Isolated Systolic Blood Pressure and Red-Complex Bacteria—A Risk for Generalized Periodontitis and Chronic Kidney Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Demographic Variables
2.2. Periodontal Parameters
2.3. Renal Parameters
2.4. Assessment of Blood Pressure
2.5. Assessment of Potential Confounders
2.6. Red-Complex Bacteria (RCB)
PCR Procedure for the Identification of Red-Complex Bacteria
2.7. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Rivas-Tumanyan, S.; Campos, M.; Zevallos, J.C.; Joshipura, K.J. Periodontal Disease, Hypertension, and Blood Pressure among Older Adults in Puerto Rico. J. Periodontol. 2013, 84, 203–211. [Google Scholar] [CrossRef]
- Rodriguez-Iturbe, B.; Pons, H.; Quiroz, Y.; Johnson, R.J. The Immunological Basis of Hypertension. Am. J. Hypertens. 2014, 27, 1327–1337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gordon, J.H.; LaMonte, M.J.; Genco, R.J.; Zhao, J.; Cimato, T.R.; Hovey, K.M.; Wactawski-Wende, J. Association of clinical measures of periodontal disease with blood pressure and hypertension among postmenopausal women. J. Periodontol. 2018, 89, 1193–1202. [Google Scholar] [CrossRef]
- Roger, V.L.; Go, A.S.; Lloyd-Jones, D.M.; Benjamin, E.J.; Berry, J.D.; Borden, W.B.; Bravata, D.M.; Dai, S.; Ford, E.S.; Fox, C.S.; et al. Heart Disease and Stroke Statistics—2012 Update. Circulation 2012, 125, e2–e220. [Google Scholar] [CrossRef]
- Mancia, G.; Fagard, R.; Narkiewicz, K.; Redón, J.; Zanchetti, A.; Böhm, M.; Christiaens, T.; Cífková, R.; De Backer, G.; Dominiczak, A.; et al. 2013 ESH/ESC Guidelines for the management of arterial hypertension. J. Hypertens. 2013, 31, 1281–1357. [Google Scholar] [CrossRef] [Green Version]
- Rosamond, W.; Flegal, K.; Friday, G.; Furie, K.; Go, A.; Greenlund, K.; Haase, N.; Ho, M.; Howard, V.; Kissela, B.; et al. Heart Disease and Stroke Statistics—2007 Update. Circulation 2007, 115, e69–e171. [Google Scholar] [CrossRef] [PubMed]
- Wahid, A.; Chaudhry, S.; Ehsan, A.; Butt, S.; Kahn, A.A. Bidirectional Relationship between Chronic Kidney Disease & Periodontal Disease: A Review. Pak. J. Med. Sci. 2012, 29, 211. [Google Scholar] [CrossRef]
- Baioni, C.S.; de Souza, C.M.; Braosi, A.P.R.; Luczyszyn, S.M.; da Silva, M.A.D.; Igncio, S.A.; Machado, M.N.; Martins, W.D.B.; Riella, M.C.; Pecoits-Filho, R.; et al. Analysis of the association of polymorphism in the osteoprotegerin gene with susceptibility to chronic kidney disease and periodontitis. J. Periodontal Res. 2008, 43, 578–584. [Google Scholar] [CrossRef] [PubMed]
- Hamrahian, S.M.; Falkner, B. Hypertension in Chronic Kidney Disease. Adv. Exp. Med. Biol. 2017, 956, 307–325. [Google Scholar] [CrossRef]
- Sanz, M.; del Castillo, A.M.; Jepsen, S.; Juanatey, J.R.G.; D’Aiuto, F.; Bouchard, P.; Chapple, I.; Dietrich, T.; Gotsman, I.; Graziani, F.; et al. Periodontitis and cardiovascular diseases: Consensus report. J. Clin. Periodontol. 2020, 47, 268–288. [Google Scholar] [CrossRef]
- Contaldo, M.; Itro, A.; Lajolo, C.; Gioco, G.; Inchingolo, F.; Serpico, R. Overview on Osteoporosis, Periodontitis and Oral Dysbiosis: The Emerging Role of Oral Microbiota. Appl. Sci. 2020, 10, 6000. [Google Scholar] [CrossRef]
- Tsakos, G.; Sabbah, W.; Hingorani, A.D.; Netuveli, G.; Donos, N.; Watt, R.G.; D’Aiuto, F. Is periodontal inflammation associated with raised blood pressure? Evidence from a National US survey. J. Hypertens. 2010, 28, 2386–2393. [Google Scholar] [CrossRef] [PubMed]
- Franek, E.; Napora, M.; Blach, A.; Budlewski, T.; Gozdowski, D.; Jedynasty, K.; Krajewski, J.; Gorska, R. Blood pressure and left ventricular mass in subjects with type 2 diabetes and gingivitis or chronic periodontitis. J. Clin. Periodontol. 2010, 37, 875–880. [Google Scholar] [CrossRef]
- Levey, A.S.; Stevens, L.A.; Schmid, C.H.; Zhang, Y.L.; Castro, A.F., III; Feldman, H.I.; Kusek, J.W.; Eggers, P.; Van Lente, F.; Greene, T.; et al. A New Equation to Estimate Glomerular Filtration Rate. Ann. Intern. Med. 2009, 150, 604–612. [Google Scholar] [CrossRef] [PubMed]
- Löe, H.; Silness, J. Periodontal Disease in Pregnancy I. Prevalence and Severity. Acta Odontol. Scand. 1963, 21, 533–551. [Google Scholar] [CrossRef] [PubMed]
- Silness, J.; Löe, H. Periodontal Disease in Pregnancy II. Correlation between Oral Hygiene and Periodontal Condition. Acta Odontol. Scand. 1964, 22, 121–135. [Google Scholar] [CrossRef]
- Armitage, G.C. Development of a Classification System for Periodontal Diseases and Conditions. Ann. Periodontol. 1999, 4, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Ahn, Y.-B.; Shin, M.-S.; Byun, J.-S.; Kim, H.-D. The association of hypertension with periodontitis is highlighted in female adults: Results from the Fourth Korea National Health and Nutrition Examination Survey. J. Clin. Periodontol. 2015, 42, 998–1005. [Google Scholar] [CrossRef]
- Chobanian, A.V. Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. JAMA 2003, 289, 2560. [Google Scholar] [CrossRef] [PubMed]
- Tsioufis, C.; Kasiakogias, A.; Thomopoulos, C.; Stefanadis, C. Periodontitis and blood pressure: The concept of dental hypertension. Atherosclerosis 2011, 219, 1–9. [Google Scholar] [CrossRef]
- Sharma, P.; Dietrich, T.; Ferro, C.J.; Cockwell, P.; Chapple, I.L.C. Association between periodontitis and mortality in stages 3–5 chronic kidney disease: NHANES III and linked mortality study. J. Clin. Periodontol. 2016, 43, 104–113. [Google Scholar] [CrossRef] [Green Version]
- Lertpimonchai, A.; Rattanasiri, S.; Tamsailom, S.; Champaiboon, C.; Ingsathit, A.; Kitiyakara, C.; Limpianunchai, A.; Attia, J.; Sritara, P.; Thakkinstian, A. Periodontitis as the risk factor of chronic kidney disease: Mediation analysis. J. Clin. Periodontol. 2019, 46, 631–639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Romandini, M.; Laforí, A.; Romandini, P.; Baima, G.; Cordaro, M. Periodontitis and platelet count: A new potential link with cardiovascular and other systemic inflammatory diseases. J. Clin. Periodontol. 2018, 45, 1299–1310. [Google Scholar] [CrossRef] [PubMed]
- Grubbs, V.; Vittinghoff, E.; Beck, J.D.; Kshirsagar, A.V.; Wang, W.; Griswold, M.E.; Powe, N.R.N.R.; Correa, A.; Young, B. Association Between Periodontal Disease and Kidney Function Decline in African Americans: The Jackson Heart Study. J. Periodontol. 2015, 86, 1126–1132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caúla, A.L.; Lira-Junior, R.; Tinoco, E.M.B.; Fischer, R.G. Serum creatinine and alkaline phosphatase levels are associated with severe chronic periodontitis. J. Periodontal. Res. 2015, 50, 793–797. [Google Scholar] [CrossRef]
- Messier, M.-D.; Emde, K.; Stern, L.; Radhakrishnan, J.; Vernocchi, L.; Cheng, B.; Angelopoulos, C.; Papapanou, P.N. Radiographic Periodontal Bone Loss in Chronic Kidney Disease. J. Periodontol. 2012, 83, 602–611. [Google Scholar] [CrossRef] [PubMed]
- Iwasaki, M.; Taylor, G.W.; Sato, M.; Minagawa, K.; Ansai, T.; Yoshihara, A. Effect of chronic kidney disease on progression of clinical attachment loss in older adults: A 4-year cohort study. J. Periodontol. 2019, 90, 826–833. [Google Scholar] [CrossRef] [PubMed]
- Shimazaki, Y.; Kushiyama, M.; Murakami, M.; Yamashita, Y. Relationship between Normal Serum Creatinine Concentration and Periodontal Disease in Japanese Middle-Aged Males. J. Periodontol. 2013, 84, 94–99. [Google Scholar] [CrossRef] [PubMed]
- Graziani, F.; Cei, S.; La Ferla, F.; Vano, M.; Gabriele, M.; Tonetti, M. Effects of non-surgical periodontal therapy on the glomerular filtration rate of the kidney: An exploratory trial. J. Clin. Periodontol. 2010, 37, 638–643. [Google Scholar] [CrossRef]
- Davidovich, E.; Schwarz, Z.; Davidovitch, M.; Eidelman, E.; Bimstein, E. Oral findings and periodontal status in children, adolescents and young adults suffering from renal failure. J. Clin. Periodontol. 2005, 32, 1076–1082. [Google Scholar] [CrossRef]
- Kshirsagar, A.V.; Craig, R.G.; Moss, K.L.; Beck, J.D.; Offenbacher, S.; Kotanko, P.; Klemmer, P.J.; Yoshino, M.; Levin, N.W.; Yip, J.K.; et al. Periodontal disease adversely affects the survival of patients with end-stage renal disease. Kidney Int. 2009, 75, 746–751. [Google Scholar] [CrossRef] [Green Version]
- Yamori, M.; Njelekela, M.; Mtabaji, J.; Yamori, Y.; Bessho, K. Hypertension, Periodontal Disease, and Potassium Intake in Nonsmoking, Nondrinker African Women on No Medication. Int. J. Hypertens. 2011, 2011, 695719. [Google Scholar] [CrossRef] [Green Version]
- Ganibegović, M. Dental radiographic changes in chronic renal disease. Med. Arh. 2000, 54, 115–118. [Google Scholar]
- Vidal, F.; Figueredo, C.; Cordovil, I.; Fischer, R. Higher prevalence of periodontitis in patients with refractory arterial hypertension: A case-control study. Oral Dis. 2011, 17, 560–563. [Google Scholar] [CrossRef] [PubMed]
- Desvarieux, M.; Demmer, R.; Jacobs, D.R., Jr.; Rundek, T.; Boden-Albala, B.; Sacco, R.L.; Papapanou, P.N. Periodontal bacteria and hypertension: The oral infections and vascular disease epidemiology study (INVEST). J. Hypertens. 2010, 28, 1413–1421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manjunath, G.; Tighiouart, H.; Coresh, J.; Macleod, B.; Salem, D.N.; Griffith, J.L.; Levey, A.S.; Sarnak, M.J. Level of kidney function as a risk factor for cardiovascular outcomes in the elderly. Kidney Int. 2003, 63, 1121–1129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.-P.; Chiang, C.-K.; Peng, Y.-S.; Hsu, S.-P.; Lin, C.-Y.; Lai, C.-F.; Hung, K.-Y. Relationship Between Periodontal Disease and Mortality in Patients Treated with Maintenance Hemodialysis. Am. J. Kidney Dis. 2011, 57, 276–282. [Google Scholar] [CrossRef] [PubMed]
- Yoshihara, A.; Deguchi, T.; Hanada, N.; Miyazaki, H. Renal Function and Periodontal Disease in Elderly Japanese. J. Periodontol. 2007, 78, 1241–1248. [Google Scholar] [CrossRef] [PubMed]
- Vieira, C.L.; Cury, P.R.; Miname, M.H.; Martinez, L.R.; Bortolotto, L.A.; Giuliano, I.B.; Santos, R.D.; Caramelli, B. Severe Periodontitis Is Associated with Diastolic Blood Pressure Elevation in Individuals with Heterozygous Familial Hypercholesterolemia: A Pilot Study. J. Periodontol. 2011, 82, 683–688. [Google Scholar] [CrossRef]
- Fisher, M.A.; Taylor, G.W.; Papapanou, P.N.; Rahman, M.; Debanne, S.M. Clinical and Serologic Markers of Periodontal Infection and Chronic Kidney Disease. J. Periodontol. 2008, 79, 1670–1678. [Google Scholar] [CrossRef]
- Holmlund, A.; Holm, G.; Lind, L. Severity of Periodontal Disease and Number of Remaining Teeth Are Related to the Prevalence of Myocardial Infarction and Hypertension in a Study Based on 4254 Subjects. J. Periodontol. 2006, 77, 1173–1178. [Google Scholar] [CrossRef]
- Fisher, M.A.; Taylor, G.W. A Prediction Model for Chronic Kidney Disease Includes Periodontal Disease. J. Periodontol. 2009, 80, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Morita, T.; Yamazaki, Y.; Mita, A.; Takada, K.; Seto, M.; Nishinoue, N.; Sasaki, Y.; Motohashi, M.; Maeno, M. A Cohort Study on the Association between Periodontal Disease and the Development of Metabolic Syndrome. J. Periodontol. 2010, 81, 512–519. [Google Scholar] [CrossRef]
- Savoia, C.; Schiffrin, E.L. Inflammation in hypertension. Curr. Opin. Intern. Med. 2006, 5, 245–251. [Google Scholar] [CrossRef] [PubMed]
- Scannapieco, F.A.; Panesar, M. Periodontitis and Chronic Kidney Disease. J. Periodontol. 2008, 79, 1617–1619. [Google Scholar] [CrossRef] [PubMed]
- Higashi, Y.; Goto, C.; Jitsuiki, D.; Umemura, T.; Nishioka, K.; Hidaka, T.; Takemoto, H.; Nakamura, S.; Soga, J.; Chayama, K.; et al. Periodontal Infection Is Associated with Endothelial Dysfunction in Healthy Subjects and Hypertensive Patients. Hypertension 2008, 51, 446–453. [Google Scholar] [CrossRef] [Green Version]
- Morita, T.; Ogawa, Y.; Takada, K.; Nishinoue, N.; Sasaki, Y.; Motohashi, M.; Maeno, M. Association Between Periodontal Disease and Metabolic Syndrome. J. Public Health Dent. 2009, 69, 248–253. [Google Scholar] [CrossRef]
- Bonato, C.F.; Do-Amaral, C.C.F.; Belini, L.; Salzedas, L.M.P.; Oliveira, S.H.P. Hypertension favors the inflammatory process in rats with experimentally induced periodontitis. J. Periodontal. Res. 2012, 47, 783–792. [Google Scholar] [CrossRef]
- Han, D.-H.; Kim, M.-S.; Shin, H.-S.; Park, K.P.; Kim, H.-D. Association between Periodontitis and Salivary Nitric Oxide Metabolites Among Community Elderly Koreans. J. Periodontol. 2013, 84, 776–784. [Google Scholar] [CrossRef] [PubMed]

| Bacteria | Primer Sequences |
|---|---|
| Tf (Forward primer) | GCGTATGTAACCTGCCCGCA |
| Tf (Reverse primer) | TGCTTCAGTGTCAGTTATACC |
| Pg (Forward primer) | AGGCAGCTTGCCATACTGC |
| Pg (Reverse primer) | ACTGTTAGCAACTACCGATGT |
| Td (Forward primer) | TAATACCGAATGTGCTCATTTACAT |
| Td (Reverse primer) | TCAAAGAAGCATTCCCTCTTCTTCTTA |
| Parameters | C | GP | CKD | CKD + GP | p-Value |
|---|---|---|---|---|---|
| N | 30 | 30 | 30 | 30 | |
| Mean Age (years) | 37.63 ± 10.26 | 54.03 ± 9.10 | 59.27 ± 10.90 | 61.47 ± 10.99 | 0.0001 * |
| Age < 50 years | 22 | 9 | 5 | 4 | 0.001 * |
| Age > 50 years | 8 | 21 | 25 | 26 | 0.001 * |
| Male | 14 | 13 | 17 | 19 | 0.39 |
| Female | 16 | 17 | 13 | 11 | 0.39 |
| BMI | 25.70 ± 3.48 | 26.39 ± 4.39 | 25.81 ± 3.79 | 26.48 ± 4.81 | 0.846 |
| Obesity (kg) | 2 | 6 | 2 | 5 | 0.274 |
| Parameters | C | GP | CKD | CKD + GP | p-Value |
|---|---|---|---|---|---|
| N | 30 | 30 | 30 | 30 | |
| Teeth Present | 27 ± 1.48 | 25.53 ± 3.36 | 25.73 ± 3.03 | 25.37 ± 4.06 | 0.173 |
| Plaque Index | 0.80 ± 0.29 | 1.79 ± 0.22 | 0.88 ± 0.29 | 2.27 ± 0.23 | 0.001 * |
| Gingival Index | 0.91 ± 0.34 | 1.93 ± 0.35 | 1.05 ± 0.30 | 2.42 ± 0.18 | 0.001 * |
| Mean PPD (mm) | 1.33 ± 0.17 | 2.77 ± 0.27 | 1.29 ± 0.09 | 3.18 ± 0.24 | 0.001 * |
| % of sites with Pockets | 0 | 12.04 ± 9.29 | 0 | 21.87 ± 7.49 | 0.001 * |
| Mean CAL (mm) | 0 | 0.72 ± 0.26 | 0 | 1.14 ± 0.48 | 0.002 * |
| Parameters | C | GP | CKD | CKD + GP | p-Value |
|---|---|---|---|---|---|
| N | 30 | 30 | 30 | 30 | |
| CREATININE (mg/dl) | 0.80 ± 0.14 | 0.72 ± 0.11 | 1.21 ± 0.43 | 1.08 ± 0.19 | 0.001 * |
| eGFR (mL/min/m2) | 107.67 ± 14.81 | 101 ± 7.10 | 64.77 ± 18.94 | 68.43 ± 12.45 | 0.001 * |
| DIABETES | 0 | 9 | 7 | 20 | 0.001 * |
| Parameters | C | GP | CKD | CKD + GP | p-Value |
|---|---|---|---|---|---|
| N | 30 | 30 | 30 | 30 | |
| SBP mmHg | 113.93 ± 8.48 | 125.27 ± 19.80 | 130.73 ± 14.31 | 132.2 ± 21.80 | 0.0001 * |
| Normal Bood Pressure mmHg | 19 | 9 | 5 | 4 | 0.0001 * |
| HTN (Prehypertension) 110–120 mmHg | 11 | 10 | 10 | 16 | 0.001 * |
| HTN (STAGE 1) 120–140 mmHg | 0 | 6 | 11 | 4 | 0.002 * |
| HTN (Stage 2) >140 mmHg | 0 | 5 | 4 | 6 | 0.003 * |
| Variable | C | GP | CKD | CKD + GP | p-Value |
|---|---|---|---|---|---|
| N | 30 | 30 | 30 | 30 | |
| Pg | 29.77 + 1.20 | 25.99 + 2.09 | 27 + 1.54 | 24.33 + 2.39 | 0.001 * |
| Td | 28.58 + 1.28 | 26.1 + 1.67 | 27.10 + 1.72 | 25.94 + 1.01 | 0.0001 * |
| Tf | 31.33 + 1.27 | 29.52 + 2.46 | 29.30 + 1.60 | 27.90 + 2.02 | 0.002 * |
| Correlations | Systolic Blood Pressure (mm Hg) | p-Value |
|---|---|---|
| Pearson Correlation | ||
| Age In Completed Years | 0.472 | 0.002 ** |
| Body Mass Index (BMI) | 0.14 | 0.13 |
| Number Of Teeth Missing | 0.481 | 0.00 ** |
| Creatinine Value—mg/dl | 0.256 | 0.01 ** |
| Estimated Glomerular Filtration Rate—Value (CKD-Epi 2009 Equation)—(mL/min/m2) | −0.369 | 0.001 ** |
| Plaque Index Score | 0.201 | 0.03 * |
| Gingival Index Score | 0.10 | 0.26 |
| Mean Probing Pocket Depth—mm | 0.17 | 0.07 |
| Mean Clinical Attachment Loss—mm | 0.269 | 0.001 ** |
| Porphyromonas gingivalis CT Value | Treponema denticola CT Value | Tannerella forsythia CT Value | ||||
|---|---|---|---|---|---|---|
| Pearson Correlation | p-Value | Pearson Correlation | p-Value | Pearson Correlation | p-Value | |
| Plaque index (PI) | −0.616 | 0.00 ** | −0.455 | 0.00 ** | −0.433 | 0.001 ** |
| Gingival index (GI) | −0.571 | 0.00 ** | −0.467 | 0.00 ** | −0.432 | 0.002 ** |
| Mean probing pocket depth (PPD) mm | −0.567 | 0.00 ** | −0.473 | 0.00 ** | −0.396 | 0.003 ** |
| Mean clinical attachment loss (CAL)—mm | −0.504 | 0.00 ** | −0.407 | 0.00 ** | −0.361 | 0.001 ** |
| Number of teeth present | 0.226 | 0.013 * | 0.049 | 0.594 | 0.11 | 0.23 |
| eGFR (CKD-EPI 2009 equation)—(mL/min/m2) | 0.479 | 0.00 ** | 0.271 | 0.003 ** | 0.473 | 0.001 ** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mahendra, J.; Palathingal, P.; Mahendra, L.; Muralidharan, J.; Alzahrani, K.J.; Sayed, M.; Mugri, M.H.; Almagbol, M.; Varadarajan, S.; Balaji, T.M.; et al. Isolated Systolic Blood Pressure and Red-Complex Bacteria—A Risk for Generalized Periodontitis and Chronic Kidney Disease. Microorganisms 2022, 10, 50. https://doi.org/10.3390/microorganisms10010050
Mahendra J, Palathingal P, Mahendra L, Muralidharan J, Alzahrani KJ, Sayed M, Mugri MH, Almagbol M, Varadarajan S, Balaji TM, et al. Isolated Systolic Blood Pressure and Red-Complex Bacteria—A Risk for Generalized Periodontitis and Chronic Kidney Disease. Microorganisms. 2022; 10(1):50. https://doi.org/10.3390/microorganisms10010050
Chicago/Turabian StyleMahendra, Jaideep, Plato Palathingal, Little Mahendra, Janani Muralidharan, Khalid J. Alzahrani, Mohammed Sayed, Maryam H. Mugri, Mohammad Almagbol, Saranya Varadarajan, Thodur Madapusi Balaji, and et al. 2022. "Isolated Systolic Blood Pressure and Red-Complex Bacteria—A Risk for Generalized Periodontitis and Chronic Kidney Disease" Microorganisms 10, no. 1: 50. https://doi.org/10.3390/microorganisms10010050
APA StyleMahendra, J., Palathingal, P., Mahendra, L., Muralidharan, J., Alzahrani, K. J., Sayed, M., Mugri, M. H., Almagbol, M., Varadarajan, S., Balaji, T. M., Bhandi, S., Srinivasan, S., Raj, A. T., & Patil, S. (2022). Isolated Systolic Blood Pressure and Red-Complex Bacteria—A Risk for Generalized Periodontitis and Chronic Kidney Disease. Microorganisms, 10(1), 50. https://doi.org/10.3390/microorganisms10010050

