Rhoifolin Suppresses Cell Proliferation and Induces Apoptosis in Hepatocellular Carcinoma Cells In Vitro and In Vivo
Abstract
:1. Introduction
2. Results
2.1. ROF Inhibited the Proliferation of HepG2 and HuH7
2.2. ROF-Induced Apoptosis of HepG2 and HuH7
2.3. ROF-Induced Cell Cycle Arrest in HepG2 and HuH7 HCC Cells
2.4. ROF Inhibits Tumor Growth In Vivo
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Reagents
4.2. Cell Proliferation Assay
4.3. Cell Cycle Analysis
4.4. Apoptosis Assay
4.5. Quantitative Real-Time PCR
4.6. Western Blot Analysis
4.7. Experiments on Subcutaneous Transplantation of HCC Cells
4.8. Histopathological Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Anwanwan, D.; Singh, S.K.; Singh, S.; Saikam, V.; Singh, R. Challenges in liver cancer and possible treatment approaches. Biochim. Biophys. Acta Rev. Cancer 2020, 1873, 188314. [Google Scholar] [CrossRef] [PubMed]
- Ganesan, P.; Kulik, L.M. Hepatocellular Carcinoma: New Developments. Clin. Liver Dis. 2023, 27, 85–102. [Google Scholar] [CrossRef] [PubMed]
- Brown, Z.J.; Tsilimigras, D.I.; Ruff, S.M.; Mohseni, A.; Kamel, I.R.; Cloyd, J.M.; Pawlik, T.M. Management of Hepatocellular Carcinoma: A Review. JAMA Surg. 2023, 158, 410–420. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Yang, C.; Zhang, S.; Geng, H.; Zhu, A.X.; Bernards, R.; Qin, W.; Fan, J.; Wang, C.; Gao, Q. Precision treatment in advanced hepatocellular carcinoma. Cancer Cell 2024, 42, 180–197. [Google Scholar] [CrossRef]
- Syed, D.N.; Adhami, V.M.; Khan, N.; Khan, M.I.; Mukhtar, H. Exploring the molecular targets of dietary flavonoid fisetin in cancer. Semin. Cancer Biol. 2016, 40–41, 130–140. [Google Scholar] [CrossRef]
- Darband, S.G.; Kaviani, M.; Yousefi, B.; Sadighparvar, S.; Pakdel, F.G.; Attari, J.A.; Mohebbi, I.; Naderi, S.; Majidinia, M. Quercetin: A functional dietary flavonoid with potential chemo-preventive properties in colorectal cancer. J. Cell. Physiol. 2018, 233, 6544–6560. [Google Scholar] [CrossRef]
- Saeed, R.A.; Maqsood, M.; Saeed, R.A.; Muzammil, H.S.; Khan, M.I.; Asghar, L.; Nisa, S.U.; Rabail, R.; Aadil, R.M. Plant-based foods and hepatocellular carcinoma: A review on mechanistic understanding. Crit. Rev. Food Sci. Nutr. 2023, 63, 11750–11783. [Google Scholar] [CrossRef]
- Wang, K.; Chen, Q.; Shao, Y.; Yin, S.; Liu, C.; Liu, Y.; Wang, R.; Wang, T.; Qiu, Y.; Yu, H. Anticancer activities of TCM and their active components against tumor metastasis. Biomed. Pharmacother. 2021, 133, 111044. [Google Scholar] [CrossRef]
- Yang, Z.; Bi, Y.; Xu, W.; Guo, R.; Hao, M.; Liang, Y.; Shen, Z.; Yin, L.; Yu, C.; Wang, S.; et al. Glabridin inhibits urothelial bladder carcinoma cell growth in vitro and in vivo by inducing cell apoptosis and cell cycle arrest. Chem. Biol. Drug Des. 2023, 101, 581–592. [Google Scholar] [CrossRef]
- Naz, F.; Wu, Y.; Zhang, N.; Yang, Z.; Yu, C. Anticancer Attributes of Cantharidin: Involved Molecular Mechanisms and Pathways. Molecules 2020, 25, 3279. [Google Scholar] [CrossRef]
- Zhang, J.; Zhou, B.; Sun, J.; Chen, H.; Yang, Z. Betulin ameliorates 7,12-dimethylbenz(a)anthracene-induced rat mammary cancer by modulating MAPK and AhR/Nrf-2 signaling pathway. J. Biochem. Mol. Toxicol. 2021, 35, e22779. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Yin, L.; Hao, M.; Xu, W.; Gao, J.; Sun, Y.; Wang, Q.; Chen, S.; Liang, Y.; Guo, R.; et al. Medicarpin induces G1 arrest and mitochondria-mediated intrinsic apoptotic pathway in bladder cancer cells. Acta Pharm. 2023, 73, 211–225. [Google Scholar] [CrossRef] [PubMed]
- Hu, N.; Liu, J.; Xue, X.; Li, Y. The effect of emodin on liver disease -- comprehensive advances in molecular mechanisms. Eur. J. Pharmacol. 2020, 882, 173269. [Google Scholar] [CrossRef] [PubMed]
- Rahmani, A.H.; Almatroudi, A.; Allemailem, K.S.; Khan, A.A.; Almatroodi, S.A. The Potential Role of Fisetin, a Flavonoid in Cancer Prevention and Treatment. Molecules 2022, 27, 9009. [Google Scholar] [CrossRef] [PubMed]
- Kopustinskiene, D.M.; Jakstas, V.; Savickas, A.; Bernatoniene, J. Flavonoids as Anticancer Agents. Nutrients 2020, 12, 457. [Google Scholar] [CrossRef]
- Sudarshan, K.; Aidhen, I.S. Convenient Synthesis of 3-Glycosylated Isocoumarins. Eur. J. Org. Chem. 2017, 2017, 34–38. [Google Scholar] [CrossRef]
- Ramanan, M.; Sinha, S.; Sudarshan, K.; Aidhen, I.S.; Doble, M. Inhibition of the enzymes in the leukotriene and prostaglandin pathways in inflammation by 3-aryl isocoumarins. Eur. J. Med. Chem. 2016, 124, 428–434. [Google Scholar] [CrossRef]
- Dobrzynska, M.; Napierala, M.; Florek, E. Flavonoid Nanoparticles: A Promising Approach for Cancer Therapy. Biomolecules 2020, 10, 1268. [Google Scholar] [CrossRef]
- Xiong, L.; Lu, H.; Hu, Y.; Wang, W.; Liu, R.; Wan, X.; Fu, J. In vitro anti-motile effects of Rhoifolin, a flavonoid extracted from Callicarpa nudiflora on breast cancer cells via downregulating Podocalyxin-Ezrin interaction during Epithelial Mesenchymal Transition. Phytomedicine Int. J. Phytother. Phytopharm. 2021, 93, 153486. [Google Scholar] [CrossRef]
- Mai, B.; Han, L.; Zhong, J.; Shu, J.; Cao, Z.; Fang, J.; Zhang, X.; Gao, Z.; Xiao, F. Rhoifolin Alleviates Alcoholic Liver Disease In Vivo and In Vitro via Inhibition of the TLR4/NF-κB Signaling Pathway. Front. Pharmacol. 2022, 13, 878898. [Google Scholar] [CrossRef]
- Zheng, B.; Zheng, Y.; Zhang, N.; Zhang, Y.; Zheng, B. Rhoifolin from Plumula Nelumbinis exhibits anti-cancer effects in pancreatic cancer via AKT/JNK signaling pathways. Sci. Rep. 2022, 12, 5654. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.Q.; Li, H.J.; Zeng, Y.H.; Chen, H.H.; Liang, W.Y.; Zhang, J.; Ding, F.P. [Baicalin induces ferroptosis in HepG2 cells by inhibiting ROS-mediated PI3K/Akt/FoxO3a signaling pathway]. Zhongguo Zhong Yao Za Zhi 2024, 49, 1327–1334. [Google Scholar] [CrossRef] [PubMed]
- Fekry, M.I.; Ezzat, S.M.; Salama, M.M.; Alshehri, O.Y.; Al-Abd, A.M. Bioactive glycoalkaloides isolated from Solanum melongena fruit peels with potential anticancer properties against hepatocellular carcinoma cells. Sci. Rep. 2019, 9, 1746. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.J.; Guan, Y.Y.; Qiao, L.X.; Zhang, J.M.; Li, A.J.; Yang, P.X.; Gao, Y.X.; Chen, D.X.; Wang, C.X.; Wu, J. The mechanism and experimental verification of Ixeris sonchifolia promoting apoptosis of hepatocellular carcinoma based on network pharmacology: Ixeris sonchifolia Induces Hepatocellular Carcinoma Apoptosis via the PI3K/AKT Pathway. J. Ethnopharmacol. 2024, 327, 117994. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Qiu, H.; Ou, M.; Chen, R.; Liang, G. Taccaoside induces apoptosis in hepatocellular carcinoma cell lines. J. Int. Med. Res. 2016, 44, 1395–1402. [Google Scholar] [CrossRef]
- Ying, L.; Hao, M.; Zhang, Z.; Guo, R.; Liang, Y.; Yu, C.; Yang, Z. Medicarpin suppresses proliferation and triggeres apoptosis by upregulation of BID, BAX, CASP3, CASP8, and CYCS in glioblastoma. Chem. Biol. Drug Des. 2023, 102, 1097–1109. [Google Scholar] [CrossRef]
- Chen, H.; Qin, J.; Shi, H.; Li, Q.; Zhou, S.; Chen, L. Rhoifolin ameliorates osteoarthritis via the Nrf2/NF-κB axis: In vitro and in vivo experiments. Osteoarthr. Cartil. 2022, 30, 735–745. [Google Scholar] [CrossRef]
Name | Cell Line | IC50 (24 h) | IC50 (48 h) | Mechanism of Action | References |
---|---|---|---|---|---|
Baicalin | HepG2 | 89.27 µg/mL | 89.27 µg/mL | Baicalin elevated ROS levels in HepG2 cells, downregulated p-PI3K/PI3K, p-Akt/Akt, and p-FoxO3a/FoxO3a proteins, and promoted iron death in HepG2 cells. | [22] |
Solanum melongena glycoalkaloids | HuH7 | 9.81 µg/mL 11.14 µg/mL | NA | The isolated glycoalkaloids induced an antiproliferative effect which is attributed to the inhibition of cell cycle progression in the S phase. | [23] |
Ixeris sonchifolia extract | HepG2 | 2.5 µg/mL | 0.5 µg/mL | Ixeris sonchifolia extract induces hepatocellular carcinoma apoptosis via the PI3K/AKT pathway. | [24] |
Rhoifolin | HepG2 and HuH7 | 373.9 µg/mL and 288.7 µg/mL | 208.9 µg/mL and 218.0 µg/mL | BID, BIM, BAX, CASP8, and BAK1, which promote apoptosis, were all increased. | This study |
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
GAPDH | AAGGTGAAGGTCGGAGTCAA | GGAAGATGGTGATGGGATTT |
PIDD1 | GAGCCTCGTCGAGTCTCCAT | GGCCCAGTACAACAGGTGC |
BAX | CCTTTTGCTTCAGGGTTTCA | CAGTTGAAGTTGCCGTCAGA |
CASP8 | TTTGACCACGACCTTTGAAGAG | CCCCTGACAAGCCTGAATAAAAA |
CASP9 | CGAACTAACAGGCAAGCA | AATCCTCCAGAACCAATGTC |
BID | ATGGACCGTAGCATCCCTCC | GTAGGTGCGTAGGTTCTGGT |
BIM | CTGAGTGTGACCGAGAAG | GATTACCTTGTGGCTCTGT |
BAK1 | TCTGGCCCTACACGTCTACC | ACAAACTGGCCCAACAGAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, R.; Sabeel, Z.; Ying, L.; Liang, Y.; Guo, R.; Hao, M.; Chen, X.; Zhang, W.; Dong, J.; Liu, Y.; et al. Rhoifolin Suppresses Cell Proliferation and Induces Apoptosis in Hepatocellular Carcinoma Cells In Vitro and In Vivo. Pharmaceuticals 2025, 18, 79. https://doi.org/10.3390/ph18010079
Chen R, Sabeel Z, Ying L, Liang Y, Guo R, Hao M, Chen X, Zhang W, Dong J, Liu Y, et al. Rhoifolin Suppresses Cell Proliferation and Induces Apoptosis in Hepatocellular Carcinoma Cells In Vitro and In Vivo. Pharmaceuticals. 2025; 18(1):79. https://doi.org/10.3390/ph18010079
Chicago/Turabian StyleChen, Ruolan, Zufa Sabeel, Lu Ying, Youfeng Liang, Rui Guo, Mingxuan Hao, Xiaoyang Chen, Wenjing Zhang, Jian Dong, Yan Liu, and et al. 2025. "Rhoifolin Suppresses Cell Proliferation and Induces Apoptosis in Hepatocellular Carcinoma Cells In Vitro and In Vivo" Pharmaceuticals 18, no. 1: 79. https://doi.org/10.3390/ph18010079
APA StyleChen, R., Sabeel, Z., Ying, L., Liang, Y., Guo, R., Hao, M., Chen, X., Zhang, W., Dong, J., Liu, Y., Yu, C., & Yang, Z. (2025). Rhoifolin Suppresses Cell Proliferation and Induces Apoptosis in Hepatocellular Carcinoma Cells In Vitro and In Vivo. Pharmaceuticals, 18(1), 79. https://doi.org/10.3390/ph18010079