Next Article in Journal
The Advances in Novel Delivery Strategies for Hirudin Against Cardiovascular Diseases
Previous Article in Journal
Antitumor Activity of the ACC Inhibitor Firsocostat in Breast Cancer Cell Lines: A Proof-of-Concept In Vitro Study
Previous Article in Special Issue
Nasal Administration of Durvillaea antarctica Fucoidan Inhibits Lung Cancer Growth in Mice Through Immune Activation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceuticals
Volume 19
Issue 2
10.3390/ph19020202
pharmaceuticals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Sulfated Polysaccharide-Rich Fractions from Spirulina Platensis (SPPs) Exert Multi-Target Anticancer Activity in Non-Small Cell Lung Cancer (NSCLC) Cells

by
Beatrice Polini
1,*,
Matteo Banti
2,
Anna Mazzierli
1,
Alessandro Corti
3,
Paola Nieri
2,
Clementina Manera
2 and
Grazia Chiellini
1
1
Department of Pathology, University of Pisa, 56126 Pisa, Italy
2
Department of Pharmacy, University of Pisa, 56126 Pisa, Italy
3
Department of Translational Research NTMS, University of Pisa, 56126 Pisa, Italy
*
Author to whom correspondence should be addressed.
Pharmaceuticals 2026, 19(2), 202; https://doi.org/10.3390/ph19020202
Submission received: 22 December 2025 / Revised: 18 January 2026 / Accepted: 21 January 2026 / Published: 24 January 2026
(This article belongs to the Special Issue Therapeutic Potential of Natural Extracts in Cancer Prevention and Treatment)
Browse Figures
Versions Notes

Abstract

Background/Objectives: Sulfated polysaccharides from Spirulina platensis have shown various promising biological activities, but their anticancer effects in lung cancer models remain poorly characterized. In this study, sulfated polysaccharide-rich fractions (SPPs) were tested on A549 non-small cell lung cancer (NSCLC) cells to evaluate their cytotoxic, oxidative, and immunomodulatory activity. Methods: The potential of SPPs to interfere with A549 cell viability, to modulate intracellular reactive oxygen species (ROS) levels, to produce pro-inflammatory effects, and to induce apoptosis was evaluated. Co-administration experiments were also performed using Gefitinib, a drug commonly used in NSCLC therapy. Non-cancerous human bronchial epithelial cells (16HBE) were included to assess the ability of SPPs to selectively target tumoral cells. Results: Our findings show that SPPs significantly reduced A549 cell viability in a concentration-dependent manner and increased ROS levels. This effect was associated with apoptotic DNA fragmentation and modulation of apoptosis-related genes, including upregulation of BAX and CASP-9, and downregulation of BCL-2, MTOR, and BIRC5. SPPs also induced a controlled pro-inflammatory response by increasing ACE2, NF-κB1, and CCL2 expression while reducing COX-2 levels. In co-administration experiments with Gefitinib, a cancer drug used to treat NSCLC, enhanced cytotoxic and pro-apoptotic effects were observed. Importantly, at active concentrations (150–250 µg/mL) SPPs were not found to produce cytotoxicity or apoptosis in 16HBE cells. Conclusions: Overall, these findings suggest that SPPs may selectively target NSCLC cells by promoting redox imbalance, apoptosis, and immune response, without affecting healthy cells, supporting their potential as natural adjuvants in lung cancer treatment.

Graphical Abstract

1. Introduction

Lung cancer remains one of the leading causes of cancer-related mortality worldwide, with non-small cell lung cancer (NSCLC) accounting for approximately 85% of all cases. Despite recent advances in targeted therapies and immunotherapy, clinical outcomes are limited by resistance mechanisms, tumor heterogeneity, and toxicity to normal tissues [1]. Therefore, novel compounds able to target tumor cells and reduce adverse effects are one of the main challenges in cancer research.
Natural products represent a valuable source of bioactive compounds with anticancer potential. In this context, increasing interest has been focused on compounds with pleiotropic activity against cancer cells, capable of interfering simultaneously with multiple tumor-promoting pathways, such as redox imbalance, inflammation, and apoptosis [2,3]. In particular, these bioactive agents often exert their effects by disrupting redox homeostasis, impairing mitochondrial function, activating apoptotic signaling, and modulating immune responses. Through the cooperation of all these pathways, natural compounds can counteract tumor growth and improve therapeutic outcomes [2,4,5].
Among natural sources of multifunctional biomolecules, great interest has been attracted by Spirulina platensis, a filamentous cyanobacterium widely recognized for its nutritional and therapeutic properties. Commonly used as a dietary supplement, Spirulina platensis is particularly rich in proteins, polyunsaturated fatty acids, pigments such as phycocyanin, and sulfated polysaccharides [6,7]. A growing body of evidence highlights the diverse biological activities of its polysaccharide fractions, which include antioxidant, anti-inflammatory, immunomodulatory, antiviral, and antitumor effects [8,9,10,11,12].
Moreover, various in vitro and in vivo studies have shown that extracts or purified components from Spirulina platensis can inhibit cancer cell proliferation, induce apoptosis, suppress angiogenesis, and modulate the immune response. These effects have been described in different cancer models, including hepatocellular carcinoma, breast cancer, colon cancer, and leukemia [13,14,15,16,17,18,19]. These antitumor effects are frequently associated with mitochondrial dysfunction, intracellular ROS accumulation, and modulation of pro- and anti-inflammatory cytokines [7,20]. Clinical trials have also explored systemic effects and safety of Spirulina platensis supplementation in humans, providing a translational context for the in vitro findings [21].
Among algal polysaccharides with reported anticancer activity, fucoidan and laminarin, mainly derived from brown algae, are among the most extensively studied. Fucoidan is characterized by a high degree of sulfation and a fucose-rich backbone, features that have been closely associated with its immunomodulatory, pro-apoptotic, and anti-angiogenic properties [22,23]. Laminarin, in contrast, is a β-glucan with a lower degree of sulfation and generally exhibits weaker direct cytotoxic effects while retaining immunomodulatory activity [24,25].
Within this broader framework, sulfated polysaccharides from Spirulina platensis represent a distinct class of algal biomolecules. Although their degree of sulfation is generally lower than that reported for fucoidan [26], Spirulina-derived polysaccharides display a heterogeneous composition and have been shown to exert significant biological activity. Structural parameters, such as sulfation degree, molecular weight, and monosaccharide composition, are known to critically influence bioactivity, suggesting that Spirulina-derived sulfated polysaccharides may engage partially in overlapping but distinct molecular mechanisms compared to other algal polysaccharides.
Despite these promising findings, the mechanisms underlying the anticancer properties of Spirulina platensis, especially in the context of lung cancer, are still incompletely understood, and the body of research in this area remains limited. Further studies are needed to identify specific Spirulina platensis fractions, determine their bioactive components, and elucidate how they interact with cellular pathways involved in cancer development and progression.
In this study, we investigated the anticancer potential of a previously reported sulfated polysaccharide-rich fraction isolated from Spirulina platensis (SPPs) [11], focusing on its ability to modulate oxidative stress, inflammation, and mitochondria-dependent apoptosis in NSCLC cells.

2. Results

2.1. SPPs Inhibit A549 Cancer Cell Proliferation

To evaluate the antiproliferative activity of the water-soluble polysaccharide extract derived from Spirulina platensis, SPPs [11], A549 human lung cancer cells were treated with increasing concentrations of SPPs (0–400 μg/mL) for 24 h.
As shown in Figure 1, SPPs exhibited a significant and dose-dependent inhibitory effect on A549 cell proliferation starting from the dosage of 200 µg/mL. The half-maximal inhibitory concentration (IC50) of SPPs was estimated to be approximately 250 µg/mL.

2.2. SPPs Induce a Pro-Inflammatory and Immune-Modulatory Response in A549 Cancer Cells

Natural polysaccharides are recognized for their ability to exert antitumor effects, a significant part of which is mediated through the modulation of immune responses, particularly by inducing pro-inflammatory cytokines [27,28]. To explore the potential immunomodulatory activity of SPPs, we first assessed their ability to modulate cytokine release in A549 cells.
SPPs were initially tested at the highest concentration that did not compromise cell viability (150 µg/mL; Figure 2A–C). At this concentration, SPPs were observed to induce a robust pro-inflammatory response, significantly enhancing the release of TNF-α, IL-6, and IL-21 in A549 cells (Figure 2A–C).
When SPPs were evaluated at their IC50 concentration (250 µg/mL), an increased release of all cytokines was observed (Figure 2A–C), with TNF-α and IL-21 levels significantly higher than those observed when using SPPs at the highest non-cytotoxic concentration (150 µg/mL), indicating a dose-dependent response.
To better characterize the pro-inflammatory effects of SPPs, we also evaluated cytokine release after treatment with LPS, a well-established pro-inflammatory polysaccharide. LPS was tested at two concentrations, 10 and 50 µg/mL, chosen based on the effects produced on cell viability. In particular, 10 µg/mL concentration did not produce cytotoxic effects on A549 cells, while 50 µg/mL corresponded to the IC50 for cytotoxicity in A549 cells after 24 h treatment (Supplementary Figure S1). Therefore, these concentrations of LPS were used as positive controls for comparison with the corresponding non-cytotoxic and IC50 concentrations of SPPs.
Notably, treatment of A549 cells with SPPs resulted in a more robust cytokine release response than LPS treatment (Figure 2A–C). The levels of TNF-α, IL-6, and IL-21 released after treatment with SPPs were, in fact, significantly higher than those observed after treatment with LPS. In addition, for LPS, only a minimal difference in the amount of cytokine released after treatment with the two different doses (10 and 50 µg/mL) was observed, suggesting an early saturation of its pro-inflammatory effect (Figure 2A–C).
To better understand the mechanism underlying the inflammatory response produced by SPPs treatment in A549 cells, we performed parallel experiments to analyze the expression profiles of key inflammatory and immune-relevant genes [29,30,31], such as ACE2, NF-κB, CCL2, and the enzyme COX-2, an inflammation-associated catalyst often upregulated in many solid tumors, including lung cancer [32].
As shown in Figure 3, SPPs were observed to induce significant up-regulation of ACE2, NF-κB1, and CCL2 expression, which resulted in a particularly pronounced effect when used at the highest concentration (250 µg/mL). Similar results were also obtained by testing the reference pro-inflammatory polysaccharide LPS. Notably, treatment with SPPs revealed to induce a significant downregulation of COX-2 gene expression in A549 cells, whereas treatment with LPS did not appear to lead to any relevant effect (Figure 3D).

2.3. SPPs Induce Oxidative Stress in A549 Cancer Cells by Increasing ROS Levels and Downregulating Antioxidant Gene Expression

Given the close interplay between inflammation and oxidative stress in tumor biology, we next investigated whether SPPs could also promote a pro-oxidant response in A549 cells. Therefore, intracellular ROS levels were measured following treatment with SPPs at 150 and 250 µg/mL concentrations. As shown in Figure 4A, SPPs were able to significantly increase ROS levels only when used at the highest dose tested (250 µg/mL), a dosage which, as shown above, corresponds to the IC50 for cytotoxicity in A549 cells. This result suggests that oxidative stress may at least partly contribute to the cytotoxic effect produced by SPPs in A549 cells when used at a dose of 250 µg/mL. Remarkably, ROS induction produced by SPPs at a dosage of 250 µg/mL was comparable to that observed after treatment with LPS at 50 µg/mL concentration (Figure 4A), a dose reported in the literature to be able to induce oxidative stress in A549 cells [33].
To explore in more detail the pro-oxidative response produced in A549 cells by treatment with SPPs, we focused on genes with well documented involvement in cellular antioxidant defense in NSCLC, namely NFE2L2 (encoding Nrf2) [34], HMOX1 (encoding HO-1) [35], and SOD1 [36]. Growing evidence suggests a significant link between dysregulation of Nrf2, HO-1, and SOD1 and increased malignancy, metastasis, and resistance to chemotherapy in various cancers, including NSCLC [37,38]. Therefore, targeting these pathways holds promise for therapeutic intervention in lung cancer.
Our experiments revealed that SPPs, when used at the highest dose (250 µg/mL), significantly reduced the expression of all three antioxidant genes (Figure 4B–D). In comparison, LPS treatment (10 and 50 µg/mL) displayed less pronounced transcriptional effects. Indeed, both concentrations of LPS resulted in a comparable decrease in the expression of NFE2L2, no significant effects in HMOX1 expression, and a biphasic trend in SOD1 modulation, with 10 µg/mL increasing and 50 µg/mL decreasing its expression.

2.4. SPPs Induce Apoptosis Through DNA Fragmentation and Modulation of Pro-Apoptotic Gene Expression in A549 Cancer Cells

Since increased ROS levels are known to activate redox-dependent apoptosis pathways [39], the potential of SPPs to initiate apoptosis through an oxidative mechanism was evaluated.
Apoptosis was first assessed by measuring internucleosomal DNA fragmentation, a hallmark of late-stage programmed cell death [40]. Apoptotic DNA fragmentation was significantly increased in cells treated with 250 µg/mL SPPs (Figure 5A), indicating the induction of a pro-apoptotic effect at this concentration. In contrast, treatment with 150 µg/mL did not affect apoptotic DNA fragmentation compared to untreated controls. Fragment levels observed after treatment with SPPs at 250 µg/mL were comparable to those induced by LPS at 50 µg/mL, used as a positive control (Figure 5A).
To explore the molecular mechanisms responsible for the observed pro-apoptotic effect, we analyzed the transcriptional expression of a panel of apoptosis-related genes. Bax, Bcl-2, and Caspase-9 were selected for their established involvement in redox-sensitive apoptotic pathways, with Bax and Caspase-9 promoting apoptosis and Bcl-2 acting as a key inhibitor [41]. In addition, mTOR and Survivin were analyzed, as both are involved in cell survival and resistance to apoptosis in cancer [42,43].
As shown in Figure 5B–F, SPPs treatment induced a concentration-dependent upregulation of BAX and CASP-9 (encoding Caspase-9), with levels comparable to those observed in LPS-treated cells. Conversely, BCL2 expression was significantly downregulated, indicating a shift toward a pro-apoptotic gene profile. A strong and dose-dependent reduction in the expression of MTOR and BIRC5 (encoding Survivin) was also observed after treatment with SPPs. For both genes, treatment with 10 and 50 µg/mL LPS also produced a similar trend.

2.5. SPPs Enhance the Sensitivity of A549 Lung Tumor Cells to Gefitinib

Based on the promising antitumor activity highlighted by our results for SPPs, we subsequently evaluated the ability of SPPs to enhance the efficacy of a conventional antitumor drug such as Gefitinib, an EGFR tyrosine kinase inhibitor widely used in NSCLC therapy [44]. As a first step, cell viability assays were performed with increasing concentrations of Gefitinib (10–100 µM). After 48 h treatment, Gefitinib was observed to induce only a modest reduction in cell viability, with detectable effects starting at 25 µM concentration and reaching a maximum decrease of approximately 20% when used at 100 µM concentration (Figure 6A). This limited sensitivity is consistent with the low levels of EGFR expression typically observed in A549 cells [45].
To establish whether treatment with SPPs can enhance the cytotoxic effect of Gefitinib in A549 cells, we performed the treatment by exposing A549 cells to increasing doses of Gefitinib (25–100 µM) in the presence of SPPs at a dosage of 150 µg/mL, a concentration that in previous assays had shown the absence of cytotoxicity after incubation for 48 h. As shown in Figure 6A, co-treatment with SPPs resulted in a significant potentiation of Gefitinib-induced cytotoxicity at all concentrations tested.
To further investigate the potential benefits of SPPs co-administration to Gefitinib, A549 cells were treated with Gefitinib alone and in combination with SPPs (150 µg/mL), and after 48 h, histone–DNA fragmentation was analyzed. As shown in Figure 6B, the single administration of SPPs at 150 µg/mL concentration did not induce apoptosis, but in co-administration experiments, the same concentration significantly enhanced Gefitinib-induced apoptotic activity. Notably, in co-treatment experiments, administration of 25 µM Gefitinib in the presence of 150 µg/mL SPPs was observed to produce a level of induction of apoptosis comparable to that produced by treatment with 100 µM Gefitinib alone.
Based on these findings, intracellular ROS levels were evaluated in A549 cells treated with SPPs, Gefitinib, or their combination. This analysis revealed that treatment with SPPs at 150 µg/mL induced a modest increase in ROS levels, whereas Gefitinib used at the highest dose (100 µM) did not significantly affect intracellular ROS production (Figure 6C). Notably, co-administration experiments resulted in a moderate increase in ROS levels compared to Gefitinib single treatment, supporting the involvement of redox-dependent mechanisms in SPPs-mediated sensitization to gefitinib (Figure 6C).

2.6. SPPs Do Not Show Cellular Toxicity in Non-Cancerous Human Bronchial Epithelial Cells (16HBE)

To gain a better understanding of SPP’s potential impact on respiratory health, we used non-cancerous human bronchial epithelial cells (16HBE) as an in vitro model of respiratory healthy tissue. Cell viability was first evaluated by exposing 16HBE cells to increasing concentrations of SPPs (100–450 µg/mL). As shown in Figure 7A, a significant reduction in viability was observed only when SPPs were used at very high concentrations (i.e., ≥400 µg/mL). Notably, at the doses effective for antitumoral activity in A549 lung tumor cells, SPPs did not significantly affect 16HBE cells’ viability.
To confirm this profile, apoptotic DNA fragmentation was also assessed in 16HBE cells. As shown in Figure 7B, no significant increase in cytoplasmic histone-associated DNA fragments was detected after treatment with 150 or 250 µg/mL SPPs, indicating that these concentrations were not able to induce apoptosis in non-malignant bronchial cells.
To further evaluate the selectivity of SPPs, co-treatment experiments with Gefitinib were extended to 16HBE cells. In this model, Gefitinib alone exhibited a dose-dependent cytotoxic effect, with significant reductions in viability observed at concentrations ≥50 µM (Figure 8).
The co-administration with SPPs (150 µg/mL) did not enhance the cytotoxic effects produced by Gefitinib in healthy human bronchial epithelial cells (16HBE), further supporting the selective anticancer profile of SPPs.

3. Discussion

The results presented in this study demonstrate that the sulfated polysaccharide-rich fraction (SPPs) extracted from Spirulina platensis exerts in vitro selective cytotoxic effects against A549 lung cancer cells, without affecting the viability of non-cancerous bronchial epithelial cells (16HBE). Our data suggest that this selective activity is associated with two main cellular responses: an early inflammatory response and a redox-dependent activation of apoptosis.
The pro-inflammatory effect of SPPs evidenced by a significant increase in the secretion of key cytokines, particularly TNF-α and IL-21, two molecules known to promote the recruitment and activation of immune effector cells, such as cytotoxic T lymphocytes and NK cells, and to contribute to antitumor immune surveillance [46,47,48,49]. IL-21 was specifically evaluated to assess whether SPPs could promote an immune-stimulatory cytokine response, instead of a non-specific cytokine related inflammatory response [48,49].
In contrast to the dose-dependent increase observed for TNF-α and IL-21, IL-6 secretion appeared to plateau between 150 and 250 µg/mL, suggesting an early and saturable cytokine response. This behavior may indicate a regulated and immunostimulatory response, supporting the interpretation of an active, inflammation-mediated antitumor mechanism rather than a passive cytokine release [50,51].
Gene expression analyses support this interpretation: SPPs up-regulated immune-related genes such as ACE2, NF-κB, and CCL2, and down-regulated COX-2, a marker often associated with persistent tumor-supporting inflammation. The simultaneous modulation of these genes suggests the involvement of a coordinated ACE2–NF-κB–CCL2 axis: ACE2, a mediator of pro-inflammatory signaling, can activate the transcription factor NF-κB, which in turn regulates the expression of CCL2, a chemokine involved in immune cell recruitment and activation [52,53,54,55,56,57,58]. Although elevated CCL2 expression has been implicated in tumor progression under chronic inflammatory conditions, moderate and transient increases in CCL2 can enhance immune surveillance by recruiting and activating effector cells, such as monocytes, dendritic cells, NK cells, and cytotoxic T cells, without sustaining a pro-tumoral microenvironment [59,60,61,62]. Notably, the observed reduction in COX-2 expression, frequently up-regulated in chronic inflammation and cancer [63], further supports the hypothesis of a transient and immunomodulatory inflammatory response.
This pro-inflammatory effect, supported by cytokine secretion and gene expression data, is consistent with an acute immunostimulatory state. In detail, this profile may promote effector cell infiltration and tumor cell recognition, features typically observed in models of immunogenic cell death, without triggering the deleterious effects commonly associated with chronic or tumor-promoting inflammation [64,65].
In parallel, SPPs promoted a marked oxidative response, characterized by a dose-dependent accumulation of ROS. It is important to specify that ROS can exert a dual role in tumor biology: at moderate levels, they promote cancer cell proliferation, angiogenesis, and survival signaling, whereas at elevated concentrations, they can induce oxidative damage, mitochondrial dysfunction, and apoptosis [66,67,68,69,70]. To better understand whether this ROS accumulation was potentially tumor-supporting or cytotoxic, we analyzed the expression of key antioxidant defense genes. Our data revealed a reduced expression of NFE2L2 (Nrf2), HMOX1 (HO-1), and SOD1, indicating that SPPs can impair the antioxidant defense system and contribute to sustained ROS accumulation and oxidative stress. Indeed, the downregulation of NFE2L2, a master regulator of redox homeostasis, could compromise the activation of downstream antioxidant enzymes, such as HO-1 and SOD1 [35,36], affecting the ability of tumor cells to restore redox balance.
In this context, it is important to consider that the redox effects of Spirulina-derived products are known to be highly dependent on extract composition and fractionation. While crude Spirulina preparations are often described as antioxidants due to the presence of pigments and low-molecular-weight antioxidant molecules, polysaccharide-rich fractions may exert distinct redox effects [6,7,9,12]. For instance, in some cancer cell models, pro-oxidant and antitumor activities have been reported for specific Spirulina-derived extracts, with ROS generation, mitochondrial dysfunction, and apoptotic signaling contributing to the observed effects [71,72].
Overall, these findings suggest that, at higher concentrations, SPPs can induce an oxidative stress sufficient to disrupt redox homeostasis and increase susceptibility to oxidative damage and apoptosis [73,74]. This is consistent with evidence showing that ROS generation is a well-established trigger of mitochondrial dysfunction and intrinsic apoptosis pathways, contributing to cancer cell death and sensitization to therapy [75,76,77,78].
In our in vitro NSCLC model, the connection between ROS accumulation and cell death was supported by the ability of SPPs treatment to induce internucleosomal DNA fragmentation and to significantly modulate the expression of apoptosis-related genes. Specifically, we observed increased expression of pro-apoptotic genes (BAX, CASP9) [79,80] and reduced expression of anti-apoptotic regulators (BCL-2, MTOR, SURVIVIN) [80,81,82]. This coherent combination of functional and transcriptional evidence is consistent with the activation of the intrinsic apoptotic pathway [83], indicating that the pro-apoptotic effects of SPPs can be redox-dependent.
Noteworthy (unlike our findings), often Spirulina-derived compounds are described as antioxidants [84,85]. The pro-oxidant effect observed for SPPs may result from its specific composition and fractionation, which could determine a lack of antioxidant cofactors present in crude extracts. In addition, cancer cells such as A549 typically exhibit elevated basal ROS levels, rendering them more susceptible to further redox imbalance. In this context, even moderate increases in ROS (mainly not counteracted by antioxidant response) can surpass the threshold for oxidative stress-induced apoptosis. The downregulation of NFE2L2, HO-1, and SOD1 observed in our model suggests that the redox regulatory machinery fails to compensate, promoting a shift toward mitochondrial dysfunction and cell death. This behavior, while apparently contrasting with previous reports on antioxidant effects of Spirulina, aligns with the concept of context-dependent redox modulation in cancer therapy.
The dual effect of SPPs that combines immune-stimulation and redox-mediated apoptosis suggests a coordinated anti-tumor mechanism that not only initiates immune signaling but promotes elimination of cancer cells through oxidative damage. Importantly, this activity was not observed in non-cancerous bronchial epithelial cells, supporting the potential selectivity of SPPs and their favorable therapeutic index. These characteristics are of particular relevance in the context of NSCLC, where resistance mechanisms and toxicity to normal tissue limit the efficacy of standard treatments.
Although the effective concentrations of SPPs observed in vitro (150–250 µg/mL) are relatively high, comparable or higher ranges are commonly reported for complex, high-molecular-weight polysaccharides in cell-based assays and in NSCLC models, including A549 cells (approximately 100–800 µg/mL), mainly due to limited cellular uptake and the absence of metabolic and immune-mediated amplification present in vivo [86,87,88,89,90,91]. Importantly, the concentrations of SPPs used in our experimental setting were found to be selectively active toward NSCLC cells, resulting in well-tolerated by non-malignant bronchial epithelial cells.
Nevertheless, it should be taken into account that 16HBE cells represent an immortalized bronchial epithelial model and may not fully recapitulate the phenotypic and functional complexity of primary human bronchial epithelium. Therefore, in future studies, it would be advisable to employ primary human bronchial epithelial cells and/or in vivo models to more comprehensively assess pulmonary safety and translational relevance of SPPs.
Furthermore, the ability of SPPs to enhance the pro-apoptotic effects of Gefitinib highlights its potential as an adjuvant therapy. Gefitinib, a tyrosine kinase inhibitor targeting EGFR, is a frontline option in NSCLC therapy; however, resistance frequently emerges, limiting its long-term efficacy [92]. Although the A549 cell line used in this study does not harbor activating EGFR mutations, resulting therefore intrinsically resistant to Gefitinib, our data show that co-treatment with SPPs significantly increases apoptotic cell death, suggesting that SPPs may sensitize resistant cells to Gefitinib. This effect appears to be mediated, at least in part, by activation of the intrinsic apoptotic pathway. Since SPPs were shown to induce redox-dependent apoptosis when used alone, it is reasonable to hypothesize that a similar mechanism may contribute to the enhanced effect observed in co-treatment. Although ROS were not directly measured in this setting, the increase in internucleosomal DNA fragmentation suggests the involvement of oxidative stress in promoting Gefitinib-induced apoptosis. In line with this hypothesis, previous studies have shown that promoting ROS accumulation can effectively overcome resistance to EGFR-targeted therapies, including Gefitinib, by reactivating apoptotic signaling pathways in NSCLC cells [93,94].
In this context, several clinical studies reported that Spirulina platensis supplementation displays a favorable safety profile and immunomodulatory effects in humans. Although these trials were not designed to assess anticancer efficacy, they may provide a translational framework that supports the therapeutic relevance of Spirulina-derived products and the in vitro findings presented in our work [21].
In conclusion, the Spirulina-derived sulfated polysaccharide-rich fraction (SPPs) exerts multi-target anticancer effects in NSCLC cells by promoting a transient immunostimulatory response and triggering oxidative stress-mediated apoptosis. These findings suggest that SPPs could represent a promising natural adjuvant in lung cancer treatment strategies, warranting further studies to define their molecular targets and in vivo efficacy.

4. Materials and Methods

4.1. SPPs: Extraction, Purification, and Proximate Composition

The extraction, purification, and proximate composition analysis of SPPs used for this work were performed following a procedure previously described [11]. Briefly, the biomass of Spirulina platensis was purchased from Spirufarm Srl (Casalbuttano ed Uniti, Cremona, Italy). The sulfated polysaccharide-rich fraction from Spirulina platensis (SPPs) was obtained by ultrasound-assisted extraction combined with hot water extraction, followed by a deproteinization and decolorization treatment [11]. The SPPs yield was 3.7%, displaying a proximate composition consistent with previously reported data: 80.5 ± 2.1% monosaccharides content, 8.0 ± 0.7% protein content, and 9.7 ± 0.9% sulphate group content [11]. IR and NMR analysis of SPPs confirmed a monosaccharide composition consisting mainly of glucose/galactose in combination with rhamnose, ribose, and fucose, present only in trace amounts [11].

4.2. Cell Culture and Reagents

A549 human lung carcinoma (ATCC® CCL-185, Manassas, VA, USA) cell line was cultured in high-glucose DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin (100 U/mL)/streptomycin (100 U/mL) (Sigma-Aldrich, Milan, Italy) at 37 °C in 5% CO2 humidified atmosphere. SV-40 immortalized human bronchial epithelial cells (16HBE) were a gift from Prof. Alessandro Celi (Department of Pathology, University of Pisa, Pisa, Italy). Cells were maintained in EMEM supplemented with 10% FBS, 1% MEM non-essential amino acid solution 100× (Sigma-Aldrich, Milan, Italy), and penicillin (100 U/mL)/streptomycin (100 U/mL) at 37 °C in 5% CO2 humidified air.
SPPs, a water-soluble polysaccharide extract from Spirulina platensis obtained by ultrasound-assisted extraction combined with hot water extraction as previously described [11], was characterized by the following composition: 80.5 ± 2.1% monosaccharides content, 8.0 ± 0.7% protein content, and 9.7 ± 0.9% sulphate group content [11]. Lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (LPS25) was purchased from Sigma-Aldrich (Milan, Italy). Gefitinib was a gift from Prof. Anna Maria Piras (Department of Pharmacy, University of Pisa, Pisa, Italy).

4.3. MTT Assay for Cell Viability

A549 cells were seeded in 96-well plates at a density of 5 × 103 cells/well in complete DMEM medium and incubated overnight at 37 °C. The following day, cells were treated with the test compounds, administered either alone or in combination, and incubated under appropriate conditions depending on the specific assay design.
Cell viability was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent. At the end of the treatments, 0.5 mg/mL MTT reagent was added to each well, and the cells were incubated for 4 h at 37 °C. After removing 85 µL from each well, 50 µL of DMSO was added to dissolve blue formazan crystals, and the cells were incubated for 10 min at 37 °C. The optical density at 540 nm was measured with an automated microplate reader (BIO-TEK, Winooski, VT, USA).

4.4. ELISA Assay

The concentrations of the pro-inflammatory cytokines interleukin (IL)-6, tumor necrosis factor-α (TNFα), and IL-21 were measured in cell culture supernatants using commercial ELISA kits: IL-6 (RAB0306) and TNFα (RAB0476) kits from Sigma-Aldrich (Milan, Italy), and IL-21 (MBS765480) kit from MyBioSource (San Diego, CA, USA), following the manufacturers’ instructions. A549 cells were treated with the SPPs or LPS, used as a positive control, for cytokine induction. After 24 h of treatment, culture media were collected and stored at −80 °C until analysis.

4.5. ROS Quantification Assay

Intracellular reactive oxygen species (ROS) production in A549 was quantified with DCFDA/H2DCFDA—Cellular ROS Assay Kit (ab113851, Abcam, Cambridge, UK), according to the manufacturer’s instructions. Briefly, the cells were seeded into a dark 96-well plate with a clean bottom at a density of 1 × 104 cells/well and incubated overnight at 37 °C. The following day, cells were treated with the test compound or positive control for 24 h. At the end of the treatment, culture media was removed, and each well was washed with 100 µL of Buffer 1X, provided by the kit. Cells were then incubated at 37 °C with DCFDA (20 μM, diluted in buffer 1x) for 30–45 min. After incubation, fluorescence was measured using a microplate reader [Synergy H1 Multimode Reader, BioTek, Winooski, VT, USA] with excitation/emission wavelengths set at 485/535 nm (end-point mode).

4.6. Gene Expression Analysis

Total RNA was isolated using the RNeasy Mini Kit (74104, Qiagen, Hilden, Germany) following the protocol provided by the manufacturer. Then, RNA Qubit fluorometer plus Qubit RNA HS Assay Kit (Thermo Fisher Scientific, Wilmington, DE, USA) was used to quantify total extracted RNA, and 1 μg of RNA was reverse transcribed into first-strand cDNA using the iScript™ gDNA Clear cDNA Synthesis Kit (Bio-Rad, Milan, Italy). The relative expression levels of target genes were quantified by real-time PCR using SYBR Green dye and the CFX Connect Real-Time PCR Detection System (Bio-Rad, Milan, Italy). The thermal cycling conditions consisted of an initial denaturation step (95 °C for 30 s), followed by 40 cycles of denaturation (95 °C for 5 s) and annealing/extension (60 °C for 15 s). Finally, a melting curve analysis was included from 65 °C to 95 °C with 0.5 °C increments every 5 s to confirm the specificity of the amplicons and detect primer dimers formation. All reactions were performed in duplicate, and GAPDH was quantified as an endogenous reference gene for each sample. The amount of mRNA was calculated by the comparative CT method.
Additionally, a negative control was included to exclude the possibility of contamination from residual genomic DNA. Primers (Table 1) were designed using Beacon Designer Software (version 8.0, Premier Biosoft International, Palo Alto, CA, USA), employing a junction primer strategy.

4.7. Statistical Analysis

Statistical analyses were performed using GraphPad Prism version 9.0 for Mac (GraphPad Software, San Diego, CA, USA), and significant differences among different treatments were calculated using ordinary one-way ANOVA followed by Dunnett’s or Tukey’s post hoc. All data are reported as mean ± SEM. Differences at p < 0.05 were considered significant.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ph19020202/s1, Figure S1: LPS reduce the viability of A549 cells. A549 cells were treated with increasing concentration of LPS ranging from 1 to 100 µg/ml for 24 h. Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one way ANOVA followed by Dunnet’s multiple comparisons test. *** p < 0.005 compared to untreated cells (CTRL).

Author Contributions

Conceptualization, G.C. and C.M.; methodology, B.P., M.B., A.M. and A.C.; software, B.P.; validation, B.P., M.B. and A.M.; formal analysis, B.P.; investigation, B.P., M.B. and A.M.; resources, G.C. and C.M.; data curation, B.P., M.B. and A.M.; writing—original draft preparation, B.P.; writing—review and editing, G.C. and C.M.; supervision, A.C., G.C., C.M. and P.N.; project administration, G.C.; funding acquisition, G.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by institutional research funds “Fondi di Ateneo” from University of Pisa of Prof.ssa G. Chiellini.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Tang, F.H.; Wong, H.Y.T.; Tsang, P.S.W.; Yau, M.; Tam, S.Y.; Law, L.; Yau, K.; Wong, J.; Farah, F.H.M.; Wong, J. Recent Advancements in Lung Cancer Research: A Narrative Review. Transl. Lung Cancer Res. 2025, 14, 975–990. [Google Scholar] [CrossRef] [PubMed]
  2. Newman, D.J.; Cragg, G.M. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J. Nat. Prod. 2020, 83, 770–803. [Google Scholar] [CrossRef]
  3. Alves, C.; Diederich, M. Marine Natural Products as Anticancer Agents. Mar. Drugs 2021, 19, 447. [Google Scholar] [CrossRef] [PubMed]
  4. Quintero-Rincón, P.; Caballero-Gallardo, K.; Olivero-Verbel, J. Natural Anticancer Agents: Prospection of Medicinal and Aromatic Plants in Modern Chemoprevention and Chemotherapy. Nat. Prod. Bioprospect. 2025, 15, 25. [Google Scholar] [CrossRef] [PubMed]
  5. Kubczak, M.; Szustka, A.; Rogalińska, M. Molecular Targets of Natural Compounds with Anti-Cancer Properties. Int. J. Mol. Sci. 2021, 22, 13659. [Google Scholar] [CrossRef]
  6. Chaiklahan, R.; Chirasuwan, N.; Triratana, P.; Loha, V.; Tia, S.; Bunnag, B. Polysaccharide Extraction from Spirulina Sp. and Its Antioxidant Capacity. Int. J. Biol. Macromol. 2013, 58, 73–78. [Google Scholar] [CrossRef]
  7. Wu, Q.; Liu, L.; Miron, A.; Klímová, B.; Wan, D.; Kuča, K. The Antioxidant, Immunomodulatory, and Anti-Inflammatory Activities of Spirulina: An Overview. Arch. Toxicol. 2016, 90, 1817–1840. [Google Scholar] [CrossRef]
  8. Wang, Q.; Liu, F.; Chen, X.; Yang, Z.; Cao, Y. Effects of the Polysaccharide SPS-3-1 Purified from Spirulina on Barrier Integrity and Proliferation of Caco-2 Cells. Int. J. Biol. Macromol. 2020, 163, 279–287. [Google Scholar] [CrossRef]
  9. Wu, X.; Liu, Z.; Liu, Y.; Yang, Y.; Shi, F.; Cheong, K.-L.; Teng, B. Immunostimulatory Effects of Polysaccharides from Spirulina Platensis In Vivo and Vitro and Their Activation Mechanism on RAW246.7 Macrophages. Mar. Drugs 2020, 18, 538. [Google Scholar] [CrossRef]
  10. Chen, Y.-H.; Chang, G.-K.; Kuo, S.-M.; Huang, S.-Y.; Hu, I.-C.; Lo, Y.-L.; Shih, S.-R. Well-Tolerated Spirulina Extract Inhibits Influenza Virus Replication and Reduces Virus-Induced Mortality. Sci. Rep. 2016, 6, 24253. [Google Scholar] [CrossRef]
  11. Banti, M.; Garcia-Gil, M.; Guidotti, L.; Di Giuseppe, G.; Rapposelli, S.; Monti, D.; Tampucci, S.; De Leo, M.; Gado, F.; Nieri, P.; et al. Characterization and Otoprotective Effects of Polysaccharides from Arthrospira Platensis. Molecules 2025, 30, 224. [Google Scholar] [CrossRef] [PubMed]
  12. Dartsch, P.C. Antioxidant Potential of Selected Spirulina Platensis Preparations. Phytother. Res. 2008, 22, 627–633. [Google Scholar] [CrossRef] [PubMed]
  13. Oh, S.-H.; Ahn, J.; Kang, D.-H.; Lee, H.-Y. The Effect of Ultrasonificated Extracts of Spirulina Maxima on the Anticancer Activity. Mar. Biotechnol. 2011, 13, 205–214. [Google Scholar] [CrossRef]
  14. Mahmoud, Y.I.; Shehata, A.M.M.; Fares, N.H.; Mahmoud, A.A. Spirulina Inhibits Hepatocellular Carcinoma through Activating P53 and Apoptosis and Suppressing Oxidative Stress and Angiogenesis. Life Sci. 2021, 265, 118827. [Google Scholar] [CrossRef]
  15. Subramaiam, H.; Chu, W.-L.; Radhakrishnan, A.K.; Chakravarthi, S.; Selvaduray, K.R.; Kok, Y.-Y. Evaluating Anticancer and Immunomodulatory Effects of Spirulina (Arthrospira) Platensis and Gamma-Tocotrienol Supplementation in a Syngeneic Mouse Model of Breast Cancer. Nutrients 2021, 13, 2320. [Google Scholar] [CrossRef] [PubMed]
  16. Hassanin, S.O.; Hegab, A.M.M.; Mekky, R.H.; Said, M.A.; Khalil, M.G.; Hamza, A.A.; Amin, A. Combining In Vitro, In Vivo, and Network Pharmacology Assays to Identify Targets and Molecular Mechanisms of Spirulina-Derived Biomolecules against Breast Cancer. Mar. Drugs 2024, 22, 328. [Google Scholar] [CrossRef]
  17. Lu, Y.; Chen, Z.; Lin, Q.; Xia, X.; Lin, Y.; Yan, J.; Huang, M.; Huang, R. Anti-Colon Cancer Effects of Spirulina Polysaccharide and Its Mechanism Based on 3D Models. Int. J. Biol. Macromol. 2023, 228, 559–569. [Google Scholar] [CrossRef]
  18. Li, B.; Gao, M.; Zhang, X.; Chu, X. Molecular Immune Mechanism of C-phycocyanin from Spirulina platensis Induces Apoptosis in HeLa Cells in Vitro. Biotechnol. Appl. Biochem. 2006, 43, 155–164. [Google Scholar] [CrossRef]
  19. Subhashini, J.; Mahipal, S.V.K.; Reddy, M.C.; Reddy, M.M.; Rachamallu, A.; Reddanna, P. Molecular Mechanisms in C-Phycocyanin Induced Apoptosis in Human Chronic Myeloid Leukemia Cell Line-K562. Biochem. Pharmacol. 2004, 68, 453–462. [Google Scholar] [CrossRef]
  20. Hirahashi, T.; Matsumoto, M.; Hazeki, K.; Saeki, Y.; Ui, M.; Seya, T. Activation of the Human Innate Immune System by Spirulina: Augmentation of Interferon Production and NK Cytotoxicity by Oral Administration of Hot Water Extract of Spirulina Platensis. Int. Immunopharmacol. 2002, 2, 423–434. [Google Scholar] [CrossRef]
  21. Karizi, S.R.; Armanmehr, F.; Azadi, H.G.; Zahroodi, H.S.; Ghalibaf, A.M.; Bazzaz, B.S.F.; Abbaspour, M.; Boskabadi, J.; Eslami, S.; Taherzadeh, Z. A Randomized, Double-Blind Placebo-Controlled Add-on Trial to Assess the Efficacy, Safety, and Anti-Atherogenic Effect of Spirulina Platensis in Patients with Inadequately Controlled Type 2 Diabetes Mellitus. Phytother. Res. 2023, 37, 1435–1448. [Google Scholar] [CrossRef] [PubMed]
  22. Fitton, J.H. Therapies from Fucoidan; Multifunctional Marine Polymers. Mar. Drugs 2011, 9, 1731–1760. [Google Scholar] [CrossRef]
  23. Zayed, A.; Al-Saedi, D.A.; Mensah, E.O.; Kanwugu, O.N.; Adadi, P.; Ulber, R. Fucoidan’s Molecular Targets: A Comprehensive Review of Its Unique and Multiple Targets Accounting for Promising Bioactivities Supported by In Silico Studies. Mar. Drugs 2023, 22, 29. [Google Scholar] [CrossRef]
  24. Prasertsan, P.; Wichienchot, S.; Doelle, H.; Kennedy, J. Optimization for Biopolymer Production by Enterobacter Cloacae WD7. Carbohydr. Polym. 2008, 71, 468–475. [Google Scholar] [CrossRef]
  25. Brown, G.D.; Gordon, S. Fungal β-Glucans and Mammalian Immunity. Immunity 2003, 19, 311–315. [Google Scholar] [CrossRef] [PubMed]
  26. Raposo, M.; De Morais, R.; De Morais, A.B. Bioactivity and Applications of Sulphated Polysaccharides from Marine Microalgae. Mar. Drugs 2013, 11, 233–252. [Google Scholar] [CrossRef]
  27. Mao, T.K.; Van De Water, J.; Gershwin, M.E. Effect of Spirulina on the Secretion of Cytokines from Peripheral Blood Mononuclear Cells. J. Med. Food 2000, 3, 135–140. [Google Scholar] [CrossRef] [PubMed]
  28. Bax, C.E.; Diaz, D.; Li, Y.; Vazquez, T.; Patel, J.; Grinnell, M.; Ravishankar, A.; Maddukuri, S.; Keyes, E.; Yan, D.; et al. Herbal Supplement Spirulina Stimulates Inflammatory Cytokine Production in Patients with Dermatomyositis in Vitro. iScience 2023, 26, 108355. [Google Scholar] [CrossRef]
  29. Ziegler, C.G.K.; Allon, S.J.; Nyquist, S.K.; Mbano, I.M.; Miao, V.N.; Tzouanas, C.N.; Cao, Y.; Yousif, A.S.; Bals, J.; Hauser, B.M.; et al. SARS-CoV-2 Receptor ACE2 Is an Interferon-Stimulated Gene in Human Airway Epithelial Cells and Is Detected in Specific Cell Subsets across Tissues. Cell 2020, 181, 1016–1035.e19. [Google Scholar] [CrossRef]
  30. Hirano, T. IL-6 in Inflammation, Autoimmunity and Cancer. Int. Immunol. 2021, 33, 127–148. [Google Scholar] [CrossRef]
  31. Karin, M. Nuclear Factor-κB in Cancer Development and Progression. Nature 2006, 441, 431–436. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, D.; Dubois, R.N. Eicosanoids and Cancer. Nat. Rev. Cancer 2010, 10, 181–193. [Google Scholar] [CrossRef]
  33. Chuang, C.-Y.; Chen, T.-L.; Cherng, Y.-G.; Tai, Y.-T.; Chen, T.-G.; Chen, R.-M. Lipopolysaccharide Induces Apoptotic Insults to Human Alveolar Epithelial A549 Cells through Reactive Oxygen Species-Mediated Activation of an Intrinsic Mitochondrion-Dependent Pathway. Arch. Toxicol. 2011, 85, 209–218. [Google Scholar] [CrossRef]
  34. Hellyer, J.A.; Padda, S.K.; Diehn, M.; Wakelee, H.A. Clinical Implications of KEAP1-NFE2L2 Mutations in NSCLC. J. Thorac. Oncol. 2021, 16, 395–403. [Google Scholar] [CrossRef]
  35. Zuo, L.; Zou, X.; Ge, J.; Hu, S.; Fang, Y.; Xu, Y.; Chen, R.; Xu, S.; Yu, G.; Zhou, X.; et al. The Nrf2-HMOX1 Pathway as a Therapeutic Target for Reversing Cisplatin Resistance in Non-Small Cell Lung Cancer via Inhibiting Ferroptosis. Cell Death Discov. 2025, 11, 287. [Google Scholar] [CrossRef]
  36. Glasauer, A.; Sena, L.A.; Diebold, L.P.; Mazar, A.P.; Chandel, N.S. Targeting SOD1 Reduces Experimental Non–Small-Cell Lung Cancer. J. Clin. Investig. 2014, 124, 117–128. [Google Scholar] [CrossRef]
  37. Sánchez-Ortega, M.; Carrera, A.C.; Garrido, A. Role of NRF2 in Lung Cancer. Cells 2021, 10, 1879. [Google Scholar] [CrossRef]
  38. Ghareghomi, S.; Moosavi-Movahedi, F.; Saso, L.; Habibi-Rezaei, M.; Khatibi, A.; Hong, J.; Moosavi-Movahedi, A.A. Modulation of Nrf2/HO-1 by Natural Compounds in Lung Cancer. Antioxidants 2023, 12, 735. [Google Scholar] [CrossRef]
  39. Circu, M.L.; Aw, T.Y. Reactive Oxygen Species, Cellular Redox Systems, and Apoptosis. Free Radic. Biol. Med. 2010, 48, 749–762. [Google Scholar] [CrossRef] [PubMed]
  40. Compton, M.M. A Biochemical Hallmark of Apoptosis: Internucleosomal Degradation of the Genome. Cancer Metastasis Rev. 1992, 11, 105–119. [Google Scholar] [CrossRef] [PubMed]
  41. Redza-Dutordoir, M.; Averill-Bates, D.A. Activation of Apoptosis Signalling Pathways by Reactive Oxygen Species. Biochim. Biophys. Acta 2016, 1863, 2977–2992. [Google Scholar] [CrossRef]
  42. Chen, L.; Xu, B.; Liu, L.; Luo, Y.; Yin, J.; Zhou, H.; Chen, W.; Shen, T.; Han, X.; Huang, S. Hydrogen Peroxide Inhibits mTOR Signaling by Activation of AMPKα Leading to Apoptosis of Neuronal Cells. Lab. Investig. 2010, 90, 762–773. [Google Scholar] [CrossRef]
  43. Chen, X.; Duan, N.; Zhang, C.; Zhang, W. Survivin and Tumorigenesis: Molecular Mechanisms and Therapeutic Strategies. J. Cancer 2016, 7, 314–323. [Google Scholar] [CrossRef]
  44. Sim, E.H.; Yang, I.A.; Wood-Baker, R.; Bowman, R.V.; Fong, K.M. Gefitinib for Advanced Non-Small Cell Lung Cancer. Cochrane Database Syst. Rev. 2018, 2018, CD006847. [Google Scholar] [CrossRef]
  45. Pan, C.; Duan, H.; Wu, Y.; Zhu, C.; Yi, C.; Duan, Y.; Lu, D.; Guo, C.; Wu, D.; Wang, Y.; et al. Inhibition of DNA-PK by Gefitinib Causes Synergism between Gefitinib and Cisplatin in NSCLC. Int. J. Oncol. 2020, 57, 939–955. [Google Scholar] [CrossRef] [PubMed]
  46. Mercogliano, M.F.; Bruni, S.; Mauro, F.; Elizalde, P.V.; Schillaci, R. Harnessing Tumor Necrosis Factor Alpha to Achieve Effective Cancer Immunotherapy. Cancers 2021, 13, 564. [Google Scholar] [CrossRef] [PubMed]
  47. Smyth, M.J.; Kelly, J.M.; Baxter, A.G.; Körner, H.; Sedgwick, J.D. An Essential Role for Tumor Necrosis Factor in Natural Killer Cell-Mediated Tumor Rejection in the Peritoneum. J. Exp. Med. 1998, 188, 1611–1619. [Google Scholar] [CrossRef] [PubMed]
  48. Leonard, W.J.; Wan, C.-K. IL-21 Signaling in Immunity. F1000Research 2016, 5, 224. [Google Scholar] [CrossRef]
  49. Søndergaard, H.; Galsgaard, E.D.; Bartholomaeussen, M.; Straten, P.T.; Ødum, N.; Skak, K. Intratumoral Interleukin-21 Increases Antitumor Immunity, Tumor-Infiltrating CD8+ T-Cell Density and Activity, and Enlarges Draining Lymph Nodes. J. Immunother. 2010, 33, 236–249. [Google Scholar] [CrossRef]
  50. Yoshimura, A.; Naka, T.; Kubo, M. SOCS Proteins, Cytokine Signalling and Immune Regulation. Nat. Rev. Immunol. 2007, 7, 454–465. [Google Scholar] [CrossRef]
  51. Hemdan, N.Y.A.; Emmrich, F.; Adham, K.; Wichmann, G.; Lehmann, I.; El-Massry, A.; Ghoneim, H.; Lehmann, J.; Sack, U. Dose-Dependent Modulation of the In Vitro Cytokine Production of Human Immune Competent Cells by Lead Salts. Toxicol. Sci. 2005, 86, 75–83. [Google Scholar] [CrossRef]
  52. Yang, J.; Li, H.; Hu, S.; Zhou, Y. ACE2 Correlated with Immune Infiltration Serves as a Prognostic Biomarker in Endometrial Carcinoma and Renal Papillary Cell Carcinoma: Implication for COVID-19. Aging 2020, 12, 6518–6535. [Google Scholar] [CrossRef]
  53. Zhang, Q.; Lu, S.; Li, T.; Yu, L.; Zhang, Y.; Zeng, H.; Qian, X.; Bi, J.; Lin, Y. ACE2 Inhibits Breast Cancer Angiogenesis via Suppressing the VEGFa/VEGFR2/ERK Pathway. J. Exp. Clin. Cancer Res. 2019, 38, 173. [Google Scholar] [CrossRef]
  54. Hoesel, B.; Schmid, J.A. The Complexity of NF-κB Signaling in Inflammation and Cancer. Mol. Cancer 2013, 12, 86. [Google Scholar] [CrossRef]
  55. Cornice, J.; Verzella, D.; Arboretto, P.; Vecchiotti, D.; Capece, D.; Zazzeroni, F.; Franzoso, G. NF-κB: Governing Macrophages in Cancer. Genes 2024, 15, 197. [Google Scholar] [CrossRef] [PubMed]
  56. Yan, M.; Dong, Y.; Bo, X.; Cheng, Y.; Cheng, J. Large Screening Identifies ACE2 Positively Correlates With NF-κB Signaling Activity and Targeting NF-κB Signaling Drugs Suppress ACE2 Levels. Front. Pharmacol. 2021, 12, 771555. [Google Scholar] [CrossRef]
  57. Li, M.; Knight, D.A.; Snyder, L.A.; Smyth, M.J.; Stewart, T.J. A Role for CCL2 in Both Tumor Progression and Immunosurveillance. OncoImmunology 2013, 2, e25474. [Google Scholar] [CrossRef] [PubMed]
  58. Fridlender, Z.G.; Buchlis, G.; Kapoor, V.; Cheng, G.; Sun, J.; Singhal, S.; Crisanti, M.C.; Wang, L.-C.S.; Heitjan, D.; Snyder, L.A.; et al. CCL2 Blockade Augments Cancer Immunotherapy. Cancer Res. 2010, 70, 109–118. [Google Scholar] [CrossRef] [PubMed]
  59. Gschwandtner, M.; Derler, R.; Midwood, K.S. More Than Just Attractive: How CCL2 Influences Myeloid Cell Behavior Beyond Chemotaxis. Front. Immunol. 2019, 10, 2759. [Google Scholar] [CrossRef]
  60. Jin, J.; Lin, J.; Xu, A.; Lou, J.; Qian, C.; Li, X.; Wang, Y.; Yu, W.; Tao, H. CCL2: An Important Mediator Between Tumor Cells and Host Cells in Tumor Microenvironment. Front. Oncol. 2021, 11, 722916. [Google Scholar] [CrossRef]
  61. Anderson, N.R.; Minutolo, N.G.; Gill, S.; Klichinsky, M. Macrophage-Based Approaches for Cancer Immunotherapy. Cancer Res. 2021, 81, 1201–1208. [Google Scholar] [CrossRef]
  62. Kudo-Saito, C.; Shirako, H.; Ohike, M.; Tsukamoto, N.; Kawakami, Y. CCL2 Is Critical for Immunosuppression to Promote Cancer Metastasis. Clin. Exp. Metastasis 2013, 30, 393–405. [Google Scholar] [CrossRef]
  63. Liu, X.; Zhang, J.; Sun, W.; Cao, J.; Ma, Z. COX-2 in Lung Cancer: Mechanisms, Development, and Targeted Therapies. Chronic Dis. Transl. Med. 2024, 10, 281–292. [Google Scholar] [CrossRef]
  64. Chaput, N.; De Botton, S.; Obeid, M.; Apetoh, L.; Ghiringhelli, F.; Panaretakis, T.; Flament, C.; Zitvogel, L.; Kroemer, G. Molecular Determinants of Immunogenic Cell Death: Surface Exposure of Calreticulin Makes the Difference. J. Mol. Med. 2007, 85, 1069–1076. [Google Scholar] [CrossRef] [PubMed]
  65. Galluzzi, L.; Buqué, A.; Kepp, O.; Zitvogel, L.; Kroemer, G. Immunogenic Cell Death in Cancer and Infectious Disease. Nat. Rev. Immunol. 2017, 17, 97–111. [Google Scholar] [CrossRef]
  66. Kennel, K.B.; Greten, F.R. Immune Cell—Produced ROS and Their Impact on Tumor Growth and Metastasis. Redox Biol. 2021, 42, 101891. [Google Scholar] [CrossRef] [PubMed]
  67. Aggarwal, V.; Tuli, H.; Varol, A.; Thakral, F.; Yerer, M.; Sak, K.; Varol, M.; Jain, A.; Khan, M.A.; Sethi, G. Role of Reactive Oxygen Species in Cancer Progression: Molecular Mechanisms and Recent Advancements. Biomolecules 2019, 9, 735. [Google Scholar] [CrossRef] [PubMed]
  68. Nakamura, H.; Takada, K. Reactive Oxygen Species in Cancer: Current Findings and Future Directions. Cancer Sci. 2021, 112, 3945–3952. [Google Scholar] [CrossRef]
  69. Liang, W.; He, X.; Bi, J.; Hu, T.; Sun, Y. Role of Reactive Oxygen Species in Tumors Based on the ‘Seed and Soil’ Theory: A Complex Interaction (Review). Oncol. Rep. 2021, 46, 208. [Google Scholar] [CrossRef]
  70. An, X.; Yu, W.; Liu, J.; Tang, D.; Yang, L.; Chen, X. Oxidative Cell Death in Cancer: Mechanisms and Therapeutic Opportunities. Cell Death Dis. 2024, 15, 556. [Google Scholar] [CrossRef]
  71. Śmieszek, A.; Giezek, E.; Chrapiec, M.; Murat, M.; Mucha, A.; Michalak, I.; Marycz, K. The Influence of Spirulina Platensis Filtrates on Caco-2 Proliferative Activity and Expression of Apoptosis-Related microRNAs and mRNA. Mar. Drugs 2017, 15, 65. [Google Scholar] [CrossRef] [PubMed]
  72. Al-Badwy, A.H.; Khalil, A.M.; Bashal, A.H.; Kebeish, R. Polysaccharides from Spirulina Platensis (PSP): Promising Biostimulants for the Green Synthesis of Silver Nanoparticles and Their Potential Application in the Treatment of Cancer Tumors. Microb. Cell Factories 2023, 22, 247. [Google Scholar] [CrossRef]
  73. Nizami, Z.N.; Aburawi, H.E.; Semlali, A.; Muhammad, K.; Iratni, R. Oxidative Stress Inducers in Cancer Therapy: Preclinical and Clinical Evidence. Antioxidants 2023, 12, 1159. [Google Scholar] [CrossRef] [PubMed]
  74. Hayes, J.D.; Dinkova-Kostova, A.T.; Tew, K.D. Oxidative Stress in Cancer. Cancer Cell 2020, 38, 167–197. [Google Scholar] [CrossRef]
  75. Reczek, C.R.; Chandel, N.S. The Two Faces of Reactive Oxygen Species in Cancer. Annu. Rev. Cancer Biol. 2017, 1, 79–98. [Google Scholar] [CrossRef] [PubMed]
  76. Cory, S.; Adams, J.M. The Bcl2 Family: Regulators of the Cellular Life-or-Death Switch. Nat. Rev. Cancer 2002, 2, 647–656. [Google Scholar] [CrossRef]
  77. Li, L.; Wang, H. Heterogeneity of Liver Cancer and Personalized Therapy. Cancer Lett. 2016, 379, 191–197. [Google Scholar] [CrossRef]
  78. Li, Q.; Dai, W.; Liu, J.; Sang, Q.; Li, Y.-X.; Li, Y.-Y. Gene Dysregulation Analysis Builds a Mechanistic Signature for Prognosis and Therapeutic Benefit in Colorectal Cancer. J. Mol. Cell Biol. 2021, 12, 881–893. [Google Scholar] [CrossRef]
  79. Seo, S.U.; Woo, S.M.; Lee, H.-S.; Kim, S.H.; Min, K.; Kwon, T.K. mTORC1/2 Inhibitor and Curcumin Induce Apoptosis through Lysosomal Membrane Permeabilization-Mediated Autophagy. Oncogene 2018, 37, 5205–5220. [Google Scholar] [CrossRef]
  80. Kim, K.W.; Moretti, L.; Mitchell, L.R.; Jung, D.K.; Lu, B. Combined Bcl-2/Mammalian Target of Rapamycin Inhibition Leads to Enhanced Radiosensitization via Induction of Apoptosis and Autophagy in Non–Small Cell Lung Tumor Xenograft Model. Clin. Cancer Res. 2009, 15, 6096–6105. [Google Scholar] [CrossRef]
  81. Anandharaj, A.; Cinghu, S.; Park, W.-Y. Rapamycin-Mediated mTOR Inhibition Attenuates Survivin and Sensitizes Glioblastoma Cells to Radiation Therapy. Acta Biochim. Biophys. Sin. 2011, 43, 292–300. [Google Scholar] [CrossRef]
  82. Ou, D.-L.; Lee, B.-S.; Lin, L.-I.; Liou, J.-Y.; Liao, S.-C.; Hsu, C.; Cheng, A.-L. Vertical Blockade of the IGFR- PI3K/Akt/mTOR Pathway for the Treatment of Hepatocellular Carcinoma: The Role of Survivin. Mol. Cancer 2014, 13, 2. [Google Scholar] [CrossRef]
  83. Li, P.; Nijhawan, D.; Budihardjo, I.; Srinivasula, S.M.; Ahmad, M.; Alnemri, E.S.; Wang, X. Cytochrome c and dATP-Dependent Formation of Apaf-1/Caspase-9 Complex Initiates an Apoptotic Protease Cascade. Cell 1997, 91, 479–489. [Google Scholar] [CrossRef] [PubMed]
  84. Chu, W.-L.; Lim, Y.-W.; Radhakrishnan, A.K.; Lim, P.-E. Protective Effect of Aqueous Extract from Spirulina Platensis against Cell Death Induced by Free Radicals. BMC Complement. Altern. Med. 2010, 10, 53. [Google Scholar] [CrossRef]
  85. Kumar, A.; Ramamoorthy, D.; Verma, D.K.; Kumar, A.; Kumar, N.; Kanak, K.R.; Marwein, B.M.; Mohan, K. Antioxidant and Phytonutrient Activities of Spirulina Platensis. Energy Nexus 2022, 6, 100070. [Google Scholar] [CrossRef]
  86. Janaki, V.; Vijayaraghavan, K.; Oh, B.-T.; Lee, K.-J.; Muthuchelian, K.; Ramasamy, A.K.; Kamala-Kannan, S. Starch/Polyaniline Nanocomposite for Enhanced Removal of Reactive Dyes from Synthetic Effluent. Carbohydr. Polym. 2012, 90, 1437–1444. [Google Scholar] [CrossRef] [PubMed]
  87. Schepetkin, I.A.; Quinn, M.T. Botanical Polysaccharides: Macrophage Immunomodulation and Therapeutic Potential. Int. Immunopharmacol. 2006, 6, 317–333. [Google Scholar] [CrossRef]
  88. Hsu, H.-Y.; Lin, T.-Y.; Lu, M.-K.; Leng, P.-J.; Tsao, S.-M.; Wu, Y.-C. Fucoidan Induces Toll-like Receptor 4-Regulated Reactive Oxygen Species and Promotes Endoplasmic Reticulum Stress-Mediated Apoptosis in Lung Cancer. Sci. Rep. 2017, 7, 44990. [Google Scholar] [CrossRef] [PubMed]
  89. Czaplewska, P.; Bogucka, A.; Macur, K.; Rybicka, M.; Rychłowski, M.; Fiołka, M.J. Proteomic Response of A549 Lung Cancer Cell Line to Protein-Polysaccharide Complex Venetin-1 Isolated from Earthworm Coelomic Fluid. Front. Mol. Biosci. 2023, 10, 1128320. [Google Scholar] [CrossRef]
  90. Lee, K.R.; Lee, J.S.; Song, J.E.; Ha, S.J.; Hong, E.K. Inonotus Obliquus-Derived Polysaccharide Inhibits the Migration and Invasion of Human Non-Small Cell Lung Carcinoma Cells via Suppression of MMP-2 and MMP-9. Int. J. Oncol. 2014, 45, 2533–2540. [Google Scholar] [CrossRef]
  91. Qu, Y.; Yang, X.; Zhao, D.; Zhang, P.; Mi, Y.; Xu, J.; Zhao, B.; Shi, D. Structural Characterization and Anti-Tumor Activity of a Polysaccharide from Laetiporus Sulphureus in A549 Cells. Molecules 2025, 30, 3706. [Google Scholar] [CrossRef] [PubMed]
  92. Camidge, D.R.; Pao, W.; Sequist, L.V. Acquired Resistance to TKIs in Solid Tumours: Learning from Lung Cancer. Nat. Rev. Clin. Oncol. 2014, 11, 473–481. [Google Scholar] [CrossRef]
  93. Mahmoud, N.; Hegazy, M.-E.F.; Wadie, W.; Elbadawi, M.; Fleischer, E.; Klinger, A.; Bringmann, G.; Khayyal, M.T.; Efferth, T. Naphthoquinone Derivatives as P-Glycoprotein Inducers in Inflammatory Bowel Disease: 2D Monolayers, 3D Spheroids, and in Vivo Models. Pharmacol. Res. 2022, 179, 106233. [Google Scholar] [CrossRef] [PubMed]
  94. Voorn, M.J.J.; Bootsma, M.F.R.; Bootsma, G.P.; Van Kampen-van Den Boogaart, V.E.M.; Van Riet, G.J.A.; De Ruysscher, D.K.; Bongers, B.C.; Janssen-Heijnen, M.L.G. Association of Pretreatment Physical and Geriatric Parameters with Treatment Tolerance and Survival in Elderly Patients with Stage I–II Non-Small Cell Lung Cancer: An Evaluation of Usual Care Data. Cancers 2022, 14, 5994. [Google Scholar] [CrossRef] [PubMed]
Pharmaceuticals 19 00202 g001
Figure 1. SPPs reduce the viability of A549 cells. A549 cells were treated with increasing concentrations of SPPs ranging from 1 to 400 µg/mL for 24 h. Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one-way ANOVA followed by Dunnett’s multiple comparisons test. * p < 0.05; ** p < 0.01 compared to untreated cells (CTRL).
Figure 1. SPPs reduce the viability of A549 cells. A549 cells were treated with increasing concentrations of SPPs ranging from 1 to 400 µg/mL for 24 h. Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one-way ANOVA followed by Dunnett’s multiple comparisons test. * p < 0.05; ** p < 0.01 compared to untreated cells (CTRL).
Pharmaceuticals 19 00202 g001
Pharmaceuticals 19 00202 g002
Figure 2. SPPs induce the release of selected pro-inflammatory cytokines: TNF-a (A), IL6 (B) and IL21 (C). A549 cells were treated with SPPs (150 and 250 µg/mL) for 24 h. LPS-treated cells (10 and 50 µg/mL) were used as a positive control. Each bar represents means ± SD from three independent experiments performed in duplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); $$$ p < 0.005 compared to cells treated with SPPs 150 µg/mL; §§§ p < 0.005 compared to cells treated with LPS 10 µg/mL; ### p < 0.005 compared to cells treated with LPS 50 µg/mL.
Figure 2. SPPs induce the release of selected pro-inflammatory cytokines: TNF-a (A), IL6 (B) and IL21 (C). A549 cells were treated with SPPs (150 and 250 µg/mL) for 24 h. LPS-treated cells (10 and 50 µg/mL) were used as a positive control. Each bar represents means ± SD from three independent experiments performed in duplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); $$$ p < 0.005 compared to cells treated with SPPs 150 µg/mL; §§§ p < 0.005 compared to cells treated with LPS 10 µg/mL; ### p < 0.005 compared to cells treated with LPS 50 µg/mL.
Pharmaceuticals 19 00202 g002
Pharmaceuticals 19 00202 g003
Figure 3. SPPs modulate inflammation-related gene expression in A549 cells. Relative mRNA levels of ACE2 (A), NF-κB1 (B), CCL2 (C), and COX-2 (D) were measured by qPCR after 24 h treatment with SPPs (150 and 250 µg/mL) or LPS (10 and 50 µg/mL). Gene expression values were normalized to the untreated control (CTRL) and expressed as fold change. Each bar represents means ± SD from three independent experiments performed in duplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); $$$ p < 0.005 compared to cells treated with SPPs 150 µg/mL; §§ p < 0.01 compared to cells treated with LPS 10 µg/mL; # p < 0.05, ## p < 0.01 and ### p < 0.005 compared to cells treated with LPS 50 µg/mL.
Figure 3. SPPs modulate inflammation-related gene expression in A549 cells. Relative mRNA levels of ACE2 (A), NF-κB1 (B), CCL2 (C), and COX-2 (D) were measured by qPCR after 24 h treatment with SPPs (150 and 250 µg/mL) or LPS (10 and 50 µg/mL). Gene expression values were normalized to the untreated control (CTRL) and expressed as fold change. Each bar represents means ± SD from three independent experiments performed in duplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); $$$ p < 0.005 compared to cells treated with SPPs 150 µg/mL; §§ p < 0.01 compared to cells treated with LPS 10 µg/mL; # p < 0.05, ## p < 0.01 and ### p < 0.005 compared to cells treated with LPS 50 µg/mL.
Pharmaceuticals 19 00202 g003
Pharmaceuticals 19 00202 g004
Figure 4. SPPs promote pro-oxidant responses in A549 cells. In A549 cells exposed to selected concentrations of SPPs (150 and 250 µg/mL) or LPS (10 and 50 µg/mL) for 24 h, intracellular ROS production was quantified using a specific cellular ROS assay kit (A). In parallel experiments, the expression of key genes involved in the antioxidant defense system, such as NFEL2L2 (B), HMOX1 (C), and SOD1 (D) was analyzed by qPCR. Each bar represents means ± SD from three independent experiments performed in duplicate. Statistical analysis was performed by one-way ANOVA followed by Sidak or Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.005 compared to untreated cells (CTRL); $ p < 0.05, $$ p < 0.01, and $$$ p < 0.005 compared to SPPs 150 µg/mL; §§ p < 0.01 compared to cells treated with LPS 10 µg/mL; # p < 0.05 compared to cells treated with LPS 50 µg/mL.
Figure 4. SPPs promote pro-oxidant responses in A549 cells. In A549 cells exposed to selected concentrations of SPPs (150 and 250 µg/mL) or LPS (10 and 50 µg/mL) for 24 h, intracellular ROS production was quantified using a specific cellular ROS assay kit (A). In parallel experiments, the expression of key genes involved in the antioxidant defense system, such as NFEL2L2 (B), HMOX1 (C), and SOD1 (D) was analyzed by qPCR. Each bar represents means ± SD from three independent experiments performed in duplicate. Statistical analysis was performed by one-way ANOVA followed by Sidak or Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, and *** p < 0.005 compared to untreated cells (CTRL); $ p < 0.05, $$ p < 0.01, and $$$ p < 0.005 compared to SPPs 150 µg/mL; §§ p < 0.01 compared to cells treated with LPS 10 µg/mL; # p < 0.05 compared to cells treated with LPS 50 µg/mL.
Pharmaceuticals 19 00202 g004
Pharmaceuticals 19 00202 g005
Figure 5. Effects of SPPs on internucleosomal DNA fragmentation and expression of apoptosis-related genes in A549 cells. A549 cells were treated with SPPs (150 and 250 µg/mL) or LPS (10 and 50 µg/mL, positive control). After 24 h, apoptotic DNA fragmentation was quantified by a specific ELISA assay and expressed as enrichment factor compared to untreated cells, used as control (CTRL) (A). Furthermore, relative mRNA expression of apoptosis-related genes BAX (B), CASP-9 (C), BCL-2 (D), MTOR (E), and BIRC5 (F) was assessed by qPCR and expressed as fold change. Each bar represents means ± SD from three independent experiments performed in duplicate or triplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); $ p < 0.05, $$ p < 0.01 and $$$ p < 0.005 compared to cells treated with SPPs 150 µg/mL; § p < 0.05, §§ p < 0.01 and §§§ p < 0.005 compared to cells treated with LPS 10 µg/mL.
Figure 5. Effects of SPPs on internucleosomal DNA fragmentation and expression of apoptosis-related genes in A549 cells. A549 cells were treated with SPPs (150 and 250 µg/mL) or LPS (10 and 50 µg/mL, positive control). After 24 h, apoptotic DNA fragmentation was quantified by a specific ELISA assay and expressed as enrichment factor compared to untreated cells, used as control (CTRL) (A). Furthermore, relative mRNA expression of apoptosis-related genes BAX (B), CASP-9 (C), BCL-2 (D), MTOR (E), and BIRC5 (F) was assessed by qPCR and expressed as fold change. Each bar represents means ± SD from three independent experiments performed in duplicate or triplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); $ p < 0.05, $$ p < 0.01 and $$$ p < 0.005 compared to cells treated with SPPs 150 µg/mL; § p < 0.05, §§ p < 0.01 and §§§ p < 0.005 compared to cells treated with LPS 10 µg/mL.
Pharmaceuticals 19 00202 g005
Pharmaceuticals 19 00202 g006
Figure 6. Effects of co-treatment with SPPs (150 µg/mL) and Gefitinib on A549. (A) Cell viability was assessed by MTT assay after 48 h treatment with increasing concentrations of Gefitinib (10–100 µM), either alone or in combination with SPPs 150 µg/mL. (B) To evaluate the impact on apoptotic cell death, histone–DNA fragmentation was measured by ELISA following 48 h treatment with Gefitinib, alone (at the highest cytotoxic concentration, 100 µM), or at increasing dosages (25, 50, and 100 µM) in combination with SPPs (150 µg/mL). (C) Intracellular ROS production was quantified using a specific cellular ROS assay kit in A549 cells exposed to SPPs (150 µg/mL) and Gefitinib (100 µM), alone or in combination, for 24 h. Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); ### p < 0.005 compared to cells treated with Gefitinib 25 µM; $$$ p < 0.005 compared to cells treated with Gefitinib 50 µM; §§ p < 0.01 and §§§ p < 0.005 compared to cells treated with Gefitinib 100 µM.
Figure 6. Effects of co-treatment with SPPs (150 µg/mL) and Gefitinib on A549. (A) Cell viability was assessed by MTT assay after 48 h treatment with increasing concentrations of Gefitinib (10–100 µM), either alone or in combination with SPPs 150 µg/mL. (B) To evaluate the impact on apoptotic cell death, histone–DNA fragmentation was measured by ELISA following 48 h treatment with Gefitinib, alone (at the highest cytotoxic concentration, 100 µM), or at increasing dosages (25, 50, and 100 µM) in combination with SPPs (150 µg/mL). (C) Intracellular ROS production was quantified using a specific cellular ROS assay kit in A549 cells exposed to SPPs (150 µg/mL) and Gefitinib (100 µM), alone or in combination, for 24 h. Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 and *** p < 0.005 compared to untreated cells (CTRL); ### p < 0.005 compared to cells treated with Gefitinib 25 µM; $$$ p < 0.005 compared to cells treated with Gefitinib 50 µM; §§ p < 0.01 and §§§ p < 0.005 compared to cells treated with Gefitinib 100 µM.
Pharmaceuticals 19 00202 g006
Pharmaceuticals 19 00202 g007
Figure 7. Evaluation of SPPs cytotoxicity in non-malignant human bronchial epithelial cells. 16HBE cells were treated with increasing concentrations of SPPs (100–450 µg/mL) for 48 h, and cell viability was assessed by MTT assay and expressed as percentage of untreated cells, used as control (CTRL) (A). Apoptosis was evaluated by measuring cytoplasmic histone-associated DNA fragments in cells treated for 48 h with SPPs at 150 or 250 µg/mL and expressed as enrichment factor compared to control cells (B). Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. *** p < 0.005 compared to untreated cells (CTRL).
Figure 7. Evaluation of SPPs cytotoxicity in non-malignant human bronchial epithelial cells. 16HBE cells were treated with increasing concentrations of SPPs (100–450 µg/mL) for 48 h, and cell viability was assessed by MTT assay and expressed as percentage of untreated cells, used as control (CTRL) (A). Apoptosis was evaluated by measuring cytoplasmic histone-associated DNA fragments in cells treated for 48 h with SPPs at 150 or 250 µg/mL and expressed as enrichment factor compared to control cells (B). Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparisons test. *** p < 0.005 compared to untreated cells (CTRL).
Pharmaceuticals 19 00202 g007
Pharmaceuticals 19 00202 g008
Figure 8. Effect of co-treatment with SPPs and Gefitinib on 16HBE cells. Cell viability was assessed by MTT assay after 48 h treatment with increasing concentrations of Gefitinib (10–100 µM), either alone or in combination with SPPs at 150 µg/mL concentration. Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 compared to untreated cells (CTRL).
Figure 8. Effect of co-treatment with SPPs and Gefitinib on 16HBE cells. Cell viability was assessed by MTT assay after 48 h treatment with increasing concentrations of Gefitinib (10–100 µM), either alone or in combination with SPPs at 150 µg/mL concentration. Each bar represents means ± SD from three independent experiments performed in triplicate. Statistical analysis was performed by one way ANOVA followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01 compared to untreated cells (CTRL).
Pharmaceuticals 19 00202 g008
Table 1. Primer sequences.
Table 1. Primer sequences.
GeneForward PrimerReverse Primer
ACE2TCCATTGGTCTTCTGTCACCCGAGACCATCCACCTCCACTTCTC
NF-kB 1GCAGCACTACTTCTTGACCACCTCTGCTCCTGAGCATTGACGTC
COX2CGGTGAAACTCTGGCTAGACAGGCAAACCGTAGATGCTCAGGGA
NFEL2L2CACATCCAGTCAGAAACCAGTGGGGAATGTCTGCGCCAAAAGCTG
HMOX1CCAGGCAGAGAATGCTGAGTTCAAGACTGGGCTCTCCTTGTTGC
SOD1CTCACTCTCAGGAGACCATTGCCCACAAGCCAAACGACTTCCAG
BAXTCTGACGGCAACTTCAACTGTTGAGGAGTCTCACCCAACC
CASP-9GTTTGAGGACCTTCGACCAGCTCAACGTACCAGGAGCCACTCTT
BCL2TCCATGTCTTTGGACAACCACTCCACCAGTGTTCCCATCT
MTORATGCAGCTGTCCTGGTTCTCAATCAGACAGGCACGAAGGG
BIRCCCACTGAGAACGAGCCAGACTTGTATTACAGGCGTAAGCCACCG
GAPDHGTCTCCTCTGACTTCAACAGCGACCACCCTGTTGCTGTAGCCAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Polini, B.; Banti, M.; Mazzierli, A.; Corti, A.; Nieri, P.; Manera, C.; Chiellini, G. Sulfated Polysaccharide-Rich Fractions from Spirulina Platensis (SPPs) Exert Multi-Target Anticancer Activity in Non-Small Cell Lung Cancer (NSCLC) Cells. Pharmaceuticals 2026, 19, 202. https://doi.org/10.3390/ph19020202

AMA Style

Polini B, Banti M, Mazzierli A, Corti A, Nieri P, Manera C, Chiellini G. Sulfated Polysaccharide-Rich Fractions from Spirulina Platensis (SPPs) Exert Multi-Target Anticancer Activity in Non-Small Cell Lung Cancer (NSCLC) Cells. Pharmaceuticals. 2026; 19(2):202. https://doi.org/10.3390/ph19020202

Chicago/Turabian Style

Polini, Beatrice, Matteo Banti, Anna Mazzierli, Alessandro Corti, Paola Nieri, Clementina Manera, and Grazia Chiellini. 2026. "Sulfated Polysaccharide-Rich Fractions from Spirulina Platensis (SPPs) Exert Multi-Target Anticancer Activity in Non-Small Cell Lung Cancer (NSCLC) Cells" Pharmaceuticals 19, no. 2: 202. https://doi.org/10.3390/ph19020202

APA Style

Polini, B., Banti, M., Mazzierli, A., Corti, A., Nieri, P., Manera, C., & Chiellini, G. (2026). Sulfated Polysaccharide-Rich Fractions from Spirulina Platensis (SPPs) Exert Multi-Target Anticancer Activity in Non-Small Cell Lung Cancer (NSCLC) Cells. Pharmaceuticals, 19(2), 202. https://doi.org/10.3390/ph19020202

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop