p < 0.01; and +++ p < 0.001 with respect to the pathological model without EO treatment.
Cimb 44 00389 g005
Table 1. GC/MS characterization of the essential oil obtained by steam distillation of aerial parts of Lippia alba, carvone chemotype (Verbenaceae family).
Table 1. GC/MS characterization of the essential oil obtained by steam distillation of aerial parts of Lippia alba, carvone chemotype (Verbenaceae family).
No.CompoundLinear Rentention Indices GC Relative Area,
% DB-5MS
Identifi-Cation
Criteria
DB-5MSDB-WAX
Exp.*Lit.**Exp.*Lit.**
1cis-Hex-3-en-1-ol854850 [37]13861380 [38]0.3a, b
2α-Pinene934932 [37]10221025 [38]0.1a, b, c
3Camphene952954 [37]10661069 [38]0.2a, b, c
4Oct-1-en-3-ol 979980 [38]14511444 [38]0.3a, b, c
5β-Myrcene989990 [37]11631161 [38]0.7a, b, c
6Limonene10371029 [37]12061198 [38]31.5a, b, c
7trans-β-Ocimene10471050 [37]12521250 [38]0.6a, b
8Linalool 11001096 [37]15481543 [38]1.0a, b, c
9trans-p-Mentha-2,8-dien-1-ol11251122 [37]16321639 [38]0.3a, b
10cis-Limonene oxide11401136 [37]14651451 [38]0.3a, b, c
11Borneol11781169 [37]17081700 [38]0.8a, b
12trans-Dihydrocarvone 12091200 [37]--0.1a, b
13cis-Carveol 12291229 [37]18381854 [38]0.4a, b
14Carvone 12591258 [39]17471734 [38]37.3a, b, c
15Piperitone oxide12621256 [39]17251711 [39]0.5a, b
16Piperitone 12641264 [39]17371730 [38]1.8a, b
17Geranial 12691270 [38]17471725 [38]0.4a, b, c
18Carvone oxide12811273 [37]1840-0.1a, b
19Thymol12901290 [37]21802164 [38]0.5a, b, c
20trans-Carvyl acetate 13311342 [37]-1727 [38]0.1a, b
21Piperitenone 13431343 [37]19291909 [38]1.7a, b
22α-Copaene 13821376 [37]15011491 [38]0.1a, b
23β-Bourbonene13921376 [37]15301523 [38]2.6a, b
24β-Elemene13941390 [37]15981591 [38]1.6a, b
25β-Ylangene14271421 [39]15851589 [39]0.5a, b
26trans-β-Caryophyllene14301427 [39]16091599 [38]0.4a, b, c
27β-Copaene 14391432 [39]15851580 [38]0.5a, b
28trans-β-Farnesene14541456 [37]16691664 [38]1.4a, b
29Alloaromadendrene14711460 [37]16581650 [39]0.7a, b
30Germacrene D 14931481 [38]17251708 [38]11.8a, b, c
31Bicyclogermacrene 15051500 [37]17481735 [38]0.7a, b
32δ-Cadinene 15241523 [37]17621756 [38]0.4a, b
33trans-α-Bisabolene15441544 [39]17751777 [39]0.2a, b
Identification criteria: a Tentative identification based on mass spectra (MS, EI, 70 eV, match > 90%); b Tentative identification based on LRI, determined on DB-WAX and DB-5MS columns ([37] Adams, 2007; [38] Babushok et al., 2011; [39] NIST 2017); c Confirmatory identification based on mass spectra and LRI, using standard substances. * Exp: Experimental. ** Lit: Literature.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Bonilla-Carvajal, K.; Stashenko, E.E.; Moreno-Castellanos, N. Essential Oil of Carvone Chemotype Lippia alba (Verbenaceae) Regulates Lipid Mobilization and Adipogenesis in Adipocytes. Curr. Issues Mol. Biol. 2022, 44, 5741-5755. https://doi.org/10.3390/cimb44110389

AMA Style

Bonilla-Carvajal K, Stashenko EE, Moreno-Castellanos N. Essential Oil of Carvone Chemotype Lippia alba (Verbenaceae) Regulates Lipid Mobilization and Adipogenesis in Adipocytes. Current Issues in Molecular Biology. 2022; 44(11):5741-5755. https://doi.org/10.3390/cimb44110389

Chicago/Turabian Style

Bonilla-Carvajal, Katherin, Elena E. Stashenko, and Natalia Moreno-Castellanos. 2022. "Essential Oil of Carvone Chemotype Lippia alba (Verbenaceae) Regulates Lipid Mobilization and Adipogenesis in Adipocytes" Current Issues in Molecular Biology 44, no. 11: 5741-5755. https://doi.org/10.3390/cimb44110389

Article Metrics

Back to TopTop