The PI3K/AKT/NRF2 Signaling Pathway Involved in the Improvement of CUMS-Induced Depressive-like Behaviors by Apigenin

Abstract

Background/Objectives: Apigenin, a naturally occurring flavonoid, has shown promising antidepressant-like effects in previous studies. However, its precise mechanisms remain unclear. This study aims to investigate the underlying neurobiological mechanisms mediating the antidepressant effects of apigenin in chronic unpredictable mild stress (CUMS)-induced mice. Methods: The male mice were subjected to 4-week CUMS, with or without treatment, followed by behavioral testing. Network pharmacology analysis was employed to predict relevant signaling pathways. The mRNA and protein expression levels of the PI3K/AKT/NRF2 pathway were measured. Oxidative stress was assessed through the measurement of malondialdehyde, glutathione, and superoxide dismutase levels. Results: Apigenin significantly ameliorated CUMS-induced depression-like behaviors. The PI3K/AKT pathway may mediate the antidepressant properties of apigenin with both PI3K and AKT emerging as core target molecules. Apigenin restored the activity of the PI3K/AKT/NRF2 pathway and oxidative stress in the hippocampus downregulated by CUMS. Conclusions: The present study demonstrates that apigenin ameliorates depression-like behaviors in mice exposed to CUMS and mitigates oxidative stress in the hippocampus, which is associated with the PI3K/AKT/NRF2 signaling pathway.

1. Introduction

Depressive disorder is a prevalent psychiatric condition characterized by persistent sadness and anhedonia, defined as the diminished ability to experience pleasure, leading to substantial impairments in psychosocial functioning and overall well-being [1]. WHO recognizes it as one of the leading causes of disability worldwide, substantially contributing to the global burden of disease and underscoring its profound implications for public health [2]. Pharmacological interventions remain the primary approach in managing depressive disorders. However, current antidepressant agents are often limited by inadequate response rates and a range of adverse effects that affect patient tolerability [3]. Poor adherence due to side effects remains a critical barrier to effective treatment. Clinical studies indicate that only around one-third of patients achieve remission with first-line pharmacotherapy, while up to one-third of individuals exhibit treatment-resistant depression despite sequential or combination therapeutic strategies [4]. Given these limitations, there is a compelling need for novel antidepressants with improved efficacy and better safety profiles. In this context, increasing evidence supports the therapeutic potential of plant-derived bioactive compounds, which demonstrate robust antidepressant-like effects [5,6,7].

Apigenin is a natural flavonoid compound found in various edible and medicinal plants, including celery and chamomile. It has attracted considerable scientific interest owing to its diverse pharmacological effects, such as antioxidant, anti-inflammatory, and neuroprotective activities [8]. Accumulating evidence indicates that apigenin exerts beneficial effects on depressive-like phenotypes through multiple molecular pathways. In rodent models, it has been shown to attenuate neuroinflammation by suppressing the production of interleukin-1β and inhibiting the activation of the NLRP3 inflammasome, leading to improved behavioral outcomes [9]. Furthermore, apigenin enhances hippocampal brain-derived neurotrophic factor (BDNF) expression, thereby reversing corticosterone-induced depressive-like behaviors in mice [10]. Of particular significance, recent studies have demonstrated that apigenin can directly bind to BDNF and enhance its neurotrophic signaling capacity, suggesting a potential mechanism involving direct modulation of neurotrophin activity [11]. Taken together, these findings strongly support the antidepressant-like potential of apigenin. Therefore, the comprehensive mechanisms underlying its therapeutic effects remain to be elucidated.

Network pharmacology, a systems biology-driven approach, seeks to elucidate the multifaceted mechanisms of drug action by constructing comprehensive interaction networks that integrate drugs, diseases, and their associated molecular targets [12]. In recent years, this methodology has been increasingly utilized to decode the complex pharmacological profiles of traditional Chinese medicine formulations. By enabling the systematic identification of novel therapeutic targets, network pharmacology provides a robust framework for advancing drug discovery and refining treatment paradigms [13,14]. Leveraging this strategy, we conducted a network pharmacology analysis to uncover the central signaling pathways and putative molecular targets underlying the antidepressant effects of apigenin. We aim to provide mechanistic insights into its neuropharmacological activity and contribute to a more comprehensive understanding of its potential as a candidate for depression intervention.

Emerging evidence from network pharmacology analyses indicates that total phenolic compounds, with apigenin as a principal bioactive constituent, may confer neuroprotective effects through the modulation of the PI3K/AKT pathway [15]. This pathway is essential for modulating multiple neurobiological processes, including oxidative stress, neuroinflammation, neurogenesis, neurotransmitter homeostasis, and synaptic plasticity—each of which has been implicated in the pathogenesis of depression [16]. The PI3K/AKT pathway is predominantly composed of two central components: phosphatidylinositol 3-kinase (PI3K) and protein kinase B (AKT). A growing body of research demonstrates that this pathway is significantly downregulated in the brains of animal models displaying depressive-like phenotypes [17,18]. Notably, pharmacological or genetic activation of this pathway has been shown to ameliorate such behavioral impairments, underscoring its potential as a therapeutic target [19]. Collectively, these findings strongly support the pivotal role of this pathway in the molecular mechanisms underlying depressive disorder.

Recent research indicates that the PI3K/AKT pathway serves as a key upstream regulator of the nuclear factor erythroid 2-related factor 2 (NRF2)-mediated antioxidant response, thereby regulating intracellular redox homeostasis [20]. Oxidative stress has been shown to initiate and amplify the pathological mechanisms implicated in depression, such as neuroinflammation, mitochondrial dysfunction, and ferroptosis, and given the central role of these processes in disease progression, targeting oxidative stress and its downstream effects may represent a promising therapeutic strategy for alleviating depressive symptoms [21,22]. Clinical research has shown that individuals diagnosed with major depressive disorder display heightened concentrations of MDA, the lipid peroxidation product, along with diminished activity of SOD, the antioxidant enzyme, in peripheral blood [23], indicating increased oxidative stress and impaired antioxidant defenses in these patients. Meanwhile, Parul and colleagues reported elevated MDA levels alongside reduced GSH levels, an antioxidant, in the brain of rats exposed to chronic unpredictable mild stress (CUMS) [24]. These results underscore the significance of compromised antioxidant systems in the development and progression of depressive pathophysiology. NRF2 is the master transcriptional regulator of endogenous antioxidant defenses, and it is well established that NRF2 functions as a downstream effector of the PI3K/AKT pathway [25,26]. During oxidative stress, NRF2 activates downstream antioxidant genes, including heme oxygenase-1 (HO-1) and NAD(P)H/quinone oxidoreductase 1 (NQO1), supporting a protective role for NRF2 in the context of depression [27]. HO-1 catalyzes the degradation of heme, preserving neuronal integrity and function [28]. Likewise, NQO1 serves as a reductase involved in multiple redox reactions and provides protection against oxidative damage under oxidative stress conditions [29]. In our previous study, we reported that the NRF2-related antioxidant system exerts a significant influence on CUMS-induced depressive-like behaviors [30]. Moreover, evidence suggests that apigenin regulates oxidative stress levels and alleviates associated neuronal damage in the brain, highlighting its potential neuroprotective role [31].

In this study, apigenin was administered via oral gavage to mice subjected to four weeks of CUMS to evaluate its antidepressant effects. Network pharmacology analysis was subsequently performed to identify potential core signaling pathways and molecular targets associated with apigenin’s antidepressant activity. To validate these predictions, molecular biological experiments were conducted. Furthermore, changes in oxidative stress-related proteins were assessed following CUMS induction and apigenin treatment. Here, we hypothesized that apigenin ameliorates CUMS-induced depressive-like behaviors, which are related to the PI3K/AKT/NRF2 pathway and redox homeostasis.

2. Results

2.1. Apigenin Ameliorated CUMS-Induced Depression-like Behaviors in Mice

After 4-week CUMS (Figure 1), the mice exhibited significant symptoms resembling depression, including a decreased sucrose preference in sucrose preference test (SPT) (Figure 2A; F (3.000, 24.55) = 22.23; p < 0.001), a reduced total distance (Figure 2B; F (3, 35) = 14.95; p < 0.0001), time in center (Figure 2C; F (3.000, 25.12) = 31.32; p < 0.001), and frequency of rearing in open field test (OFT) (Figure 2D; F (3, 35) = 19.59; p < 0.0001), and an increased immobility time in forced swimming test (FST) (Figure 2D; p < 0.001) and tail suspension test (TST) (Figure 2E; F (3.000, 18.83) = 28.16; p < 0.0001). Conversely, apigenin intervention significantly alleviated the CUMS-induced depressive-like behaviors in mice (Figure 2A–F; p < 0.05, p < 0.05, p < 0.05, p < 0.001, p < 0.0001, p < 0.0001). These findings demonstrated that 4-week CUMS reliably induced depression-like behaviors in mice, including anhedonia, hypoactivity, and behavioral despair, all of which are ameliorated by apigenin intervention.

2.2. Network Pharmacology Analysis Indicated That the PI3K/AKT Signaling Pathway Is Implicated in the Antidepressant Effects of Apigenin

Following a comprehensive search across the PharmMapper, Swiss Target Predic, GeneCards, and OMIM databases, a total of 376 apigenin-related targets and 4679 depression-related targets were retrieved. 79 potential targets were identified by intersecting the two target sets. As depicted in Figure 3, subsequent enrichment analyses of these 79 core targets were conducted using Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Ontology (GO), and WikiPathway. The KEGG analysis enriched 100 core biological pathways (Figure 3A). The GO analysis led to the identification of 978 crucial biological processes (Figure 3B), and the Wikipathway analysis enriched 156 biological pathways (Figure 3C). Among these, the PI3K/AKT signaling pathway exhibited the most substantial alterations. Furthermore, Protein–Protein Interaction (PPI) analysis pinpointed two core proteins, namely AKT1 and PIK3R1 (Figure 3D). These findings led us to postulate that apigenin may exert its antidepressant effects via the PI3K/AKT signaling pathway.

2.3. Apigenin Mitigated CUMS-Induced Downregulation of the PI3K/AKT Pathway

We measured the expression levels of Pik3r1 and Akt1 in the hippocampus. As depicted in Figure 4, the mRNA expression levels of Pik3r1 (Figure 4A; F (3.000, 12.33) = 14.79; p < 0.001) and Akt1 (Figure 4B; F (3, 20) = 29.04; p < 0.05) were significantly diminished in the Cums. In contrast, apigenin significantly upregulated the mRNA expression of Pik3r1 (Figure 4A; p < 0.05) and Akt1 (Figure 4B; p < 0.0001). Furthermore, the protein expression levels of PI3K (Figure 4D; F (3, 8) = 19.34; p < 0.01) and AKT (Figure 4E; F (3, 8) = 20.38; p < 0.01) were decreased in the hippocampi of CUMS mice. Additionally, the phosphorylation level of AKT was also markedly reduced (Figure 4F; F (3, 8) = 38.70; p < 0.01). Conversely, upon apigenin intervention, the protein expression of PI3K (Figure 4D; p < 0.05) and AKT (Figure 4E; p < 0.01) was enhanced, and the phosphorylation level of AKT was increased (Figure 4F; p < 0.001). These results suggested that apigenin alleviated the CUMS-induced downregulation of the PI3K/AKT pathway.

2.4. Apigenin Alleviated CUMS-Induced Downregulation of the NRF2 Antioxidant Stress Pathway and Oxidative Stress

Subsequently, we explored the impacts of CUMS, and apigenin on the expression of the NRF2 antioxidant stress pathway within the hippocampi of mice. As presented in Figure 5, in comparison to the Con group, the mRNA expression levels of Nrf2 (Figure 5A; F (3, 20) = 17.22; p < 0.01), Hmox1 (Figure 5B; F (3, 20) = 29.66; p < 0.001,), and Nqo1 (Figure 5C; F (3, 20) = 27.58; p < 0.001) in the mice exposed to CUMS were significantly decreased. Apigenin led to an improvement in the mRNA expression levels of Nrf2 (Figure 5A; p < 0.01), Hmox1 (Figure 5B; p < 0.0001), and Nqo1 (Figure 5C; p < 0.0001). Furthermore, analysis of protein expression revealed that in the Cums group, the levels of NRF2 (Figure 5E; F (3, 8) = 16.37; p < 0.01), HO-1 (Figure 5F; F (3, 8) = 58.46; p < 0.001), and NQO1 (Figure 5G; F (3, 8) = 17.61; p < 0.01) were reduced. In contrast, in the Api group, the protein expression of NRF2 (Figure 5E; p < 0.05), HO-1 (Figure 5F; p < 0.0001), and NQO1 (Figure 5G; p < 0.05) was enhanced. Concomitantly, Malondialdehyde (MDA) levels (Figure 5H; F (3, 12) = 22.12; p < 0.001) significantly increased, while glutathione (GSH) levels (Figure 5I; F (3, 12) = 9.980; p < 0.01,) and superoxide dismutase (SOD) activity (Figure 5J; F (3, 20) = 10.15; p < 0.01) were reduced in the hippocampus of CUMS-exposed mice. In the Api group, apigenin downregulated MDA levels (Figure 5H; p < 0.001) and upregulated both GSH levels (Figure 5I; p < 0.05) and SOD activity (Figure 5J; p < 0.01). These findings suggested that apigenin mitigated the downregulation of the NRF2 antioxidant stress pathway and ameliorated oxidative stress-related indicators in the hippocampus induced by CUMS.

3. Discussion

This study validated that apigenin ameliorates CUMS-induced depressive-like behaviors. Through network pharmacology analysis, the PI3K/AKT pathway was identified as a potential core pathway and target underlying the antidepressant action of apigenin, and these findings were subsequently corroborated by molecular biology experiments. Furthermore, we demonstrated that apigenin alleviated the downregulation of the NRF2-associated antioxidant stress pathway and oxidative stress induced by CUMS. These results suggest that apigenin might alleviate CUMS-induced depressive-like behaviors in mice by modulating oxidative stress levels in the hippocampus, associated with activation of the PI3K/AKT/NRF2 pathway.

The CUMS model effectively recapitulates the behavioral and physiological features of human depression under chronic stress conditions and is among the most widely accepted rodent models of depression. Consistent with our group’s prior findings, four weeks of CUMS exposure robustly induced depressive-like behaviors, as evidenced by a reduced sucrose preference index, decreased total locomotor distance and diminished time in the center during the OFT, and increased immobility duration in both the FST and TST [32,33]. Apigenin significantly ameliorated these behavioral deficits, demonstrating its potent antidepressant effects. This finding is consistent with previous preclinical studies on apigenin in lipopolysaccharide-induced inflammation [34], corticosterone-induced neurotoxicity [35], and chronic restraint stress models [36]. This study further confirmed and extended these observations by validating the antidepressant efficacy of apigenin in the classical mice CUMS paradigm.

Based on the analysis results, the PI3K/AKT pathway was identified as a significantly enriched pathway involved in the mechanism underlying apigenin’s antidepressant effects. PPI network analysis further highlighted AKT1 and PIK3R1 as core target proteins associated with apigenin’s therapeutic action. AKT1 is the predominant isoform of the AKT kinase, and PIK3R1 encodes the p85α regulatory subunit of PI3K, both of which are essential components of the PI3K/AKT signaling cascade [37]. Moreover, the PI3K/AKT pathway regulates key neurobiological processes such as oxidative stress [38], synaptic plasticity [18], and neuroinflammation [17], all of which have been independently linked to the antidepressant properties of apigenin in prior studies [10,11,35,39]. These results suggested that the PI3K/AKT pathway might serve as a central mechanism mediating the antidepressant effects of apigenin. The hippocampus is implicated in cognitive and emotional regulation under stress conditions and plays a crucial role in the pathophysiology of depression [40]. Our findings demonstrated that apigenin effectively alleviated the CUMS-induced downregulation of the expression levels of PI3K and AKT, and the phosphorylation level of AKT in the hippocampus. This confirms that apigenin may modulate the PI3K/AKT signaling pathway and underscores its functional significance in ameliorating depressive-like behaviors in the mice CUMS model.

Apigenin, a naturally occurring flavonoid, exhibits potent antioxidant properties. While previous studies on its antidepressant mechanisms have primarily focused on anti-inflammatory and neuroprotective effects, its role in modulating oxidative stress remains less explored. Our prior research has demonstrated that NRF2, a master regulator of cellular redox homeostasis, is regulated downstream of the PI3K/AKT signaling pathway [41]. The NRF2-mediated antioxidant defense system has been implicated in mitigating depressive-like behaviors induced by CUMS [30]. Our results showed that apigenin effectively counteracted the CUMS-induced downregulation of NRF2 expression and significantly enhanced the expression of HO-1 and NQO1. Furthermore, we observed that apigenin ameliorated the CUMS-induced abnormalities in MDA levels, GSH levels and SOD activity in the hippocampus of mice, consistent with a previous study [10]. These findings suggested that apigenin activated the NRF2 signaling pathway to restore redox balance under chronic stress conditions. Taken together, our data support the hypothesis that the alleviatory effects of apigenin on depression-like behaviors in CUMS mice are at least partially associated with the PI3K/AKT/NRF2 pathway and the subsequent reduction in oxidative stress in the hippocampus.

This study demonstrated a significant association between the antidepressant effects of apigenin and activation of the PI3K/AKT/NRF2 pathway, further elucidating its involvement in the restoration of oxidative stress. These findings advanced the mechanistic understanding of apigenin’s neuroprotective actions and provided new perspectives for investigating the antidepressant potential of natural flavonoids.

4. Limitations

Despite these contributions, several limitations should be acknowledged. Firstly, building on well-documented evidence supporting the antidepressant effects of apigenin, this study sought to elucidate its potential mechanisms of action. It should be noted that the experimental design did not include a positive control group receiving established antidepressant medications, thereby limiting direct comparative assessment of therapeutic efficacy between apigenin and conventional treatments. Secondly, we only examined alterations in the PI3K/AKT/NRF2 pathway and oxidative stress levels in the hippocampus, and did not assess the changes in other brain regions. Thirdly, Western blotting (WB) was employed as a complementary technique in the present study to validate the changes observed at the mRNA and biochemical levels, but the statistical power of this analysis is somewhat limited due to the relatively small sample size utilized. Furthermore, the study indicates that sex-based differences in neurobiology contribute to distinct pathophysiological mechanisms in depression [42]. To minimize confounding variability associated with hormonal fluctuations during the estrous cycle, this study exclusively utilized male mice. Future studies will focus on refining the experimental design and further elucidating the molecular mechanisms underlying the antidepressant effects of apigenin.

5. Materials and Methods

5.1. Animals

Mice (male C57BL/6, 6–8 weeks old, 20–22 g; N = 39) were obtained commercially from China Three Gorges University. All mice were supplied with standardized laboratory conditions with free access to standard chow and water. Experimental procedures were approved by the Institutional Animal Care and Welfare Committee of Renmin Hospital of Wuhan University and were carried out in strict accordance (approval code: No. WDRM20200704; approval date: 4 July 2020).

5.2. Experimental Design

After acclimatization and baseline behavioral evaluation, the mice were randomly allocated to four experimental groups: the Con, Cums, Veh, and Api groups, with 4–5 mice housed per cage. The Con group were housed under standard conditions and had food and water available. In contrast, mice in the Cums, Veh, and Api groups were exposed to two randomly selected stressors daily for a consecutive four-week period, and no stressor was repeated on two consecutive days. The mild stressors were established: 24 h water or food deprivation, 24 h reversal of day and night, 24 h cage tilting at 45°, 5 min forced swimming in hot (45 °C) or cold (4 °C) water, 5 min tail clamping, and 2 h restraint stress. Throughout this period, the mice in the Api received daily gavage administration of an apigenin solution at a dose of 40 mg/kg [10]. Apigenin (S31423, Shanghai Yuanye Bio-Technology Co., Ltd., Shanghai, China) was dissolved in a physiological saline solution containing 10% DMSO (Biosharp, Beijing, China), 40% PEG300 (Solarbio, Beijing, China), and 5% Tween-80 (Biosharp, Beijing, China) [43]. While the mice in the Veh were subjected to daily gavage of the blank vehicle at a volume of 10 mL/kg. Following the four-week period, behavioral tests were performed, after which tissues were harvested for subsequent experimental analyses. Data from animals excluded during the experimental process for meeting the predefined exclusion criteria were excluded from the primary analysis. The predefined exclusion criteria were as follows: (1) Unforeseen illness or injury, (2) Errors in drug administration, (3) Unexpected mortality, (4) Sample handling errors. All experimental procedures were conducted in accordance with a standardized protocol of randomization and blinding to ensure the randomness of animal allocation and sample selection, as well as the unawareness of the personnel involved in data collection and analysis regarding the group assignments.

5.3. Behavioral Tests

5.3.1. SPT

All mice were individually housed. On day 1, mice were given access to two bottles of 1% sucrose solution (Biosharp, Beijing, China). On day 2, one sucrose bottle was substituted with water, and bottle positions were switched halfway through the period to prevent side preference. On day 3, food and water deprivation was implemented. On day 4, mice were simultaneously offered one sucrose bottle and one tap water bottle for 24 h, with bottle positions exchanged midway to minimize positional bias. Consumption was quantified by measuring the change in bottle weight before and after exposure. Sucrose preference (%) was calculated using the formula: [sucrose consumption/(sucrose consumption + tap water consumption)] × 100.

5.3.2. OFT

Each mouse was placed in a 55 cm × 55 cm white open field and freely explored for 6 min under lighting conditions. The movement was tracked using Ethovision XT 11.5 software. Rearing behavior was defined as the mouse lifting both forepaws off the floor or making contact with the arena walls. Between trials, the arena was sanitized and air-dried thoroughly to eliminate residual olfactory interference that might influence subsequent mice’s behavior.

5.3.3. FST

Each mouse was forced to swim for 6 min in a transparent cylindrical tank (H: 40 cm, D: 28 cm) with water maintained at 20 cm in depth. The immobility duration was recorded during the final 4 min, with the absence of active swimming or escape-oriented movements.

5.3.4. TST

Each mouse was suspended for 6 min by securing the distal 1–2 cm of its tail to the suspension rod with medical adhesive tape, ensuring that the body remained vertically inverted. The immobility time during the final 4 min was recorded, while the mouse hung without signs of struggle.

5.4. Network Pharmacology Analysis

Network pharmacology analysis was utilized to predict the pathways and core proteins involved in the pathogenesis of depression that are associated with apigenin. Apigenin target screening: The structural file of apigenin was downloaded from the PubChem database (https://pubchem.ncbi.nlm.nih.gov (accessed on 2 October 2025)), then this file was imported into the PharmMapper database (https://www.lilab-ecust.cn/pharmmapper/ (accessed on 2 October 2025)) and the Swiss Target Predic database (https://www.swisstargetprediction.ch (accessed on 2 October 2025)) to identify candidate targets. Depression target screening: In the GeneCards database (https://www.genecards.org (accessed on 2 October 2025)) and the OMIM database (http://www.omim.org (accessed on 2 October 2025)), a comprehensive search for depression targets was conducted using the keywords “MDD” or “major depressive disorder”. The retrieved targets were then consolidated to form a set of disease-specific targets for depression. Following the removal of duplicate entries from both sets of targets, the target data were standardized using the UniProt database (https://www.uniprot.org (accessed on 2 October 2025)). The intersection of these two datasets was then determined to identify the core potential targets underlying the antidepressant effects of apigenin. The R programming language was employed to perform KEGG, GO, and Wikipathway enrichment analyses on the core targets. This was aimed at elucidating the roles of these intersecting targets within various biological processes and pathways. PPI network analysis was performed on these targets and was performed using the STRING database (version 11.5). Only interactions with a confidence score ≥ 900 were included to ensure high reliability of the constructed network. For this analysis, “Homo sapiens” was selected as the species, the confidence score threshold was defined as ≥0.9, and all remaining parameters were kept at their default values. The detailed code for these analyses is provided in the Supplementary Material.

5.5. Quantitative Real-Time Polymerase Chain Reaction (qPCR)

Total RNA was extracted from hippocampi using Triquick Reagent (R1100, Solarbio, China). cDNA was synthesized using a reverse transcription kit (K1621, Thermo Scientific, Waltham, MA, USA). For qPCR, cDNA, primers (

Table 1. The primers.

Gene	Forward Primer	Reverse Primer
Pik3r1	agccgccagctctgataata	tctccccagtaccattcagc
Akt1	ccggttctttgccaacatcg	ctgtccacacactccatgct
Nrf2	aataaagtcgccgcccagaa	gctgagccgccttttcagta
Hmox1	cacgcatatacccgctacct	ccagagtgttcattcgagca
Nqo1	ttctctggccgattcagagt	ggctgcttggagcaaaatag
Gapdh	aactttggcattgtggaagg	acacattgggggtaggaaca

), and PCR Master Mix (172-5122, Bio-Rad, Hercules, CA, USA) were used in a PCR instrument (Bio-Rad, Hercules, CA, USA). Relative quantification was performed using the 2^−ΔΔCt method.

5.6. WB

Total proteins were extracted from hippocampi with RIPA lysis buffer (R0010, Solarbio, Beijing, China). After mixing with loading buffer and denaturation, samples were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Merck Millipore, Carrigtwohill, Ireland). After blocking, membranes were incubated with primary antibodies: anti-PI3K (1:1000, ET1608-70, Huabio, Hangzhou, China), anti-AKT (1:5000, ET1609-51, Huabio, Hangzhou, China), anti-pAKT (1:5000, ET1607-73, Huabio, Hangzhou, China), anti-NRF2 (1:2000, 16396-1-AP, Proteintech, Wuhan, China), anti-HO-1 (1:2000, ER1802-73, Huabio, Hangzhou, China), anti-NQO1 (1:5000, 67240-1-Ig, Proteintech, Wuhan, China), anti-GAPDH (1:15,000, HRP-60004, Proteintech, Wuhan, China), and anti-β-actin (1:10,000, HA601037, Huabio, Hangzhou, China). On the following day, membranes were incubated with anti-rabbit (1:50,000, RGAR001, Proteintech, Wuhan, China) or anti-mouse (1:10,000, RGAM001, Proteintech, Wuhan, China) secondary antibody. Then, blots were visualized using an ECL kit (Biosharp, Beijing, China) with ChemiDoc Touch Imaging System (Bio-Rad, Hercules, CA, USA).

5.7. Detection of MDA, GSH, and SOD

MDA and GSH levels and SOD activity in the hippocampus were measured with the MDA (E-BC-K025-M, Elabscience, Wuhan, China), GSH (E-BC-K030-M, Elabscience, Wuhan, China), and SOD assay kits (E-BC-K020-M, Elabscience, Wuhan, China), respectively. Hippocampal samples from mice were analyzed according to the manufacturers’ protocols.

5.8. Statistical Analysis

Statistical analysis used SPSS 25.0 (IBM Corporation, Armonk, NY, USA). Normality and homogeneity of variance were assessed using the Shapiro–Wilk test and Levene’s test. One-way ANOVA was used, with Tukey’s post hoc test for pairwise comparisons. In cases where the homogeneity of variance assumption was violated, Welch’s ANOVA was used, followed by Dunnett’s T3 post hoc test for pairwise comparisons. A p < 0.05 was considered statistically significant. Data were presented as mean ± standard error of the mean (SEM). Graphs were produced using GraphPad Prism 9.0 (GraphPad, San Diego, CA, USA).

6. Conclusions

This study demonstrated that the amelioration of CUMS-induced depressive-like behaviors in mice by apigenin is associated with the restoration of the PI3K/AKT/NRF2 pathway and oxidative stress. Our findings provide insight into the molecular mechanisms associated with apigenin’s antidepressant-like effects and suggest a potential framework for future exploration of natural flavonoids in depression-related research.