Investigating the Effect and Potential Mechanism of Rhamnetin 3-O-α-Rhamnoside on Acute Liver Injury In Vivo and In Vitro
Abstract
:1. Introduction
2. Results
2.1. Effect of TAA on Liver Morphology of Zebrafish Larvae
2.2. ARR Inhibits TAA-Induced Developmental Toxicity in Zebrafish
2.3. ARR Alleviates TAA-Induced Liver Injury in Zebrafish
2.4. ARR Relieves TAA-Induced Oxidative Stress Levels in Zebrafish Larvae
2.5. ARR Reduces Neutrophil Migration and Inhibits the Expression of Genes Related to NF-κB Signaling Pathway
2.6. ARR Decreases TAA-Stimulated ROS Production and Inflammatory Factor Content in HepG2 Cells
2.7. ARR Inhibits the Activation of the IKKβ/NF-κB Signaling Pathway
2.8. ARR Prevents Nuclear Translocation of NF-κB p65
3. Discussion
4. Materials and Methods
4.1. Chemical Reagents
4.2. Zebrafish Assay
4.2.1. Modeling of Zebrafish Liver Injury
4.2.2. Determination of the ORAC of ARR
4.2.3. ARR Treatment
4.2.4. ROS Measurement
4.2.5. Neutrophil Migration Analysis
4.2.6. Related Enzyme Activity Measurements
4.2.7. Quantitative Real-Time PCR (qPCR) Analysis
4.3. Cell Assay
4.3.1. Cell Viability Assay
4.3.2. Intracellular ROS Assay
4.3.3. Inflammatory Factor Assay
4.3.4. Western Blotting Analysis
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Akhurst, B.; Matthews, V.; Husk, K.; Smyth, M.J.; Abraham, L.J.; Yeoh, G.C. Differential Lymphotoxin-β and Interferon Gamma Signaling During Mouse Liver Regeneration Induced by Chronic and Acute Injury. Hepatology 2005, 41, 327–335. [Google Scholar] [CrossRef] [PubMed]
- Crismale, J.F.; Friedman, S.L. Acute Liver Injury and Decompensated Cirrhosis. Med. Clin. North Am. 2020, 104, 647–662. [Google Scholar] [CrossRef]
- Jiao, F.Z.; Wang, Y.; Zhang, W.B.; Zhang, H.Y.; Chen, Q.; Shi, C.X.; Wang, L.W.; Gong, Z.J. Protective Role of AGK2 on Thioacetamide-Induced Acute Liver Failure in Mice. Life Sci. 2019, 230, 68–75. [Google Scholar] [CrossRef]
- Hrynkiewicz, R.; Niedźwiedzka-Rystwej, P. Etiology of Viral Induced Acute Liver Failure and Defensins as Potential Therapeutic Agents in ALF Treatment. Front. Immunol. 2023, 14, 1153528. [Google Scholar] [CrossRef]
- Zhan, X.; Zhang, J.; Chen, H.; Liu, L.; Zhou, Y.; Zheng, T.; Li, S.; Zhang, Y.X.; Zheng, B.; Gong, Q. Capsaicin Alleviates Acetaminophen-Induced Acute Liver Injury in Mice. Clin. Immunol. 2020, 220, 108578. [Google Scholar] [CrossRef] [PubMed]
- Mohammadi, S.; Ashtary-Larky, D.; Asbaghi, O.; Farrokhi, V.; Jadidi, Y.; Mofidi, F.; Mohammadian, M.; Afrisham, R. Effects of Silymarin Supplementation on Liver and Kidney Functions: A Systematic Review and Dose-Response Meta-Analysis. Phytother. Res. 2024, 38, 2572–2593. [Google Scholar] [CrossRef]
- Ma, J.; Xu, Y.; Zhang, M.; Li, Y. Geraniol Ameliorates Acute Liver Failure Induced by Lipopolysaccharide/D-Galactosamine via Regulating Macrophage Polarization and NLRP3 Inflammasome Activation by PPAR-γ Methylation Geraniol Alleviates Acute Liver Failure. Biochem. Pharmacol. 2023, 210, 115467. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, H.; Wang, X.; Guo, H. Study on Host Selection and Parasitic Characteristics of Loranthus tanakae in Ziwuling, Shaanxi. Genom. Appl. Biol. 2018, 37, 2090–2095. [Google Scholar] [CrossRef]
- Bi, L.; Guan, C.J.; Yang, G.E.; Yang, F.; Yan, H.Y.; Li, Q.S. High-Throughput Transcriptome Sequencing Analysis Provides Preliminary Insights into the Biotransformation Mechanism of Rhodopseudomonas palustris Treated with Alpha-Rhamnetin-3-Rhamnoside. Microbiol. Res. 2016, 185, 1–12. [Google Scholar] [CrossRef]
- Qin, M.; Huang, Q.; Yang, X.; Yu, L.; Tang, Y.; Zhang, C.; Qin, D.; Zou, W.; Deng, J.; Liu, J.; et al. Taxillus chinensis (DC.) Danser: A Comprehensive Review on Botany, Traditional Uses, Phytochemistry, Pharmacology, and Toxicology. Chin. Med. 2022, 17, 136. [Google Scholar] [CrossRef]
- Shen, P.; Lin, W.; Ba, X.; Huang, Y.; Chen, Z.; Han, L.; Qin, K.; Huang, Y.; Tu, S.H. Quercetin-Mediated SIRT1 Activation Attenuates Collagen-Induced Mice Arthritis. J. Ethnopharmacol. 2021, 279, 114213. [Google Scholar] [CrossRef]
- Deng, H.H.; Yan, H.; Bi, L.; Geng, Z.Y.; Wu, X.; Yang, G.E. Biotransformation Characteristics of Loranthus tanakae by Rhodopseudomonas palustris. Cell. Chem. Technol. 2016, 50, 819–829. [Google Scholar]
- Triantafyllou, E.; Pop, O.T.; Possamai, L.A.; Wilhelm, A.; Liaskou, E.; Singanayagam, A.; Bernsmeier, C.; Khamri, W.; Petts, G.; Dargue, R.; et al. MerTK Expressing Hepatic Macrophages Promote the Resolution of Inflammation in Acute Liver Failure. Gut 2018, 67, 333–347. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, Y.; Zhou, P.; Ai, J.; Liu, X.; Zhang, Q.; Wang, Z.X.; Wang, H.Y.; Zhang, W.H.; Zhang, J.; et al. Down-Regulated Cylindromatosis Enhances NF-κB Activation and Aggravates Inflammation in HBV-ACLF Patients. Emerg. Microbes Infect. 2022, 11, 1586–1601. [Google Scholar] [CrossRef]
- Hybertson, B.M.; Gao, B.; Bose, S.K.; McCord, J.M. Oxidative Stress in Health and Disease: The Therapeutic Potential of Nrf2 Activation. Mol. Asp. Med. 2011, 32, 234–246. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Guo, L.; Yang, Y.; Wang, Y.; Xia, S.; Gong, H.; Zhang, B.K.; Yan, M. Dissecting the Crosstalk Between Nrf2 and NF-κB Response Pathways in Drug-Induced Toxicity. Front. Cell Dev. Biol. 2022, 9, 809952. [Google Scholar] [CrossRef] [PubMed]
- Sanjay, S.; Girish, C.; Toi, P.C.; Bobby, Z. Quercetin Modulates NRF2 and NF-κB/TLR-4 Pathways to Protect Against Isoniazid- and rifampicin-induced hepatotoxicity In Vivo. Can. J. Physiol. Pharmacol. 2021, 99, 952–963. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Liu, J.; Zhuang, Y.; Bai, L.P.; Yuan, Q.; Zheng, S.; Liao, K.; Khan, M.A.; Wu, Q.; Luo, C.; et al. Identification of an IKKβ Inhibitor for Inhibition of Inflammation In Vivo and In Vitro. Pharmacol. Res. 2019, 149, 104440. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Svetkauskaite, D.; He, Q.; Kim, J.Y.; Strassheim, D.; Ishizaka, A.; Abraham, E. Involvement of Toll-Like Receptors 2 and 4 in Cellular Activation by High Mobility Group Box 1 Protein. J. Biol. Chem. 2004, 279, 7370–7377. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-κB Signaling in Inflammation. Signal Transduct. Tar. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB Pathway for the Therapy of Diseases: Mechanism and Clinical Study. Signal Transduct. Tar. 2020, 5, 209. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Li, Y.; Xu, X.; Cheng, Y.; Meng, B.; Xu, J.; Xiang, L.; Zhang, J.; He, K.Y.; Tong, J.; et al. Brown Adipose Tissue-Derived Nrg4 Alleviates Endothelial Inflammation and Atherosclerosis in Male Mice. Nat. Metab. 2022, 4, 1573–1590. [Google Scholar] [CrossRef]
- Park, S.; Lee, A.Y.; Lim, J.; Lee, S.; Kim, W.; Yang, Y.; Kim, B.; Kim, J.S.; Chae, S.W.; Na, K.; et al. Loranthus tanakae Franch. & Sav. Suppresses Inflammatory Response in Cigarette Smoke Condensate Exposed Bronchial Epithelial Cells and Mice. Antioxidants 2022, 11, 1885. [Google Scholar] [CrossRef]
- Wang, R.; Li, Z.; Wang, Y.; Gui, J.F. An Apo-14 Promoter-Driven Transgenic Zebrafish That Marks Liver Organogenesis. PLoS ONE 2011, 6, e22555. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Liu, C.; Suliburk, J.; Hsu, J.W.; Muthupillai, R.; Jahoor, F. Supplementing Glycine and N-Acetylcysteine (GlyNAC) in Older Adults Improves Glutathione Deficiency, Oxidative Stress, Mitochondrial Dysfunction, Inflammation, Physical Function, and Aging Hallmarks: A Randomized Clinical Trial. J. Gerontol. A Biol. Sci. Med. Sci. 2023, 78, 75–89. [Google Scholar] [CrossRef] [PubMed]
- Jia, Z.L.; Cen, J.; Wang, J.B.; Zhang, F.; Xia, Q.; Wang, X.; Chen, X.Q.; Wang, R.C.; Hsiao, C.D.; Liu, K.C.; et al. Mechanism of Isoniazid-Induced Hepatotoxicity in Zebrafish Larvae: Activation of ROS-Mediated ERS, Apoptosis and the Nrf2 Pathway. Chemosphere 2019, 227, 541–550. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Sun, Y.; Xie, Y.; Liu, F.; Han, L. Identification of Key Anti-Inflammatory Components of Green Prickly Ash Fruit Based on Zebrafish Model and Activity Tracking Strategy. J. Funct. 2023, 107, 1756–4646. [Google Scholar] [CrossRef]
- Cheng, B.; Zhang, H.; Jia, K.; Li, E.; Zhang, S.; Yu, H.; Cao, Z.G.; Xiong, G.H.; Hu, C.Y.; Lu, H.Q. Effects of Spinetoram on the Developmental Toxicity and Immunotoxicity of Zebrafish. Fish Shellfish Immunol. 2020, 96, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Fazio, M.; Ablain, J.; Chuan, Y.; Langenau, D.M.; Zon, L.I. Zebrafish Patient Avatars in Cancer Biology and Precision Cancer Therapy. Nat. Rev. Cancer 2020, 20, 263–273. [Google Scholar] [CrossRef] [PubMed]
- White, R.M.; Sessa, A.; Burke, C.; Bowman, T.; LeBlanc, J.; Ceol, C.; Bourque, C.; Dovey, M.; Goessling, W.; Burns, C.E.; et al. Transparent Adult Zebrafish as a Tool for In Vivo Transplantation Analysis. Cell Stem Cell 2008, 2, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Goessling, W.; Sadler, K.C. Zebrafish: An Important Tool for Liver Disease Research. Gastroenterology 2015, 149, 1361–1377. [Google Scholar] [CrossRef]
- Ghosh, S.; Sarkar, A.; Bhattacharyya, S.; Sil, P.C. Silymarin Protects Mouse Liver and Kidney from Thioacetamide Induced Toxicity by Scavenging Reactive Oxygen Species and Activating PI3K-Akt Pathway. Front. Pharmacol. 2016, 7, 481. [Google Scholar] [CrossRef] [PubMed]
- Ramakrishna, K.; Sinku, S.; Majumdar, S.; Singh, N.; Gajendra, T.A.; Rani, A.; Krishnamurthy, S. Indole-3-Carbinol Ameliorated the Thioacetamide-Induced Hepatic Encephalopathy in Rats. Toxicology 2023, 492, 153542. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Chen, Q.; Cao, P.; Shi, C.; Zhang, L.; Wang, L.; Gong, Z. AGK2 Pre-Treatment Protects Against Thioacetamide-Induced Acute Liver Failure via Regulating the MFN2-PERK Axis and Ferroptosis Signaling Pathway. Hepatobiliary Pancreat. Dis. Int. 2024, 23, 43–51. [Google Scholar] [CrossRef]
- Hussein, R.M.; Sawy, D.M.; Kandeil, M.A.; Farghaly, H.S. Chlorogenic Acid, Quercetin, Coenzyme Q10 and Silymarin Modulate Keap1-Nrf2/Heme Oxygenase-1 Signaling in Thioacetamide-Induced Acute Liver Toxicity. Life Sci. 2021, 277, 119460. [Google Scholar] [CrossRef]
- Zhou, J.; Ren, K.; Hou, J.; Chen, J.; Yang, G.E. α-Rhamnrtin-3-α-Rhamnoside Exerts Anti-Inflammatory Effects on Lipopolysaccharide-Stimulated RAW264.7 Cells by Abrogating NF-κB and Activating the Nrf2 Signaling Pathway. Mol. Med. Rep. 2021, 24, 799. [Google Scholar] [CrossRef]
- Liu, Y.; Guo, J.; Zhang, J.; Deng, Y.; Xiong, G.; Fu, J.; Wei, L.; Lu, H. Chlorogenic Acid Alleviates Thioacetamide-Induced Toxicity and Promotes Liver Development in Zebrafish (Danio rerio) Through the Wnt Signaling Pathway. Aquat. Toxicol. 2022, 242, 106039. [Google Scholar] [CrossRef]
- Ezhilarasan, D. Molecular Mechanisms in Thioacetamide-Induced Acute and Chronic Liver Injury Models. Environ. Toxicol. Pharmacol. 2023, 99, 104093. [Google Scholar] [CrossRef] [PubMed]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive Oxygen Species in Metabolic and Inflammatory Signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef]
- Liu, P.; Li, Y.; Wang, W.; Bai, Y.; Jia, H.; Yuan, Z.; Yang, Z. Role and Mechanisms of the NF-ĸB Signaling Pathway in Various Developmental Processes. Biomed. Pharmacother. 2022, 153, 113513. [Google Scholar] [CrossRef] [PubMed]
- Vucur, M.; Ghallab, A.; Schneider, A.T.; Adili, A.; Cheng, M.; Castoldi, M.; Singer, M.T.; Büttner, V.; Keysberg, L.S.; Küsgens, L.; et al. Sublethal Necroptosis Signaling Promotes Inflammation and Liver Cancer. Immunity 2023, 56, 1578–1595. [Google Scholar] [CrossRef]
- El-Kashef, D.H.; Serrya, M.S. Sitagliptin Ameliorates Thioacetamide-Induced Acute Liver Injury via Modulating TLR4/NF-KB Signaling Pathway in Mice. Life Sci. 2019, 228, 266–273. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Lin, X.; Lei, Y.; Xu, X.; Zhou, Q.; Chen, Y.; Liu, H.; Jiang, J.; Yang, Y.; Zheng, F.; et al. Aerobic Glycolysis Enhances HBx-Initiated Hepatocellular Carcinogenesis via NF-κBp65/HK2 Signalling. J. Exp. Clin. Cancer Res. 2022, 41, 329. [Google Scholar] [CrossRef]
- Feng, H.; He, Y.; La, L.; Hou, C.; Song, L.; Yang, Q.; Wu, F.; Liu, W.; Hou, L.; Li, Y.; et al. The Flavonoid-Enriched Extract from the Root of Smilax china L. Inhibits Inflammatory Responses via the TLR-4-Mediated Signaling Pathway. J. Ethnopharmacol. 2020, 256, 112785. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.K.; Kim, Y.S.; Choi, S.U.; Ryu, S.Y. Isolation of Flavonol Rhamnosides from Loranthus tanakae and Cytotoxic Effect of Them on Human Tumor Cell Lines. Arch. Pharm. Res. 2004, 27, 44–47. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
β-actin | GTGATGGACTCTGGTGATGGTGTG | AGCCACGCTCGGTCAGGATC |
rela | CGGCAGGTGGCGATAGTGTTC | GGTCTGAGGGCAGGTACTGGAAG |
ikbaB | GAGCTTTACCGAGGCACCACTG | AATCCAACCCGCTGTCCAAACG |
ikbkb | GAGACCAGCATTCAGATCGCCATC | GGAACATCTCTCGCCGCAACC |
cxcl8 | CAGAAAGCCGACGCATTGGAAAAC | GAGCAGAGGGGTCCAGACAGATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, D.; Zhao, B.; Yang, H.; Wang, S.; Geng, Z.; Zhou, J.; Yang, G.; Han, L. Investigating the Effect and Potential Mechanism of Rhamnetin 3-O-α-Rhamnoside on Acute Liver Injury In Vivo and In Vitro. Pharmaceuticals 2025, 18, 116. https://doi.org/10.3390/ph18010116
Deng D, Zhao B, Yang H, Wang S, Geng Z, Zhou J, Yang G, Han L. Investigating the Effect and Potential Mechanism of Rhamnetin 3-O-α-Rhamnoside on Acute Liver Injury In Vivo and In Vitro. Pharmaceuticals. 2025; 18(1):116. https://doi.org/10.3390/ph18010116
Chicago/Turabian StyleDeng, Dandan, Borong Zhao, Hong Yang, Songsong Wang, Ziying Geng, Jiangtao Zhou, Guane Yang, and Liwen Han. 2025. "Investigating the Effect and Potential Mechanism of Rhamnetin 3-O-α-Rhamnoside on Acute Liver Injury In Vivo and In Vitro" Pharmaceuticals 18, no. 1: 116. https://doi.org/10.3390/ph18010116
APA StyleDeng, D., Zhao, B., Yang, H., Wang, S., Geng, Z., Zhou, J., Yang, G., & Han, L. (2025). Investigating the Effect and Potential Mechanism of Rhamnetin 3-O-α-Rhamnoside on Acute Liver Injury In Vivo and In Vitro. Pharmaceuticals, 18(1), 116. https://doi.org/10.3390/ph18010116