Sulfarotene Inhibits Colorectal Cancer via Mitigating Natural-Killer-Cell-Induced Stemness
Abstract
1. Introduction
2. Results
2.1. Co-Culturing with NK Cells Induces Stem-like Phenotypes of CRC Cells
2.2. Stem-like Altered CRC Cells Demonstrate Cytotoxic Resistance but Vulnerability to Sulfarotene
2.3. Different Gene Expression Profile between NK Cells from Periphery and MSS-Type CRC
2.4. Sulfarotene Further Augments the Effect of Anti-TIGIT Immunotherapy In Vivo
2.5. Sulfarotene Reverse Stemness Alteration Induced by Unleashed NK Activity
3. Discussion
4. Materials and Methods
4.1. Data Availability and scRNA-seq Analyses
4.2. Mouse Model
4.3. Cell Lines and Cell Culture
4.4. CCK-8 Assays
4.5. Single-Cell Suspension Preparation
4.6. Flow Cytometry
4.7. qPCR
4.8. IHC Staining
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Keum, N.; Giovannucci, E. Global burden of colorectal cancer: Emerging trends, risk factors and prevention strategies. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 713–732. [Google Scholar] [CrossRef]
- Feng, W.; Huang, W.; Chen, J.; Qiao, C.; Liu, D.; Ji, X.; Xie, M.; Zhang, T.; Wang, Y.; Sun, M.; et al. CXCL12-mediated HOXB5 overexpression facilitates Colorectal Cancer metastasis through transactivating CXCR4 and ITGB3. Theranostics 2021, 11, 2612–2633. [Google Scholar] [CrossRef]
- Herbertson, R.A.; Lee, S.T.; Tebbutt, N.; Scott, A.M. The expanding role of PET technology in the management of patients with colorectal cancer. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 2007, 18, 1774–1781. [Google Scholar] [CrossRef]
- Sun, Q.; Hong, Z.; Zhang, C.; Wang, L.; Han, Z.; Ma, D. Immune checkpoint therapy for solid tumours: Clinical dilemmas and future trends. Signal Transduct. Target. Ther. 2023, 8, 320. [Google Scholar] [CrossRef]
- Weng, J.; Li, S.; Zhu, Z.; Liu, Q.; Zhang, R.; Yang, Y.; Li, X. Exploring immunotherapy in colorectal cancer. J. Hematol. Oncol. 2022, 15, 95. [Google Scholar] [CrossRef]
- Janjigian, Y.Y.; Shitara, K.; Moehler, M.; Garrido, M.; Salman, P.; Shen, L.; Wyrwicz, L.; Yamaguchi, K.; Skoczylas, T.; Campos Bragagnoli, A.; et al. First-line nivolumab plus chemotherapy versus chemotherapy alone for advanced gastric, gastro-oesophageal junction, and oesophageal adenocarcinoma (CheckMate 649): A randomised, open-label, phase 3 trial. Lancet 2021, 398, 27–40. [Google Scholar] [CrossRef]
- Liu, B.; Zhang, Y.; Wang, D.; Hu, X.; Zhang, Z. Single-cell meta-analyses reveal responses of tumor-reactive CXCL13(+) T cells to immune-checkpoint blockade. Nat. Cancer 2022, 3, 1123–1136. [Google Scholar] [CrossRef] [PubMed]
- House, I.G.; Savas, P.; Lai, J.; Chen, A.X.Y.; Oliver, A.J.; Teo, Z.L.; Todd, K.L.; Henderson, M.A.; Giuffrida, L.; Petley, E.V.; et al. Macrophage-Derived CXCL9 and CXCL10 Are Required for Antitumor Immune Responses Following Immune Checkpoint Blockade. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2020, 26, 487–504. [Google Scholar] [CrossRef] [PubMed]
- Hsu, J.; Hodgins, J.J.; Marathe, M.; Nicolai, C.J.; Bourgeois-Daigneault, M.C.; Trevino, T.N.; Azimi, C.S.; Scheer, A.K.; Randolph, H.E.; Thompson, T.W.; et al. Contribution of NK cells to immunotherapy mediated by PD-1/PD-L1 blockade. J. Clin. Investig. 2018, 128, 4654–4668. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.Y.; Fu, T.; Jiang, Y.Z.; Shao, Z.M. Natural killer cells in cancer biology and therapy. Mol. Cancer 2020, 19, 120. [Google Scholar] [CrossRef] [PubMed]
- Harjunpää, H.; Guillerey, C. TIGIT as an emerging immune checkpoint. Clin. Exp. Immunol. 2020, 200, 108–119. [Google Scholar] [CrossRef] [PubMed]
- Brazel, D.; Ou, S.I.; Nagasaka, M. Tiragolumab (Anti-TIGIT) in SCLC: Skyscraper-02, a Towering Inferno. Lung Cancer 2023, 14, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Vlashi, E.; Pajonk, F. Cancer stem cells, cancer cell plasticity and radiation therapy. Semin. Cancer Biol. 2015, 31, 28–35. [Google Scholar] [CrossRef] [PubMed]
- Nassar, D.; Blanpain, C. Cancer Stem Cells: Basic Concepts and Therapeutic Implications. Annu. Rev. Pathol. 2016, 11, 47–76. [Google Scholar] [CrossRef] [PubMed]
- Meacham, C.E.; Morrison, S.J. Tumour heterogeneity and cancer cell plasticity. Nature 2013, 501, 328–337. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Mayea, Y.; Mir, C.; Masson, F.; Paciucci, R.; ME, L.L. Insights into new mechanisms and models of cancer stem cell multidrug resistance. Semin. Cancer Biol. 2020, 60, 166–180. [Google Scholar] [CrossRef] [PubMed]
- Milanovic, M.; Fan, D.N.Y.; Belenki, D.; Däbritz, J.H.M.; Zhao, Z.; Yu, Y.; Dörr, J.R.; Dimitrova, L.; Lenze, D.; Monteiro Barbosa, I.A.; et al. Senescence-associated reprogramming promotes cancer stemness. Nature 2018, 553, 96–100. [Google Scholar] [CrossRef]
- Beziaud, L.; Young, C.M.; Alonso, A.M.; Norkin, M.; Minafra, A.R.; Huelsken, J. IFNγ-induced stem-like state of cancer cells as a driver of metastatic progression following immunotherapy. Cell Stem. Cell 2023, 30, 818–831.e816. [Google Scholar] [CrossRef]
- Wei, S.; Kozono, S.; Kats, L.; Nechama, M.; Li, W.; Guarnerio, J.; Luo, M.; You, M.H.; Yao, Y.; Kondo, A.; et al. Active Pin1 is a key target of all-trans retinoic acid in acute promyelocytic leukemia and breast cancer. Nat. Med. 2015, 21, 457–466. [Google Scholar] [CrossRef]
- Qi, F.; Qin, W.; Zhang, Y.; Luo, Y.; Niu, B.; An, Q.; Yang, B.; Shi, K.; Yu, Z.; Chen, J.; et al. Sulfarotene, a synthetic retinoid, overcomes stemness and sorafenib resistance of hepatocellular carcinoma via suppressing SOS2-RAS pathway. J. Exp. Clin. Cancer Res. CR 2021, 40, 280. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Cao, X.; An, Q.; Zhang, Y.; Li, K.; Yao, W.; Shi, F.; Pan, Y.; Jia, Q.; Zhou, W.; et al. Inhibition of cancer stem cell like cells by a synthetic retinoid. Nat. Commun. 2018, 9, 1406. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, Z.; Skrzypczynska, K.M.; Fang, Q.; Zhang, W.; O’Brien, S.A.; He, Y.; Wang, L.; Zhang, Q.; Kim, A.; et al. Single-Cell Analyses Inform Mechanisms of Myeloid-Targeted Therapies in Colon Cancer. Cell 2020, 181, 442–459.e429. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.P.; Lv, L.; Liu, Y.; Smith, M.D.; Li, W.C.; Tan, X.M.; Cheng, M.; Li, Z.; Bovino, M.; Aubé, J.; et al. Tumor suppressor TET2 promotes cancer immunity and immunotherapy efficacy. J. Clin. Investig. 2019, 129, 4316–4331. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, K.L.; Finlay, D.K. Immunometabolism and natural killer cell responses. Nat. Rev. Immunol. 2019, 19, 282–290. [Google Scholar] [CrossRef] [PubMed]
- Baraibar, I.; Mirallas, O.; Saoudi, N.; Ros, J.; Salvà, F.; Tabernero, J.; Élez, E. Combined Treatment with Immunotherapy-Based Strategies for MSS Metastatic Colorectal Cancer. Cancers 2021, 13, 6311. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Wang, Y.; Liu, D.; Wang, X.; Xu, C.; Yu, Y.; Cui, Y.; Tang, C.; Li, Q.; Sun, J.; et al. The Neo-PLANET phase II trial of neoadjuvant camrelizumab plus concurrent chemoradiotherapy in locally advanced adenocarcinoma of stomach or gastroesophageal junction. Nat. Commun. 2022, 13, 6807. [Google Scholar] [CrossRef] [PubMed]
- Yoon, H.H.; Jin, Z.; Kour, O.; Kankeu Fonkoua, L.A.; Shitara, K.; Gibson, M.K.; Prokop, L.J.; Moehler, M.; Kang, Y.K.; Shi, Q.; et al. Association of PD-L1 Expression and Other Variables with Benefit From Immune Checkpoint Inhibition in Advanced Gastroesophageal Cancer: Systematic Review and Meta-analysis of 17 Phase 3 Randomized Clinical Trials. JAMA Oncol. 2022, 8, 1456–1465. [Google Scholar] [CrossRef]
- Noepel-Duennebacke, S.; Juette, H.; Schulmann, K.; Graeven, U.; Porschen, R.; Stoehlmacher, J.; Hegewisch-Becker, S.; Raulf, A.; Arnold, D.; Reinacher-Schick, A.; et al. Microsatellite instability (MSI-H) is associated with a high immunoscore but not with PD-L1 expression or increased survival in patients (pts.) with metastatic colorectal cancer (mCRC) treated with oxaliplatin (ox) and fluoropyrimidine (FP) with and without bevacizumab (bev): A pooled analysis of the AIO KRK 0207 and RO91 trials. J. Cancer Res. Clin. Oncol. 2021, 147, 3063–3072. [Google Scholar]
- Zhang, Q.; Bi, J.; Zheng, X.; Chen, Y.; Wang, H.; Wu, W.; Wang, Z.; Wu, Q.; Peng, H.; Wei, H.; et al. Blockade of the checkpoint receptor TIGIT prevents NK cell exhaustion and elicits potent anti-tumor immunity. Nat. Immunol. 2018, 19, 723–732. [Google Scholar] [CrossRef]
- Yu, X.; Harden, K.; Gonzalez, L.C.; Francesco, M.; Chiang, E.; Irving, B.; Tom, I.; Ivelja, S.; Refino, C.J.; Clark, H.; et al. The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat. Immunol. 2009, 10, 48–57. [Google Scholar] [CrossRef]
- Joller, N.; Lozano, E.; Burkett, P.R.; Patel, B.; Xiao, S.; Zhu, C.; Xia, J.; Tan, T.G.; Sefik, E.; Yajnik, V.; et al. Treg cells expressing the coinhibitory molecule TIGIT selectively inhibit proinflammatory Th1 and Th17 cell responses. Immunity 2014, 40, 569–581. [Google Scholar] [CrossRef]
- Bi, J.; Zheng, X.; Chen, Y.; Wei, H.; Sun, R.; Tian, Z. TIGIT safeguards liver regeneration through regulating natural killer cell-hepatocyte crosstalk. Hepatology 2014, 60, 1389–1398. [Google Scholar] [CrossRef] [PubMed]
- Chauvin, J.M.; Ka, M.; Pagliano, O.; Menna, C.; Ding, Q.; DeBlasio, R.; Sanders, C.; Hou, J.; Li, X.Y.; Ferrone, S.; et al. IL15 Stimulation with TIGIT Blockade Reverses CD155-mediated NK-Cell Dysfunction in Melanoma. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2020, 26, 5520–5533. [Google Scholar] [CrossRef]
- Zhang, C.; Wang, H.; Li, J.; Hou, X.; Li, L.; Wang, W.; Shi, Y.; Li, D.; Li, L.; Zhao, Z.; et al. Involvement of TIGIT in Natural Killer Cell Exhaustion and Immune Escape in Patients and Mouse Model with Liver Echinococcus multilocularis Infection. Hepatology 2021, 74, 3376–3393. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Xue, L.; Ding, X.; Zhang, J.; Jiang, L.; Liu, S.; Hou, H.; Jiang, B.; Cheng, L.; Zhu, Q.; et al. An Fc-Competent Anti-Human TIGIT Blocking Antibody Ociperlimab (BGB-A1217) Elicits Strong Immune Responses and Potent Anti-Tumor Efficacy in Pre-Clinical Models. Front. Immunol. 2022, 13, 828319. [Google Scholar] [CrossRef]
- Cho, Y.H.; Ro, E.J.; Yoon, J.S.; Mizutani, T.; Kang, D.W.; Park, J.C.; Il Kim, T.; Clevers, H.; Choi, K.Y. 5-FU promotes stemness of colorectal cancer via p53-mediated WNT/β-catenin pathway activation. Nat. Commun. 2020, 11, 5321. [Google Scholar] [CrossRef]
- Hu, J.L.; Wang, W.; Lan, X.L.; Zeng, Z.C.; Liang, Y.S.; Yan, Y.R.; Song, F.Y.; Wang, F.F.; Zhu, X.H.; Liao, W.J.; et al. CAFs secreted exosomes promote metastasis and chemotherapy resistance by enhancing cell stemness and epithelial-mesenchymal transition in colorectal cancer. Mol. Cancer 2019, 18, 91. [Google Scholar] [CrossRef]
- Wong, C.C.; Xu, J.; Bian, X.; Wu, J.L.; Kang, W.; Qian, Y.; Li, W.; Chen, H.; Gou, H.; Liu, D.; et al. In Colorectal Cancer Cells with Mutant KRAS, SLC25A22-Mediated Glutaminolysis Reduces DNA Demethylation to Increase WNT Signaling, Stemness, and Drug Resistance. Gastroenterology 2020, 159, 2163–2180.e2166. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Dong, Q.; An, Q.; Zhang, C.; Mohagheghian, E.; Niu, B.; Qi, F.; Wei, F.; Chen, S.; Chen, X.; et al. Synthetic Retinoid Kills Drug-Resistant Cancer Stem Cells via Inducing RARγ-Translocation-Mediated Tension Reduction and Chromatin Decondensation. Adv. Sci. 2022, 9, e2203173. [Google Scholar] [CrossRef]
- Qian, Z.; Lin, W.; Cai, X.; Wu, J.; Ke, K.; Ye, Z.; Wu, F. WYC-209 inhibited GC malignant progression by down-regulating WNT4 through RARα. Cancer Biol. Ther. 2024, 25, 2299288. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer 5′-3′ | Reverse Primer 5′-3′ |
---|---|---|
ACTB | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
IFNG | TCGGTAACTGACTTGAATGTCCA | TCGCTTCCCTGTTTTAGCTGC |
MKI67 | AGAAGAAGTGGTGCTTCGGAA | AGAAGAAGTGGTGCTTCGGAA |
THY1 | ATGAAGGTCCTCTACTTATCCGC | GCACTGTGACGTTCTGGGA |
CD44 | CTGCCGCTTTGCAGGTGTA | CATTGTGGGCAAGGTGCTATT |
LGR5 | ATGTCGAAGCCCCATAGTGAA | TGGGTGGTGAATCAATGTCCA |
NANOG | AAGGTCCCGGTCAAGAAACAG | CTTCTGCGTCACACCATTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, K.; Dong, Y.; Zhang, J.; Liu, M.; Sun, X.; Cao, X.; Zhang, P.; Liu, T. Sulfarotene Inhibits Colorectal Cancer via Mitigating Natural-Killer-Cell-Induced Stemness. Pharmaceuticals 2024, 17, 387. https://doi.org/10.3390/ph17030387
Hu K, Dong Y, Zhang J, Liu M, Sun X, Cao X, Zhang P, Liu T. Sulfarotene Inhibits Colorectal Cancer via Mitigating Natural-Killer-Cell-Induced Stemness. Pharmaceuticals. 2024; 17(3):387. https://doi.org/10.3390/ph17030387
Chicago/Turabian StyleHu, Keshu, Yu Dong, Jiayu Zhang, Mengling Liu, Xun Sun, Xin Cao, Pengfei Zhang, and Tianshu Liu. 2024. "Sulfarotene Inhibits Colorectal Cancer via Mitigating Natural-Killer-Cell-Induced Stemness" Pharmaceuticals 17, no. 3: 387. https://doi.org/10.3390/ph17030387
APA StyleHu, K., Dong, Y., Zhang, J., Liu, M., Sun, X., Cao, X., Zhang, P., & Liu, T. (2024). Sulfarotene Inhibits Colorectal Cancer via Mitigating Natural-Killer-Cell-Induced Stemness. Pharmaceuticals, 17(3), 387. https://doi.org/10.3390/ph17030387