The Genetic Landscape of Systemic Rheumatic Diseases: A Comprehensive Multigene-Panel Study Identifying Key Gene Polymorphisms
Abstract
:1. Introduction
1.1. Role of Cytokines and Their Receptors in Systemic Rheumatic Disease
1.2. Role of Key Genes in Autoimmune Rheumatic Diseases
2. Results
3. Discussion
4. Materials and Methods
4.1. Sample Collection and PBMCs Isolation
4.2. Genomic DNA Extraction
4.3. Library Preparation and Genomic DNA Sequencing
4.4. Biostatistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Linos, A.; Worthington, J.W.; O’Fallon, W.M.; Kurland, L.T. The epidemiology of rheumatoid arthritis in Rochester, Minnesota: A study of incidence, prevalence, and mortality. Am. J. Epidemiol. 1980, 111, 87–98. [Google Scholar] [CrossRef] [PubMed]
- Fessel, W.J. Systemic lupus erythematosus in the community. Incidence, prevalence, outcome, and first symptoms; the high prevalence in black women. Arch. Intern. Med. 1974, 134, 1027–1035. [Google Scholar] [CrossRef] [PubMed]
- Masi, A.T. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Subcommittee for scleroderma criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee. Arthritis Rheum. 1980, 23, 581–590. [Google Scholar] [CrossRef] [PubMed]
- Talal, N. Sjögren’s syndrome: Historical overview and clinical spectrum of disease. Rheum. Dis. Clin. N. Am. 1992, 18, 507–515. [Google Scholar] [CrossRef]
- Van Vollenhoven, R.F. Sex differences in rheumatoid arthritis: More than meets the eye. BMC Med. 2009, 7, 12. [Google Scholar] [CrossRef] [PubMed]
- Vervoordeldonk, M.J.B.M.; Tak, P.P. Cytokines in rheumatoid arthritis. Curr. Rheumatol. Rep. 2002, 4, 208–217. [Google Scholar] [CrossRef] [PubMed]
- Asano, Y. Systemic sclerosis. J. Dermatol. 2018, 45, 128–138. [Google Scholar] [CrossRef] [PubMed]
- Negrini, S.; Emmi, G.; Greco, M.; Borro, M.; Sardanelli, F.; Murdaca, G.; Indiveri, F.; Puppo, F. Sjögren’s syndrome: A systemic autoimmune disease. Clin. Exp. Med. 2022, 22, 9–25. [Google Scholar] [CrossRef]
- Ameer, M.A.; Chaudhry, H.; Mushtaq, J.; Khan, O.S.; Babar, M.; Hashim, T.; Zeb, S.; Tariq, M.A.; Patlolla, S.R.; Ali, J.; et al. An Overview of Systemic Lupus Erythematosus (SLE) Pathogenesis, Classification, and Management. Cureus 2022, 14, e30330. [Google Scholar] [CrossRef]
- Passiu, G.; Erre, G.L.; Pirina, P.; Sechi, L.A. Clinical utility of anti-lipoarabinomannan antibodies testing for the diagnosis of tuberculous arthritis. Springerplus 2015, 4, 63. [Google Scholar] [CrossRef]
- Erre, G.L.; Mameli, G.; Cossu, D.; Muzzeddu, B.; Piras, C.; Paccagnini, D.; Passiu, G.; Sechi, L.A. Increased Epstein-Barr Virus DNA Load and Antibodies Against EBNA1 and EA in Sardinian Patients with Rheumatoid Arthritis. Viral Immunol. 2015, 28, 385–390. [Google Scholar] [CrossRef]
- Bo, M.; Erre, G.L.; Bach, H.; Slavin, Y.N.; Manchia, P.A.; Passiu, G.; Sechi, L.A. PtpA and PknG Proteins Secreted by Mycobacterium avium subsp. paratuberculosis are Recognized by Sera from Patients with Rheumatoid Arthritis: A Case-Control Study. J. Inflamm. Res. 2019, 12, 301–308. [Google Scholar] [CrossRef] [PubMed]
- Smith, A.J.P.; Humphries, S.E. Cytokine and cytokine receptor gene polymorphisms and their functionality. Cytokine Growth Factor Rev. 2009, 20, 43–59. [Google Scholar] [CrossRef] [PubMed]
- Jang, D.-I.; Lee, A.-H.; Shin, H.-Y.; Song, H.-R.; Park, J.-H.; Kang, T.-B.; Lee, S.-R.; Yang, S.-H. The Role of Tumor Necrosis Factor Alpha (TNF-α) in Autoimmune Disease and Current TNF-α Inhibitors in Therapeutics. Int. J. Mol. Sci. 2021, 22, 2719. [Google Scholar] [CrossRef] [PubMed]
- Chabaud, M.; Lubberts, E.; Joosten, L.; van Den Berg, W.; Miossec, P. IL-17 derived from juxta-articular bone and synovium contributes to joint degradation in rheumatoid arthritis. Arthritis Res. 2001, 3, 168–177. [Google Scholar] [CrossRef] [PubMed]
- Powell, M.D.; Read, K.A.; Sreekumar, B.K.; Jones, D.M.; Oestreich, K.J. IL-12 signaling drives the differentiation and function of a T(H)1-derived T(FH1)-like cell population. Sci. Rep. 2019, 9, 13991. [Google Scholar] [CrossRef] [PubMed]
- Haskó, G.; Szabó, C. IL-12 as a therapeutic target for pharmacological modulation in immune-mediated and inflammatory diseases: Regulation of T helper 1/T helper 2 responses. Br. J. Pharmacol. 1999, 127, 1295–1304. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Tian, B. IFN-γ promotes the development of systemic lupus erythematosus through the IFNGR1/2-PSTAT1-TBX21 signaling axis. Am. J. Transl. Res. 2022, 14, 6874–6888. [Google Scholar] [PubMed]
- Ihim, S.A.; Abubakar, S.D.; Zian, Z.; Sasaki, T.; Saffarioun, M.; Maleknia, S.; Azizi, G. Interleukin-18 cytokine in immunity, inflammation, and autoimmunity: Biological role in induction, regulation, and treatment. Front. Immunol. 2022, 13, 919973. [Google Scholar] [CrossRef] [PubMed]
- Begovich, A.B.; Carlton, V.E.H.; Honigberg, L.A.; Schrodi, S.J.; Chokkalingam, A.P.; Alexander, H.C.; Ardlie, K.G.; Huang, Q.; Smith, A.M.; Spoerke, J.M.; et al. A Missense Single-Nucleotide Polymorphism in a Gene Encoding a Protein Tyrosine Phosphatase (PTPN22) Is Associated with Rheumatoid Arthritis. Am. J. Hum. Genet. 2004, 75, 330–337. [Google Scholar] [CrossRef] [PubMed]
- Kyogoku, C.; Langefeld, C.D.; Ortmann, W.A.; Lee, A.; Selby, S.; Carlton, V.E.H.; Chang, M.; Ramos, P.; Baechler, E.C.; Batliwalla, F.M.; et al. Genetic association of the R620W polymorphism of protein tyrosine phosphatase PTPN22 with human SLE. Am. J. Hum. Genet. 2004, 75, 504–507. [Google Scholar] [CrossRef] [PubMed]
- Thomas, R. The TRAF6-NF kappa B signaling pathway in autoimmunity: Not just inflammation. Arthritis Res. Ther. 2005, 7, 170–173. [Google Scholar] [CrossRef] [PubMed]
- Tizaoui, K.; Terrazzino, S.; Cargnin, S.; Lee, K.H.; Gauckler, P.; Li, H.; Shin, J.I.; Kronbichler, A. The role of PTPN22 in the pathogenesis of autoimmune diseases: A comprehensive review. Semin. Arthritis Rheum. 2021, 51, 513–522. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Tao, Y.; Hu, F.; Liu, X. Diminished LAG3+ B cells correlate with exacerbated rheumatoid arthritis. Ann. Med. 2023, 55, 2208373. [Google Scholar] [CrossRef] [PubMed]
- Turner, A.J. ACE2 Cell Biology, Regulation, and Physiological Functions. In The Protective Arm of the Renin Angiotensin System (RAS); Academic Press: Cambridge, MA, USA, 2015; pp. 185–189. [Google Scholar]
- Kongsbak, M.; Levring, T.B.; Geisler, C.; von Essen, M.R. The vitamin d receptor and T cell function. Front. Immunol. 2013, 4, 148. [Google Scholar] [CrossRef] [PubMed]
- Niño-Moreno, P.; Turrubiartes-Martínez, E.; Oceguera-Maldonado, B.; Baltazar-Benítez, N.; Negrete-González, C.; Oliva-Ramírez, B.; Baranda, L.; González-Amaro, R. The Role of NRAMP1/SLC11A1 Gene Variant D543N (1730G/A) in the Genetic Susceptibility to Develop Rheumatoid Arthritis in the Mexican Mestizo population. Rev. Investig. Clin. Organo Del Hosp. Enfermedades La Nutr. 2017, 69, 5–10. [Google Scholar] [CrossRef] [PubMed]
- Jung, Y.Y.; Son, D.J.; Lee, H.L.; Kim, D.H.; Song, M.J.; Ham, Y.W.; Kim, Y.; Han, S.B.; Park, M.H.; Hong, J.T. Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation. Redox Biol. 2017, 12, 666–673. [Google Scholar] [CrossRef] [PubMed]
- Clavel, C.; Nogueira, L.; Laurent, L.; Iobagiu, C.; Vincent, C.; Sebbag, M.; Serre, G. Induction of macrophage secretion of tumor necrosis factor alpha through Fcgamma receptor IIa engagement by rheumatoid arthritis-specific autoantibodies to citrullinated proteins complexed with fibrinogen. Arthritis Rheum. 2008, 58, 678–688. [Google Scholar] [CrossRef] [PubMed]
- Alam, J.; Jantan, I.; Bukhari, S.N.A. Rheumatoid arthritis: Recent advances on its etiology, role of cytokines and pharmacotherapy. Biomed. Pharmacother. 2017, 92, 615–633. [Google Scholar] [CrossRef] [PubMed]
- Ciobanu, D.A.; Poenariu, I.S.; Crînguș, L.-I.; Vreju, F.A.; Turcu-Stiolica, A.; Tica, A.A.; Padureanu, V.; Dumitrascu, R.M.; Banicioiu-Covei, S.; Dinescu, S.C.; et al. JAK/STAT pathway in pathology of rheumatoid arthritis (Review). Exp. Ther. Med. 2020, 20, 3498–3503. [Google Scholar] [CrossRef] [PubMed]
- Spadaro, A.; Scrivo, R.; Rinaldi, T.; Riccieri, V.; Sili Scavalli, A.; Taccari, E.; Valesini, G. The role of interleukin-12 in immune-mediated rheumatic diseases. Reumatismo 2002, 54, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Yan, W.; Zheng, H.; Du, Q.; Zhang, L.; Ban, Y.; Li, N.; Wei, F. Regulation of IL-10 and IL-12 production and function in macrophages and dendritic cells. F1000Research 2015, 4, 1465. [Google Scholar] [CrossRef]
- Hamza, T.; Barnett, J.B.; Li, B. Interleukin 12 a key immunoregulatory cytokine in infection applications. Int. J. Mol. Sci. 2010, 11, 789–806. [Google Scholar] [CrossRef] [PubMed]
- Ullrich, K.A.-M.; Schulze, L.L.; Paap, E.-M.; Müller, T.M.; Neurath, M.F.; Zundler, S. Immunology of IL-12: An update on functional activities and implications for disease. EXCLI J. 2020, 19, 1563–1589. [Google Scholar] [CrossRef]
- Morita, Y.; Yamamura, M.; Nishida, K.; Harada, S.; Okamoto, H.; Inoue, H.; Ohmoto, Y.; Modlin, R.L.; Makino, H. Expression of interleukin-12 in synovial tissue from patients with rheumatoid arthritis. Arthritis Rheum. 1998, 41, 306–314. [Google Scholar] [CrossRef] [PubMed]
- Zwerina, J.; Hayer, S.; Tohidast-Akrad, M.; Bergmeister, H.; Redlich, K.; Feige, U.; Dunstan, C.; Kollias, G.; Steiner, G.; Smolen, J.; et al. Single and combined inhibition of tumor necrosis factor, interleukin-1, and RANKL pathways in tumor necrosis factor-induced arthritis: Effects on synovial inflammation, bone erosion, and cartilage destruction. Arthritis Rheum. 2004, 50, 277–290. [Google Scholar] [CrossRef]
- Luo, P.; Wang, P.; Xu, J.; Hou, W.; Xu, P.; Xu, K.; Liu, L. Immunomodulatory role of T helper cells in rheumatoid arthritis: A comprehensive research review. Bone Jt. Res. 2022, 11, 426–438. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Liu, N.; Sigdel, K.R.; Duan, L. Role of NLRP3 Inflammasome in Rheumatoid Arthritis. Front. Immunol. 2022, 13, 931690. [Google Scholar] [CrossRef]
- De Zoete, M.R.; Palm, N.W.; Zhu, S.; Flavell, R.A. Inflammasomes. Cold Spring Harb. Perspect. Biol. 2014, 6, a016287. [Google Scholar] [CrossRef] [PubMed]
- Spadaro, A.; Rinaldi, T.; Riccieri, V.; Taccari, E.; Valesini, G. Interleukin-13 in autoimmune rheumatic diseases: Relationship with the autoantibody profile. Clin. Exp. Rheumatol. 2002, 20, 213–216. [Google Scholar]
- Arend, W.P.; Gabay, C. Cytokines in the rheumatic diseases. Rheum. Dis. Clin. N. Am. 2004, 30, 41–67. [Google Scholar] [CrossRef] [PubMed]
- Feldmann, M.; Brennan, F.M.; Maini, R.N. Role of cytokines in rheumatoid arthritis. Annu. Rev. Immunol. 1996, 14, 397–440. [Google Scholar] [CrossRef] [PubMed]
- Wassmann, S.; Stumpf, M.; Strehlow, K.; Schmid, A.; Schieffer, B.; Böhm, M.; Nickenig, G. Interleukin-6 induces oxidative stress and endothelial dysfunction by overexpression of the angiotensin II type 1 receptor. Circ. Res. 2004, 94, 534–541. [Google Scholar] [CrossRef] [PubMed]
- Aliyu, M.; Zohora, F.T.; Anka, A.U.; Ali, K.; Maleknia, S.; Saffarioun, M.; Azizi, G. Interleukin-6 cytokine: An overview of the immune regulation, immune dysregulation, and therapeutic approach. Int. Immunopharmacol. 2022, 111, 109130. [Google Scholar] [CrossRef] [PubMed]
- Ding, H.; Wang, G.; Yu, Z.; Sun, H.; Wang, L. Role of interferon-gamma (IFN-γ) and IFN-γ receptor 1/2 (IFNγR1/2) in regulation of immunity, infection, and cancer development: IFN-γ-dependent or independent pathway. Biomed. Pharmacother. 2022, 155, 113683. [Google Scholar] [CrossRef]
- Wu, Y.; Li, M.; Zeng, J.; Feng, Z.; Yang, J.; Shen, B.; Zeng, Y. Differential Expression of Renin-Angiotensin System-related Components in Patients with Rheumatoid Arthritis and Osteoarthritis. Am. J. Med. Sci. 2020, 359, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues Prestes, T.R.; Rocha, N.P.; Miranda, A.S.; Teixeira, A.L.; Simoes-E-Silva, A.C. The Anti-Inflammatory Potential of ACE2/Angiotensin-(1-7)/Mas Receptor Axis: Evidence from Basic and Clinical Research. Curr. Drug Targets 2017, 18, 1301–1313. [Google Scholar] [CrossRef] [PubMed]
- Moreira, F.R.C.; de Oliveira, T.A.; Ramos, N.E.; Abreu, M.A.D.; Simões E Silva, A.C. The role of renin angiotensin system in the pathophysiology of rheumatoid arthritis. Mol. Biol. Rep. 2021, 48, 6619–6629. [Google Scholar] [CrossRef] [PubMed]
- MacDonald, I.J.; Liu, S.-C.; Su, C.-M.; Wang, Y.-H.; Tsai, C.-H.; Tang, C.-H. Implications of Angiogenesis Involvement in Arthritis. Int. J. Mol. Sci. 2018, 19, 2012. [Google Scholar] [CrossRef] [PubMed]
- Al-Azzawi, I.S.; Mohammed, N.S. The Impact of Angiotensin Converting Enzyme-2 (ACE-2) on Bone Remodeling Marker Osteoprotegerin (OPG) in Post-COVID-19 Iraqi Patients. Cureus 2022, 14, e29926. [Google Scholar] [CrossRef] [PubMed]
- Walsh, D.A.; Catravas, J.; Wharton, J. Angiotensin converting enzyme in human synovium: Increased stromal [(125)I]351A binding in rheumatoid arthritis. Ann. Rheum. Dis. 2000, 59, 125–131. [Google Scholar] [CrossRef]
- Bhoola, K.D.; Elson, C.J.; Dieppe, P.A. Kinins—Key mediators in inflammatory arthritis? Br. J. Rheumatol. 1992, 31, 509–518. [Google Scholar] [CrossRef]
- Okwan-Duodu, D.; Landry, J.; Shen, X.Z.; Diaz, R. Angiotensin-converting enzyme and the tumor microenvironment: Mechanisms beyond angiogenesis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 305, R205–R215. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Lu, H.; Zhao, M.; Tashiro, K.; Cassis, L.A.; Daugherty, A. Contributions of leukocyte angiotensin-converting enzyme to development of atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 2075–2080. [Google Scholar] [CrossRef] [PubMed]
- Koch, A.E. Review: Angiogenesis: Implications for rheumatoid arthritis. Arthritis Rheum. 1998, 41, 951–962. [Google Scholar] [CrossRef] [PubMed]
- Manning, J.E.; Lewis, J.W.; Marsh, L.-J.; McGettrick, H.M. Insights Into Leukocyte Trafficking in Inflammatory Arthritis—Imaging the Joint. Front. Cell. Dev. Biol. 2021, 9, 635102. [Google Scholar] [CrossRef] [PubMed]
- Sagawa, K.; Nagatani, K.; Komagata, Y.; Yamamoto, K. Angiotensin receptor blockers suppress antigen-specific T cell responses and ameliorate collagen-induced arthritis in mice. Arthritis Rheum. 2005, 52, 1920–1928. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Gao, F.; Li, B.; Wang, H.; Xu, Y.; Zhu, C.; Wang, G. Parkin mono-ubiquitinates Bcl-2 and regulates autophagy. J. Biol. Chem. 2010, 285, 38214–38223. [Google Scholar] [CrossRef]
- Celia, A.I.; Colafrancesco, S.; Barbati, C.; Alessandri, C.; Conti, F. Autophagy in Rheumatic Diseases: Role in the Pathogenesis and Therapeutic Approaches. Cells 2022, 11, 1359. [Google Scholar] [CrossRef]
- Krishnamurthy, A.; Joshua, V.; Haj Hensvold, A.; Jin, T.; Sun, M.; Vivar, N.; Ytterberg, A.J.; Engström, M.; Fernandes-Cerqueira, C.; Amara, K.; et al. Identification of a novel chemokine-dependent molecular mechanism underlying rheumatoid arthritis-associated autoantibody-mediated bone loss. Ann. Rheum. Dis. 2016, 75, 721–729. [Google Scholar] [CrossRef]
- Wigerblad, G.; Bas, D.B.; Fernades-Cerqueira, C.; Krishnamurthy, A.; Nandakumar, K.S.; Rogoz, K.; Kato, J.; Sandor, K.; Su, J.; Jimenez-Andrade, J.M.; et al. Autoantibodies to citrullinated proteins induce joint pain independent of inflammation via a chemokine-dependent mechanism. Ann. Rheum. Dis. 2016, 75, 730–738. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, K.; Sugiyama, D.; Kogata, Y.; Tsuji, G.; Nakazawa, T.; Kawano, S.; Saigo, K.; Morinobu, A.; Koshiba, M.; Kuntz, K.M.; et al. Meta-analysis: Diagnostic accuracy of anti-cyclic citrullinated peptide antibody and rheumatoid factor for rheumatoid arthritis. Ann. Intern. Med. 2007, 146, 797–808. [Google Scholar] [CrossRef] [PubMed]
- Bizzaro, N.; Bartoloni, E.; Morozzi, G.; Manganelli, S.; Riccieri, V.; Sabatini, P.; Filippini, M.; Tampoia, M.; Afeltra, A.; Sebastiani, G.; et al. Anti-cyclic citrullinated peptide antibody titer predicts time to rheumatoid arthritis onset in patients with undifferentiated arthritis: Results from a 2-year prospective study. Arthritis Res. Ther. 2013, 15, R16. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Qin, H.; Xu, J. The role of autophagy in the pathogenesis of systemic lupus erythematosus. Int. Immunopharmacol. 2016, 40, 351–361. [Google Scholar] [CrossRef] [PubMed]
- Colafrancesco, S.; Vomero, M.; Iannizzotto, V.; Minniti, A.; Barbati, C.; Arienzo, F.; Mastromanno, L.; Colasanti, T.; Izzo, R.; Nayar, S.; et al. Autophagy occurs in lymphocytes infiltrating Sjögren’s syndrome minor salivary glands and correlates with histological severity of salivary gland lesions. Arthritis Res. Ther. 2020, 22, 238. [Google Scholar] [CrossRef] [PubMed]
- Ferrell, W.R.; Lockhart, J.C.; Kelso, E.B.; Dunning, L.; Plevin, R.; Meek, S.E.; Smith, A.J.H.; Hunter, G.D.; McLean, J.S.; McGarry, F.; et al. Essential role for proteinase-activated receptor-2 in arthritis. J. Clin. Investig. 2003, 111, 35–41. [Google Scholar] [CrossRef] [PubMed]
- McCulloch, K.; McGrath, S.; Huesa, C.; Dunning, L.; Litherland, G.; Crilly, A.; Hultin, L.; Ferrell, W.R.; Lockhart, J.C.; Goodyear, C.S. Rheumatic Disease: Protease-Activated Receptor-2 in Synovial Joint Pathobiology. Front. Endocrinol. 2018, 9, 257. [Google Scholar] [CrossRef]
- Begovich, A.B.; Caillier, S.J.; Alexander, H.C.; Penko, J.M.; Hauser, S.L.; Barcellos, L.F.; Oksenberg, J.R. The R620W polymorphism of the protein tyrosine phosphatase PTPN22 is not associated with multiple sclerosis. Am. J. Hum. Genet. 2005, 76, 184–187. [Google Scholar] [CrossRef] [PubMed]
- Hedges, J.F.; Kimmel, E.; Snyder, D.T.; Jerome, M.; Jutila, M.A. Solute carrier 11A1 is expressed by innate lymphocytes and augments their activation. J. Immunol. 2013, 190, 4263–4273. [Google Scholar] [CrossRef] [PubMed]
- Awomoyi, A.A. The human solute carrier family 11 member 1 protein (SLC11A1): Linking infections, autoimmunity and cancer? FEMS Immunol. Med. Microbiol. 2007, 49, 324–329. [Google Scholar] [CrossRef] [PubMed]
- Cham, C.M.; Ko, K.; Niewold, T.B. Interferon regulatory factor 5 in the pathogenesis of systemic lupus erythematosus. Clin. Dev. Immunol. 2012, 2012, 780436. [Google Scholar] [CrossRef] [PubMed]
- Almuttaqi, H.; Udalova, I.A. Advances and challenges in targeting IRF5, a key regulator of inflammation. FEBS J. 2019, 286, 1624–1637. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB pathway for the therapy of diseases: Mechanism and clinical study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wu, X.; Jiang, M.; Tai, G. Mechanism by which TRAF6 Participates in the Immune Regulation of Autoimmune Diseases and Cancer. BioMed Res. Int. 2020, 2020, 4607197. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Gabarre, D.; Carnero-Espejo, A.; Ávila, J.; García-Escudero, V. What’s in a Gene? The Outstanding Diversity of MAPT. Cells 2022, 11, 840. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zhang, L.; Liu, P.; Peng, G. Autoimmunity and Frontotemporal Lobar Degeneration: From Laboratory Study to Clinical Practice. Clin. Interv. Aging 2023, 18, 495–503. [Google Scholar] [CrossRef] [PubMed]
- Bottini, N.; Peterson, E.J. Tyrosine phosphatase PTPN22: Multifunctional regulator of immune signaling, development, and disease. Annu. Rev. Immunol. 2014, 32, 83–119. [Google Scholar] [CrossRef]
- Bates, D.; Mächler, M.; Bolker, B.; Walker, S. Fitting Linear Mixed-Effects Models Using lme4. J. Stat. Softw. 2015, 67, 1–48. [Google Scholar] [CrossRef]
Gene | Position | Mutation | Estimate | Std. Error | t Value | Pr(>|t|) |
---|---|---|---|---|---|---|
ACE | chr17_61560763 | T → C rs4311 intronic | −0.18308 | 0.08180 | −2.238 | 0.0272 * |
chr17_61562063 | G → C rs12720722 intronic | −0.86364 | 0.43233 | −1.998 | 0.0481 * | |
chr17_61564533 | C → G rs55907121 intronic | −0.86364 | 0.43233 | −1.998 | 0.0481 * | |
IL-12A | chr3_159713467 | G → A rs568408 3′UTR | 0.28182 | 0.16042 | 1.757 | 0.0816. |
PARK2 | chr6_161781225 | C → T rs1801334 missense | −0.39006 | 0.19423 | −2.008 | 0.0470 * |
chr6_161990516 | G → C rs3765475 intronic | −0.20270 | 0.07892 | −2.568 | 0.0115 * | |
chr6_162394341 | C → T rs146173584 missense | −0.87114 | 0.42823 | −2.034 | 0.0442 * | |
LAG3 | chr12_6883722 | T → C rs201769189 intronic | −0.74359 | 0.44040 | −1.688 | 0.094. |
ACE2 | chrX_15589725 | C → G rs4646168 intronic | −0.76316 | 0.42701 | −1.787 | 0.0766. |
chrX_15590120 | T → C rs2301692 intronic | −0.76316 | 0.30325 | −2.517 | 0.0132 * | |
chrX_15613148 | T → C - intronic | −0.76316 | 0.42701 | −1.787 | 0.0766. | |
IFNG | chr12_68551941 | A → G - intronic | −0.74359 | 0.44040 | −1.688 | 0.094. |
IL-17A | chr6_52053771 | C → T rs17881747 intronic | −0.74359 | 0.44040 | −1.688 | 0.094. |
IL-18 | chr11_112020916 | T → G rs549908 synonymous | −0.24638 | 0.08060 | −3.057 | 0.00278 ** |
IL-18R1 | chr2_103010912 | C → T rs1420096 intronic | −0.32080 | 0.08225 | −3.900 | 0.000162 *** |
chr2_103013408 | C → T rs7570821 3′UTR | 0.21779 | 0.08666 | 2.513 | 0.013349 * | |
IL-4R | chr16_27353479 | C → T rs17548704 synonymous | −0.35221 | 0.20020 | −1.759 | 0.0812. |
IL-5 | chr5_131878992 | A → C - intronic | −0.74359 | 0.44040 | −1.688 | 0.094. |
IL-6 | chr7_22767433 | A → G rs2069832 intronic | −0.18301 | 0.08813 | −2.077 | 0.0401 * |
chr7_22768249 | G → T rs2066992 intronic | −0.25826 | 0.15166 | −1.703 | 0.0913. | |
IL-7R | chr5_35857235 | C → G rs1494561 intronic | −0.39327 | 0.09232 | −4.260 | 4.22 × 10−5 *** |
chr5_35861159 | A → G rs969128 intronic | −0.18606 | 0.08934 | −2.083 | 0.0395 * | |
chr5_35871190 | G → A rs1494555 missense | 0.21247 | 0.09005 | 2.359 | 0.0200 * | |
IRF5 | chr7_128586057 | C → T rs139688977 synonymous | −0.75652 | 0.24991 | −3.027 | 0.00304 ** |
MAPT | chr17_44060845 | T → C - synonymous | −0.86111 | 0.43926 | −1.960 | 0.0524. |
chr17_44101591 | GA → G, GAA - 3′UTR | 0.16975 | 0.08679 | 1.956 | 0.0529. | |
TMPRSS2 | chr21_42866107 | T → C rs2838042 intronic | −0.27348 | 0.09034 | −3.027 | 0.00304 ** |
TRAF6 | chr11_36518824 | T → TA rs3830511 splicing | −0.22306 | 0.08279 | −2.694 | 0.00811 ** |
VDR | chr12_48272821 | C → A - missense | −0.74359 | 0.44040 | −1.688 | 0.094. |
IFNGR1 | chr6_137519780 | T → C rs3799488 splicing | −0.28000 | 0.11064 | −2.531 | 0.0127 * |
IL-12RB1 | chr19_18184462 | G → A - intronic | −0.74359 | 0.44040 | −1.688 | 0.094. |
IL-12RB2 | chr1_67833867 | C → T rs145750129 intronic | −0.85714 | 0.43712 | −1.961 | 0.0523. |
chr1_67852335 | G → A rs2228420 synonymous | −0.17714 | 0.08326 | −2.128 | 0.0355 * |
Gene | Position | Odds Ratio | CI_Low (2.5%) ° | CI_High (97.5%) ° |
---|---|---|---|---|
ACE | chr17_61560763 | 0.833 | 0.709 | 0.978 |
chr17_61562063 | 0.422 | 0.181 | 0.984 | |
chr17_61564533 | 0.422 | 0.181 | 0.984 | |
IL-12A | chr3_159713467 | 1.326 | 0.968 | 1.815 |
PARK2 | chr6_161781225 | 0.677 | 0.463 | 0.991 |
chr6_161990516 | 0.817 | 0.700 | 0.953 | |
chr6_162394341 | 0.418 | 0.181 | 0.969 | |
LAG3 | chr12_6883722 | 0.475 | 0.201 | 1.127 |
ACE2 | chrX_15589725 | 0.466 | 0.202 | 1.077 |
chrX_15590120 | 0.466 | 0.257 | 0.845 | |
chrX_15613148 | 0.466 | 0.202 | 1.077 | |
IFNG | chr12_68551941 | 0.475 | 0.201 | 1.127 |
IL-17A | chr6_52053771 | 0.475 | 0.201 | 1.127 |
IL-18 | chr11_112020916 | 0.782 | 0.667 | 0.915 |
IL-18R1 | chr2_103010912 | 0.726 | 0.618 | 0.852 |
chr2_103013408 | 1.243 | 1.049 | 1.473 | |
IL-4R | chr16_27353479 | 0.703 | 0.475 | 1.041 |
IL-5 | chr5_131878992 | 0.475 | 0.201 | 1.127 |
IL-6 | chr7_22767433 | 0.833 | 0.701 | 0.99 |
chr7_22768249 | 0.772 | 0.574 | 1.04 | |
IL-7R | chr5_35857235 | 0.675 | 0.563 | 0.809 |
chr5_35861159 | 0.830 | 0.697 | 0.989 | |
chr5_35871190 | 1.237 | 1.037 | 1.475 | |
IRF5 | chr7_128586057 | 0.469 | 0.288 | 0.766 |
MAPT | chr17_44060845 | 0.423 | 0.179 | 1.000 |
chr17_44101591 | 1.185 | 1.000 | 1.405 | |
TMPRSS2 | chr21_42866107 | 0.761 | 0.637 | 0.908 |
TRAF6 | chr11_36518824 | 0.8 | 0.68 | 0.941 |
VDR | chr12_48272821 | 0.475 | 0.201 | 1.127 |
IFNGR1 | chr6_137519780 | 0.756 | 0.608 | 0.939 |
IL-12RB1 | chr19_18184462 | 0.475 | 0.201 | 1.127 |
IL-12RB2 | chr1_67833867 | 0.424 | 0.180 | 1.000 |
chr1_67852335 | 0.838 | 0.712 | 0.986 |
Gene | Position | Mutation | Estimate | Std. Error | t Value | Pr(>|t|) |
---|---|---|---|---|---|---|
ACE | chr17_61566031 | G → A rs4343 synonymous | −0.34968 | 0.12749 | −2.743 | 0.00825 ** |
PARK2 | chr6_161990516 | G → C rs3765475 intronic | −0.42529 | 0.12239 | −3.475 | 0.00102 ** |
TMEM50B | chr21_34804966 | T → C rs1532 3′UTR | −0.3948 | 0.1762 | −2.241 | 0.0292 * |
ACE2 | chrX_15596143 | C → CATAAG rs113691336 intronic | −0.30952 | 0.15045 | −2.057 | 0.0445 * |
ATG7 | chr3_11596348 | C → T rs14016 3′UTR | −0.30000 | 0.17185 | −1.746 | 0.0866. |
IL-13 | chr5_131995843 | T → C rs1295686 intronic | −0.6200 | 0.2018 | −3.072 | 0.00332 ** |
IL-18 | chr11_112014152 | C → G rs360728 3′UTR | −0.29167 | 0.12811 | −2.277 | 0.02686 * |
chr11_112020916 | T → G rs549908 synonymous | −0.34375 | 0.12404 | −2.771 | 0.00768 ** | |
IL-18R1 | chr2_102984624 | C → G rs1362348 intronic | 0.33233 | 0.14883 | 2.233 | 0.03006 * |
chr2_102984671 | T → A rs1882348 intronic | 0.39441 | 0.14562 | 2.709 | 0.00923 ** | |
chr2_102984684 | G → A rs1558627 intronic | −0.54781 | 0.17369 | −3.154 | 0.00272 ** | |
chr2_103010912 | C → T rs1420096 intronic | −0.56936 | 0.16700 | −3.409 | 0.00130 ** | |
chr2_103013408 | C → T rs7570821 3′UTR | 0.28678 | 0.12573 | 2.281 | 0.02685 * | |
IL-4R | chr16_27358098 | A → C rs2301807 intronic | −0.7436 | 0.1533 | −4.849 | 1.21 × 10−5 *** |
chr16_27366982 | T → C rs3024636 intronic | 0.4103 | 0.1818 | 2.256 | 0.0284 * | |
chr16_27370209 | A → G - intronic | 0.7436 | 0.4199 | 1.771 | 0.0826. | |
chr16_27375070 | T → C rs3024679 synonymous | 0.7436 | 0.4199 | 1.771 | 0.0826. | |
IL-6 | chr7_22767433 | A → G rs2069832 intronic | −0.4570 | 0.1333 | −3.427 | 0.00117 ** |
IL-7R | chr5_35861152 | C → G rs11567705 intronic | −0.4486 | 0.1307 | −3.432 | 0.00117 ** |
chr5_35876274 | A → G rs3194051 missense | −0.4220 | 0.1253 | −3.367 | 0.00142 ** | |
IRF5 | chr7_128586057 | C → T rs139688977 synonymous | −0.5263 | 0.2776 | −1.896 | 0.0635. |
chr7_128587351 | CACTCTGCAGCCGCCCACTCTGCGGCCGCCT → C rs199508964; rs60344245 nonframeshift | 0.3596 | 0.1533 | 2.347 | 0.0228 * | |
chr7_128587724 | C → T rs190039770 intronic | 0.4737 | 0.2776 | 1.706 | 0.0939. | |
NR1I2 | chr3_119501506 | T → G rs3814056 intronic | 0.7143 | 0.3349 | 2.133 | 0.03760 * |
chr3_119526349 | G → A rs1464603 intronic | −0.3985 | 0.1313 | −3.036 | 0.00372 ** | |
PTPN22 | chr1_114400590 | C → T rs55730164 intronic | −0.49020 | 0.22767 | −2.153 | 0.0358 * |
TRAF6 | chr11_36518824 | T → TA rs3830511 splicing | −0.5048 | 0.1217 | −4.148 | 0.000119 *** |
IFNGR1 | chr6_137519780 | T → C rs3799488 splicing | −0.42174 | 0.16705 | −2.525 | 0.0146 * |
IL-12RB1 | chr19_18170384 | G → A rs3746190 3′UTR | 0.4263 | 0.1794 | 2.376 | 0.02121 * |
chr19_18171886 | A → G rs383483 intronic | −0.5586 | 0.1827 | −3.057 | 0.00352 ** | |
chr19_18173179 | C → T - intronic | 1.0226 | 0.5000 | 2.045 | 0.04592 * |
Gene | Position | Odds Ratio | CI_Low (2.5%) ° | CI_High (97.5%) ° |
---|---|---|---|---|
ACE | chr17_61566031 | 0.705 | 0.549 | 0.905 |
PARK2 | chr6_161990516 | 0.654 | 0.514 | 0.831 |
TMEM50B | chr21_34804966 | 0.674 | 0.477 | 0.952 |
ACE2 | chrX_15596143 | 0.734 | 0.546 | 0.985 |
ATG7 | chr3_11596348 | 0.741 | 0.529 | 1.038 |
IL-13 | chr5_131995843 | 0.538 | 0.362 | 0.799 |
IL-18 | chr11_112014152 | 0.747 | 0.581 | 0.960 |
chr11_112020916 | 0.709 | 0.556 | 0.904 | |
IL-18R1 | chr2_102984624 | 1.394 | 1.041 | 1.866 |
chr2_102984671 | 1.484 | 1.115 | 1.974 | |
chr2_102984684 | 0.578 | 0.411 | 0.813 | |
chr2_103010912 | 0.566 | 0.408 | 0.785 | |
chr2_103013408 | 1.332 | 1.041 | 1.704 | |
IL-4R | chr16_27358098 | 0.475 | 0.352 | 0.642 |
chr16_27366982 | 1.507 | 1.055 | 2.153 | |
chr16_27370209 | 2.103 | 0.924 | 4.791 | |
chr16_27375070 | 2.103 | 0.924 | 4.791 | |
IL-6 | chr7_22767433 | 0.633 | 0.488 | 0.822 |
IL-7R | chr5_35861152 | 0.639 | 0.494 | 0.825 |
chr5_35876274 | 0.656 | 0.513 | 0.838 | |
IRF5 | chr7_128586057 | 0.591 | 0.343 | 1.01 |
chr7_128587351 | 1.433 | 1.061 | 1.935 | |
chr7_128587724 | 1.606 | 0.932 | 2.767 | |
NR1I2 | chr3_119501506 | 2.043 | 1.060 | 3.938 |
chr3_119526349 | 0.671 | 0.519 | 0.868 | |
PTPN22 | chr1_114400590 | 0.613 | 0.392 | 0.957 |
TRAF6 | chr11_36518824 | 0.604 | 0.476 | 0.766 |
IFNGR1 | chr6_137519780 | 0.656 | 0.473 | 0.91 |
IL-12RB1 | chr19_18170384 | 1.532 | 1.078 | 2.177 |
chr19_18171886 | 0.572 | 0.400 | 0.818 | |
chr19_18173179 | 2.780 | 1.044 | 7.408 |
Gene | Position | Mutation | Estimate | Std. Error | t Value | Pr(>|t|) |
---|---|---|---|---|---|---|
PARK2 | chr6_161771219 | G → A rs149953814 missense | 0.5417 | 0.2599 | 2.084 | 0.043746 * |
chr6_161990516 | G → C rs3765475 intronic | −0.3417 | 0.1397 | −2.446 | 0.019066 * | |
chr6_162394341 | C → T rs146173584 missense | −1.0083 | 0.5096 | −1.979 | 0.054942. | |
IL-18 | chr11_112020916 | T → G rs549908 synonymous | −0.29221 | 0.13250 | −2.205 | 0.0331 * |
IL-18R1 | chr2_103010912 | C → T rs1420096 intronic | −0.5376 | 0.1317 | −4.083 | 0.000201 *** |
IRF5 | chr7_128586760 | C → T rs73461593 3′UTR | 0.75610 | 0.31097 | 2.431 | 0.019498 * |
MAPT | chr17_44051927 | T → C rs148721531 5′UTR | 0.75610 | 0.31097 | 2.431 | 0.019498 * |
PTPN22 | chr1_114414021 | CTT → C, CT, CTTT - intronic | −0.4821 | 0.1327 | −3.634 | 0.00077 *** |
SLC11A1 | chr2_219256076 | T → G rs368624123 intronic | 1.000 | 4.399 × 10−1 | 2.273 | 0.0285 * |
chr2_219259270 | G → A rs2279015 intronic | 3.548 × 10−1 | 1.478 × 10−1 | 2.400 | 0.0211 * | |
TMPRSS2 | chr21_42842854 | C → A rs465576 intronic | −0.8611 | 0.1339 | −6.433 | 1.05 × 10−7 *** |
TRAF6 | chr11_36518824 | T → TA rs3830511 splicing | −0.3580 | 0.1505 | −2.378 | 0.02213 * |
IL-12RB1 | chr19_18170773 | A → G rs199686420 synonymous | 0.61081 | 0.19171 | 3.186 | 0.0028 ** |
chr19_18180367 | G → A rs748284308 missense | 0.81081 | 0.40776 | 1.988 | 0.0536. | |
IL-12RB2 | chr1_67833501 | G → A rs2252596 splicing | 0.4232 | 0.2443 | 1.732 | 0.09093. |
chr1_67852335 | G → A rs2228420 synonymous | −0.3925 | 0.1306 | −3.006 | 0.00456 ** |
Gene | Position | Odds Ratio | CI_Low (2.5%) ° | CI_High (97.5%) ° |
---|---|---|---|---|
PARK2 | chr6_161771219 | 1.719 | 1.033 | 2.861 |
chr6_161990516 | 0.711 | 0.540 | 0.934 | |
chr6_162394341 | 0.365 | 0.134 | 0.990 | |
IL-18 | chr11_112020916 | 0.747 | 0.576 | 0.968 |
IL-18R1 | chr2_103010912 | 0.584 | 0.451 | 0.756 |
IRF5 | chr7_128586760 | 2.13 | 1.158 | 3.918 |
MAPT | chr17_44051927 | 2.13 | 1.158 | 3.918 |
PTPN22 | chr1_114414021 | 0.618 | 0.476 | 0.801 |
SLC11A1 | chr2_219256076 | 2.718 | 1.148 | 6.438 |
chr2_219259270 | 1.426 | 1.067 | 1.905 | |
TMPRSS2 | chr21_42842854 | 0.423 | 0.325 | 0.549 |
TRAF6 | chr11_36518824 | 0.699 | 0.521 | 0.939 |
IL-12RB1 | chr19_18170773 | 1.842 | 1.265 | 2.682 |
chr19_18180367 | 2.250 | 1.012 | 5.003 | |
IL-12RB2 | chr1_67833501 | 1.527 | 0.946 | 2.465 |
chr1_67852335 | 0.675 | 0.523 | 0.872 |
Gene | Position | Mutation | Estimate | Std. Error | t Value | Pr(>|t|) |
---|---|---|---|---|---|---|
IL-12A | chr3_159713467 | G → A rs568408 3′UTR | 0.5439 | 0.2925 | 1.859 | 0.068. |
ACE2 | chrX_15596143 | C → CATAAG rs113691336 intronic | 0.37054 | 0.12220 | 3.032 | 0.00363 ** |
IL-18 | chr11_112014152 | C → G rs360728 3′UTR | 0.3992 | 0.1310 | 3.049 | 0.00346 ** |
IL-18R1 | chr2_103013408 | C → T rs7570821 3′UTR | 0.29397 | 0.13567 | 2.167 | 0.0344 * |
IL-2 | chr4_123377482 | C → A rs2069763 synonymous | 0.2658 | 0.1266 | 2.100 | 0.040067 * |
IL-4R | chr16_27373980 | C → T rs1805013 missense | −1.00000 | 0.57080 | −1.752 | 0.0852. |
chr16_27374927 | T → G rs1805016 missense | 0.53571 | 0.29295 | 1.829 | 0.0727. | |
IRF5 | chr7_128586057 | C → T rs139688977 synonymous | −0.54902 | 0.28870 | −1.902 | 0.0623. |
chr7_128588475 | C → A rs75282194 intronic | −0.38235 | 0.20974 | −1.823 | 0.0735. | |
NR1I2 | chr3_119501506 | T → G rs3814056 intronic | 0.5439 | 0.2925 | 1.859 | 0.068. |
IFNGR1 | chr6_137519588 | A → C rs11914 synonymous | 0.33714 | 0.12552 | 2.686 | 0.00942 ** |
Gene | Position | Odds Ratio | CI_Low (2.5%) ° | CI_High (97.5%) ° |
---|---|---|---|---|
IL-12A | chr3_159713467 | 1.723 | 0.971 | 3.056 |
ACE2 | chrX_15596143 | 1.449 | 1.14 | 1.84 |
IL-18 | chr11_112014152 | 1.491 | 1.153 | 1.927 |
IL-18R1 | chr2_103013408 | 1.342 | 1.028 | 1.75 |
IL-2 | chr4_123377482 | 1.305 | 1.018 | 1.672 |
IL-4R | chr16_27373980 | 0.368 | 0.120 | 1.126 |
chr16_27374927 | 1.709 | 0.962 | 3.034 | |
IRF5 | chr7_128586057 | 0.578 | 0.328 | 1.017 |
chr7_128588475 | 0.682 | 0.452 | 1.029 | |
NR1I2 | chr3_119501506 | 1.723 | 0.971 | 3.056 |
IFNGR1 | chr6_137519588 | 1.401 | 1.095 | 1.792 |
Gene | Position | Mutation | Estimate | Std. Error | t Value | Pr(>|t|) |
---|---|---|---|---|---|---|
IL-12A | chr3_159713467 | G → A rs568408 3′UTR | 0.64583 | 0.24387 | 2.648 | 0.0108 * |
PARK2 | chr6_161781225 | C → T rs1801334 missense | −0.52273 | 0.25695 | −2.034 | 0.047349 * |
chr6_161990516 | G → C rs3765475 intronic | −0.47727 | 0.11991 | −3.980 | 0.000227 *** | |
TMEM50B | chr21_34804966 | T → C rs1532 3′UTR | −0.3587 | 0.1969 | −1.822 | 0.074420. |
IL-18 | chr11_112020916 | T → G rs549908 synonymous | −0.46364 | 0.12421 | −3.733 | 0.000485 *** |
IL-18R1 | chr2_102984684 | G → A rs1558627 intronic | −0.37222 | 0.12595 | −2.955 | 0.004869 ** |
chr2_103010912 | C → T rs1420096 intronic | −0.40153 | 0.13407 | −2.995 | 0.004370 ** | |
chr2_103013388 | TG → T rs11465656; rs397897634 3′UTR | 0.96845 | 0.26910 | 3.599 | 0.000766 *** | |
chr2_103013408 | C → T rs7570821 3′UTR | 0.30197 | 0.12154 | 2.485 | 0.016587 * | |
IL-2RA | chr10_6061730 | TC → T rs28360486 intronic | −0.44681 | 0.22674 | −1.971 | 0.0543. |
IL-4R | chr16_27373966 | C → T rs2234899 synonymous | 0.64583 | 0.24387 | 2.648 | 0.0108 * |
IL-6 | chr7_22767433 | A → G rs2069832 intronic | −0.4248 | 0.1444 | −2.941 | 0.00495 ** |
MAPT | chr17_44101591 | GA → G, GAA - 3′UTR | 0.36134 | 0.13882 | 2.603 | 0.012132 * |
TMPRSS2 | chr21_42866107 | T → C rs2838042 intronic | −0.33782 | 0.14000 | −2.413 | 0.0195 * |
VDR | chr12_48238837 | C → A rs7975232 intronic | 0.3147 | 0.1711 | 1.839 | 0.0722. |
chr12_48250921 | T → G - missense | 0.9306 | 0.4901 | 1.899 | 0.0637. | |
chr12_48259057 | T → C rs529794948 intronic | 0.9306 | 0.4901 | 1.899 | 0.0637. | |
chr12_48272895 | A → G rs2228570 startloss | −0.3751 | 0.1895 | −1.980 | 0.0536. | |
IFNGR1 | chr6_137519780 | T → C rs3799488 splicing | −0.3762 | 0.1678 | −2.241 | 0.0295 * |
IFNGR2 | chr21_34805196 | TC → T, * rs193922682 intronic | 0.31944 | 0.14340 | 2.228 | 0.030433 * |
IL-12RB1 | chr19_18191621 | G → T rs11673460 intronic | 0.52381 | 0.18933 | 2.767 | 0.00792 ** |
IL-12RB2 | chr1_67852335 | G → A rs2228420 synonymous | −0.3589 | 0.1349 | −2.661 | 0.0105 * |
Gene | Position | Odds Ratio | CI_Low (2.5%) ° | CI_High (97.5%) ° |
---|---|---|---|---|
IL-12A | chr3_159713467 | 1.908 | 1.183 | 3.077 |
PARK2 | chr6_161781225 | 0.593 | 0.358 | 0.981 |
chr6_161990516 | 0.620 | 0.491 | 0.785 | |
TMEM50B | chr21_34804966 | 0.699 | 0.475 | 1.028 |
IL-18 | chr11_112020916 | 0.629 | 0.493 | 0.802 |
IL-18R1 | chr2_102984684 | 0.689 | 0.538 | 0.882 |
chr2_103010912 | 0.669 | 0.515 | 0.870 | |
chr2_103013388 | 2.634 | 1.554 | 4.463 | |
chr2_103013408 | 1.353 | 1.066 | 1.716 | |
IL-2RA | chr10_6061730 | 0.64 | 0.41 | 0.998 |
IL4R | chr16_27373966 | 1.908 | 1.183 | 3.077 |
IL-6 | chr7_22767433 | 0.654 | 0.493 | 0.868 |
MAPT | chr17_44101591 | 1.435 | 1.093 | 1.884 |
TMPRSS2 | chr21_42866107 | 0.713 | 0.542 | 0.939 |
VDR | chr12_48238837 | 1.370 | 0.980 | 1.916 |
chr12_48250921 | 2.536 | 0.970 | 6.627 | |
chr12_48259057 | 2.536 | 0.970 | 6.627 | |
chr12_48272895 | 0.687 | 0.474 | 0.996 | |
IFNGR1 | chr6_137519780 | 0.686 | 0.494 | 0.954 |
IFNGR2 | chr21_34805196 | 1.376 | 1.039 | 1.823 |
IL-12RB1 | chr19_18191621 | 1.688 | 1.165 | 2.447 |
IL-12RB2 | chr1_67852335 | 0.698 | 0.536 | 0.91 |
Gene Name | Position | Conditions | Risk | ClinVar (PMID: 29165669) | ||
---|---|---|---|---|---|---|
Reduced | Increased | Conditions | Clinical Significance | |||
ACE | chr17_61560763 | SRDs | ✓ | Benign | ||
chr17_61562063 | SRDs | ✓ | ||||
chr17_61564533 | SRDs | ✓ | ||||
chr17_61566031 | AR | ✓ |
| Benign | ||
IL-12A | chr3_159713467 | SS | ✓ | |||
PARK2 | chr6_161781225 | SRDs, SS | ✓ |
| Benign/likely benign | |
chr6_161990516 | SRDs, AR, SLE, SS | ✓ | Benign | |||
chr6_162394341 | SRDs | ✓ |
| Uncertain significance | ||
chr6_161771219 | SLE | ✓ |
| Conflicting interpretations of pathogenicity | ||
ACE2 | chrX_15590120 | SRDs | ✓ | |||
chrX_15596143 | AR | ✓ | ||||
SLE | ✓ | |||||
IL-18 | chr11_112020916 | SRDs, AR, SLE, SS | ✓ |
| Benign | |
chr11_112014152 | AR | ✓ | ||||
SSc | ✓ | |||||
IL-18R1 | chr2_103010912 | SRDs, AR, SLE, SS | ✓ | |||
chr2_102984684 | AR, SS | ✓ | ||||
chr2_102984624 | AR | ✓ | ||||
chr2_103013408 | SRDs, AR, SSc, SS | ✓ | ||||
chr2_102984671 | AR | ✓ | ||||
IL-4R | chr16_27358098 | AR | ✓ | |||
chr16_27366982 | AR | ✓ | ||||
chr16_27373966 | SS | ✓ | ||||
IL-6 | chr7_22767433 | SRDs, AR, SS | ✓ | |||
IL-7R | chr5_35857235 | SRDs | ✓ | Benign | ||
chr5_35861159 | SRDs | ✓ | ||||
chr5_35861152 | AR | ✓ | Benign | |||
chr5_35876274 | AR | ✓ |
| Benign | ||
chr5_35871190 | SRDs | ✓ |
| Likely benign | ||
IRF5 | chr7_128586057 | SRDs | ✓ | Likely benign | ||
chr7_128587315 | AR | ✓ | ||||
chr7_128586760 | SLE | ✓ | ||||
MAPT | chr17_44051927 | SLE | ✓ | |||
chr17_44101591 | SS | ✓ | ||||
TMPRSS2 | chr21_42866107 | SRDs, SS | ✓ | |||
chr21_42842854 | SLE | ✓ | ||||
TRAF6 | chr11_36518824 | SRDs, AR, SLE | ✓ | Benign | ||
IFNGR1 | chr6_137519780 | SRDs, AR, SS | ✓ |
| Benign | |
chr6_137519588 | SSc | ✓ | ||||
IL-12RB1 | chr19_18171886 | AR | ✓ | |||
chr19_18170384 | AR | ✓ | ||||
chr19_18173179 | AR | ✓ | ||||
chr19_18170773 | SLE | ✓ |
| Conflicting interpretations of pathogenicity | ||
chr19_18191621 | SS | ✓ | ||||
IL-12RB2 | chr1_67852335 | SRDs, SLE, SS | ✓ | Benign | ||
TMEM50B | chr21_34804966 | AR | ✓ | |||
IL-13 | chr5_131995843 | AR | ✓ | |||
NR1I2 | chr3_119526349 | AR | ✓ | |||
chr3_119501506 | AR | ✓ | ||||
PTPN22 | chr1_114400590 | AR | ✓ | |||
chr1_114414021 | SLE | ✓ | ||||
SLC11A1 | chr2_219256076 | SLE | ✓ | |||
chr2_219259270 | SLE | ✓ | ||||
IL-2 | chr4_123377482 | SSc | ✓ | |||
IFNGR2 | chr21_34805196 | SS | ✓ |
| Benign |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Simula, E.R.; Jasemi, S.; Cossu, D.; Manca, P.C.; Sanna, D.; Scarpa, F.; Meloni, G.; Cusano, R.; Sechi, L.A. The Genetic Landscape of Systemic Rheumatic Diseases: A Comprehensive Multigene-Panel Study Identifying Key Gene Polymorphisms. Pharmaceuticals 2024, 17, 438. https://doi.org/10.3390/ph17040438
Simula ER, Jasemi S, Cossu D, Manca PC, Sanna D, Scarpa F, Meloni G, Cusano R, Sechi LA. The Genetic Landscape of Systemic Rheumatic Diseases: A Comprehensive Multigene-Panel Study Identifying Key Gene Polymorphisms. Pharmaceuticals. 2024; 17(4):438. https://doi.org/10.3390/ph17040438
Chicago/Turabian StyleSimula, Elena Rita, Seyedesomaye Jasemi, Davide Cossu, Pietro Carmelo Manca, Daria Sanna, Fabio Scarpa, Gianfranco Meloni, Roberto Cusano, and Leonardo Antonio Sechi. 2024. "The Genetic Landscape of Systemic Rheumatic Diseases: A Comprehensive Multigene-Panel Study Identifying Key Gene Polymorphisms" Pharmaceuticals 17, no. 4: 438. https://doi.org/10.3390/ph17040438
APA StyleSimula, E. R., Jasemi, S., Cossu, D., Manca, P. C., Sanna, D., Scarpa, F., Meloni, G., Cusano, R., & Sechi, L. A. (2024). The Genetic Landscape of Systemic Rheumatic Diseases: A Comprehensive Multigene-Panel Study Identifying Key Gene Polymorphisms. Pharmaceuticals, 17(4), 438. https://doi.org/10.3390/ph17040438