The Melatonin Type 2 Receptor Agonist IIK7 Attenuates and Reverses Morphine Tolerance in Neuropathic Pain Rats Through the Suppression of Neuroinflammation in the Spinal Cord
Abstract
1. Introduction
2. Results
2.1. Co-Infusion of an Ultra-Low Dose of IIK7 Attenuates MOR’s Antinociceptive Tolerance in PSNT
2.2. The Effects of Continuous i.t. Administration of MOR, IIK7, and MOR + IIK7 on Mechanical Allodynia and Hyperalgesia
2.3. IIK7 Co-Infusion with MOR Reversed MOR-Induced Suppression of Nrf-2 and HO-1 Antioxidant Genes
2.4. Co-Infusion of IIK7 with MOR Led to a Decrease in Pro-Inflammatory Cytokine Levels in PSNT Rats
2.5. IIK7 Reverses MOR Antinociceptive Tolerance in PSNT Rats with Pre-Established MAT
2.6. IIK7 Restores MOR Analgesic Effects in Mechanical Allodynia and Hyperalgesia in MOR-Tolerant Rats
2.7. IIK7 Suppresses Microglial Activation Induced by MOR in the Spinal Cord of PSNT Rats
2.8. IIK7 Suppresses Spinal GFAP Activation Triggered by MOR in PSNT Rats
3. Discussion
4. Materials and Methods
4.1. Regents
4.2. Animals
4.3. Developing an Animal Model for Neuropathic Pain and i.t. Catheterization
4.4. Antinociception Test
4.5. Evaluation of Thermal Hyperalgesia and Mechanical Allodynia
4.6. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
4.7. Evaluation of Pro-Inflammatory Cytokines
4.8. Immunofluorescence Studies
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bouhassira, D. Neuropathic pain: Definition, assessment and epidemiology. Rev. Neurol. 2019, 175, 16–25. [Google Scholar] [CrossRef]
- Jensen, T.S.; Finnerup, N.B. Allodynia and hyperalgesia in neuropathic pain: Clinical manifestations and mechanisms. Lancet Neurol. 2014, 13, 924–935. [Google Scholar] [CrossRef] [PubMed]
- Ren, K.; Dubner, R. Neuron-glia crosstalk gets serious: Role in pain hypersensitivity. Curr. Opin. Anaesthesiol. 2008, 21, 570–579. [Google Scholar] [CrossRef] [PubMed]
- Tiwari, V.; Guan, Y.; Raja, S.N. Modulating the delicate glial-neuronal interactions in neuropathic pain: Promises and potential caveats. Neurosci. Biobehav. Rev. 2014, 45, 19–27. [Google Scholar] [CrossRef]
- Campos, A.C.P.; Antunes, G.F.; Matsumoto, M.; Pagano, R.L.; Martinez, R.C.R. Neuroinflammation, Pain and Depression: An Overview of the Main Findings. Front. Psychol. 2020, 11, 1825. [Google Scholar] [CrossRef]
- Ji, R.R.; Xu, Z.Z.; Gao, Y.J. Emerging targets in neuroinflammation-driven chronic pain. Nat. Rev. Drug Discov. 2014, 13, 533–548. [Google Scholar] [CrossRef]
- Jiang, B.C.; Liu, T.; Gao, Y.J. Chemokines in chronic pain: Cellular and molecular mechanisms and therapeutic potential. Pharmacol. Ther. 2020, 212, 107581. [Google Scholar] [CrossRef]
- Del Rey, A.; Apkarian, A.V.; Martina, M.; Besedovsky, H.O. Chronic neuropathic pain-like behavior and brain-borne IL-1β. Ann. N. Y. Acad. Sci. 2012, 1262, 101–107. [Google Scholar] [CrossRef]
- Tabeefar, H.; Chang, F.; Cooke, M.; Patel, T. Community pharmacists and chronic pain: A qualitative study of experience, perception, and challenges. Can. J. Pain 2020, 4, 29–39. [Google Scholar] [CrossRef]
- Pourmand, A.; Davis, S.; Marchak, A.; Whiteside, T.; Sikka, N. Virtual Reality as a Clinical Tool for Pain Management. Curr. Pain Headache Rep. 2018, 22, 53. [Google Scholar] [CrossRef]
- Morgan, M.M.; Christie, M.J. Analysis of opioid efficacy, tolerance, addiction and dependence from cell culture to human. Br. J. Pharmacol. 2011, 164, 1322–1334. [Google Scholar] [CrossRef]
- Skrabalova, J.; Drastichova, Z.; Novotny, J. Morphine as a Potential Oxidative Stress-Causing Agent. Mini Rev. Org. Chem. 2013, 10, 367–372. [Google Scholar] [CrossRef]
- Zeng, X.-S.; Geng, W.-S.; Wang, Z.-Q.; Jia, J.-J. Morphine Addiction and Oxidative Stress: The Potential Effects of Thioredoxin-1. Front. Pharmacol. 2020, 11, 82. [Google Scholar] [CrossRef]
- Abdel-Zaher, A.O.; Mostafa, M.G.; Farghaly, H.S.; Hamdy, M.M.; Abdel-Hady, R.H. Role of oxidative stress and inducible nitric oxide synthase in morphine-induced tolerance and dependence in mice. Effect of alpha-lipoic acid. Behav. Brain Res. 2013, 247, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Du, E.R.; Fan, R.P.; Rong, L.L.; Xie, Z.; Xu, C.S. Regulatory mechanisms and therapeutic potential of microglial inhibitors in neuropathic pain and morphine tolerance. J. Zhejiang Univ. Sci. B 2020, 21, 204–217. [Google Scholar] [CrossRef]
- Liu, D.Q.; Zhou, Y.Q.; Gao, F. Targeting Cytokines for Morphine Tolerance: A Narrative Review. Curr. Neuropharmacol. 2019, 17, 366–376. [Google Scholar] [CrossRef]
- Song, P.; Zhao, Z.Q. The involvement of glial cells in the development of morphine tolerance. Neurosci. Res. 2001, 39, 281–286. [Google Scholar] [CrossRef]
- Watkins, L.R.; Hutchinson, M.R.; Rice, K.C.; Maier, S.F. The “toll” of opioid-induced glial activation: Improving the clinical efficacy of opioids by targeting glia. Trends Pharmacol. Sci. 2009, 30, 581–591. [Google Scholar] [CrossRef]
- Wen, Y.-R.; Tan, P.-H.; Cheng, J.-K.; Liu, Y.-C.; Ji, R.-R. Microglia: A Promising Target for Treating Neuropathic and Postoperative Pain, and Morphine Tolerance. J. Formos. Med. Assoc. 2011, 110, 487–494. [Google Scholar] [CrossRef]
- Ahmadi, S.; Taghizadieh, M.; Mehdizadehfar, E.; Hasani, A.; Khalili Fard, J.; Feizi, H.; Hamishehkar, H.; Ansarin, M.; Yekani, M.; Memar, M.Y. Gut microbiota in neurological diseases: Melatonin plays an important regulatory role. Biomed. Pharmacother. 2024, 174, 116487. [Google Scholar] [CrossRef]
- Wang, Y.-q.; Jiang, Y.-j.; Zou, M.-s.; Liu, J.; Zhao, H.-q.; Wang, Y.-h. Antidepressant actions of melatonin and melatonin receptor agonist: Focus on pathophysiology and treatment. Behav. Brain Res. 2022, 420, 113724. [Google Scholar] [CrossRef]
- Wang, J.; Gu, J.; Ma, F.; Wei, Y.; Wang, P.; Yang, S.; Yan, X.; Xiao, Y.; Xing, K.; Lou, A.; et al. Melatonin Induces Analgesic Effects through MT(2) Receptor-Mediated Neuroimmune Modulation in the Mice Anterior Cingulate Cortex. Research 2024, 7, 0493. [Google Scholar] [CrossRef]
- Williams, W.P., 3rd; McLin, D.E., 3rd; Dressman, M.A.; Neubauer, D.N. Comparative Review of Approved Melatonin Agonists for the Treatment of Circadian Rhythm Sleep-Wake Disorders. Pharmacotherapy 2016, 36, 1028–1041. [Google Scholar] [CrossRef] [PubMed]
- López-Canul, M.; Comai, S.; Domínguez-López, S.; Granados-Soto, V.; Gobbi, G. Antinociceptive properties of selective MT2 melatonin receptor partial agonists. Eur. J. Pharmacol. 2015, 764, 424–432. [Google Scholar] [CrossRef]
- Lin, J.-J.; Lin, Y.; Zhao, T.-Z.; Zhang, C.-K.; Zhang, T.; Chen, X.-L.; Ding, J.-Q.; Chang, T.; Zhang, Z.; Sun, C.; et al. Melatonin Suppresses Neuropathic Pain via MT2-Dependent and -Independent Pathways in Dorsal Root Ganglia Neurons of Mice. Theranostics 2017, 7, 2015–2032. [Google Scholar] [CrossRef]
- Danilov, A.; Kurganova, J. Melatonin in Chronic Pain Syndromes. Pain Ther. 2016, 5, 1–17. [Google Scholar] [CrossRef]
- Zhu, C.; Xu, Y.; Duan, Y.; Li, W.; Zhang, L.; Huang, Y.; Zhao, W.; Wang, Y.; Li, J.; Feng, T.; et al. Exogenous melatonin in the treatment of pain: A systematic review and meta-analysis. Oncotarget 2017, 8, 100582–100592. [Google Scholar] [CrossRef] [PubMed]
- Uyanikgil, Y.; Cavusoglu, T.; Kılıc, K.D.; Yigitturk, G.; Celik, S.; Tubbs, R.S.; Turgut, M. Useful Effects of Melatonin in Peripheral Nerve Injury and Development of the Nervous System. J. Brachial Plex. Peripher. Nerve Inj. 2017, 12, e1–e6. [Google Scholar] [CrossRef]
- Xie, S.; Fan, W.; He, H.; Huang, F. Role of Melatonin in the Regulation of Pain. J. Pain Res. 2020, 13, 331–343. [Google Scholar] [CrossRef] [PubMed]
- Posa, L.; De Gregorio, D.; Gobbi, G.; Comai, S. Targeting Melatonin MT2 Receptors: A Novel Pharmacological Avenue for Inflammatory and Neuropathic Pain. Curr. Med. Chem. 2018, 25, 3866–3882. [Google Scholar] [CrossRef]
- Faust, R.; Garratt, P.J.; Jones, R.; Yeh, L.-K.; Tsotinis, A.; Panoussopoulou, M.; Calogeropoulou, T.; Teh, M.-T.; Sugden, D. Mapping the Melatonin Receptor. 6. Melatonin Agonists and Antagonists Derived from 6H-Isoindolo [2,1-a]indoles, 5,6-Dihydroindolo [2,1-a]isoquinolines, and 6,7-Dihydro-5H-benzo[c]azepino [2,1-a]indoles. J. Med. Chem. 2000, 43, 1050–1061. [Google Scholar] [CrossRef] [PubMed]
- Fisher, S.P.; Sugden, D. Sleep-promoting action of IIK7, a selective MT2 melatonin receptor agonist in the rat. Neurosci. Lett. 2009, 457, 93–96. [Google Scholar] [CrossRef]
- Liu, D.-D.; Ren, Z.; Yang, G.; Zhao, Q.-R.; Mei, Y.-A. Melatonin protects rat cerebellar granule cells against electromagnetic field-induced increases in Na(+) currents through intracellular Ca(2+) release. J. Cell. Mol. Med. 2014, 18, 1060–1070. [Google Scholar] [CrossRef] [PubMed]
- Kuthati, Y.; Goutham Davuluri, V.N.; Yang, C.-P.; Chang, H.-C.; Chang, C.-P.; Wong, C.S. Melatonin MT2 receptor agonist IIK-7 produces antinociception by modulation of ROS and suppression of spinal microglial activation in neuropathic pain rats. J. Pain Res. 2019, 12, 2473–2485. [Google Scholar] [CrossRef]
- Tsai, R.Y.; Chou, K.Y.; Shen, C.H.; Chien, C.C.; Tsai, W.Y.; Huang, Y.N.; Tao, P.L.; Lin, Y.S.; Wong, C.S. Resveratrol regulates N-methyl-D-aspartate receptor expression and suppresses neuroinflammation in morphine-tolerant rats. Anesth. Analg. 2012, 115, 944–952. [Google Scholar] [CrossRef]
- Liu, C.H.; Cherng, C.H.; Lin, S.L.; Yeh, C.C.; Wu, C.T.; Tai, Y.H.; Wong, C.S. N-methyl-D-aspartate receptor antagonist MK-801 suppresses glial pro-inflammatory cytokine expression in morphine-tolerant rats. Pharmacol. Biochem. Behav. 2011, 99, 371–380. [Google Scholar] [CrossRef] [PubMed]
- Tai, Y.H.; Cheng, P.Y.; Tsai, R.Y.; Chen, Y.F.; Wong, C.S. Purinergic P2X receptor regulates N-methyl-D-aspartate receptor expression and synaptic excitatory amino acid concentration in morphine-tolerant rats. Anesthesiology 2010, 113, 1163–1175. [Google Scholar] [CrossRef]
- Tai, Y.H.; Tsai, R.Y.; Lin, S.L.; Yeh, C.C.; Wang, J.J.; Tao, P.L.; Wong, C.S. Amitriptyline suppresses neuroinflammation-dependent interleukin-10-p38 mitogen-activated protein kinase-heme oxygenase-1 signaling pathway in chronic morphine-infused rats. Anesthesiology 2009, 110, 1379–1389. [Google Scholar] [CrossRef]
- Smith, J.A.; Das, A.; Ray, S.K.; Banik, N.L. Role of pro-inflammatory cytokines released from microglia in neurodegenerative diseases. Brain Res. Bull. 2012, 87, 10–20. [Google Scholar] [CrossRef]
- Johnston, I.N.; Milligan, E.D.; Wieseler-Frank, J.; Frank, M.G.; Zapata, V.; Campisi, J.; Langer, S.; Martin, D.; Green, P.; Fleshner, M.; et al. A role for proinflammatory cytokines and fractalkine in analgesia, tolerance, and subsequent pain facilitation induced by chronic intrathecal morphine. J. Neurosci. 2004, 24, 7353–7365. [Google Scholar] [CrossRef]
- Finley, M.J.; Happel, C.M.; Kaminsky, D.E.; Rogers, T.J. Opioid and nociceptin receptors regulate cytokine and cytokine receptor expression. Cell. Immunol. 2008, 252, 146–154. [Google Scholar] [CrossRef] [PubMed]
- Inoue, K. The function of microglia through purinergic receptors: Neuropathic pain and cytokine release. Pharmacol. Ther. 2006, 109, 210–226. [Google Scholar] [CrossRef]
- Watkins, L.R.; Hutchinson, M.R.; Ledeboer, A.; Wieseler-Frank, J.; Milligan, E.D.; Maier, S.F. Norman Cousins Lecture. Glia as the ”bad guys“: Implications for improving clinical pain control and the clinical utility of opioids. Brain Behav. Immun. 2007, 21, 131–146. [Google Scholar] [CrossRef]
- Narita, M.; Suzuki, M.; Narita, M.; Yajima, Y.; Suzuki, R.; Shioda, S.; Suzuki, T. Neuronal protein kinase C gamma-dependent proliferation and hypertrophy of spinal cord astrocytes following repeated in vivo administration of morphine. Eur. J. Neurosci. 2004, 19, 479–484. [Google Scholar] [CrossRef]
- Yang, Y.; Sun, Y.; Hu, R.; Yan, J.; Wang, Z.; Li, W.; Jiang, H. Morphine promotes microglial activation by upregulating the EGFR/ERK signaling pathway. PLoS ONE 2021, 16, e0256870. [Google Scholar] [CrossRef]
- Xie, F.; Kitagawa, Y.; Ogata, H.; Yasuhara, S.; You, Z.; Jeevendra Martyn, J.A. Morphine induces inflammatory responses via both TLR4 and cGAS-STING signaling pathways. Cytokine 2024, 183, 156737. [Google Scholar] [CrossRef]
- Tanga, F.Y.; Raghavendra, V.; DeLeo, J.A. Quantitative real-time RT-PCR assessment of spinal microglial and astrocytic activation markers in a rat model of neuropathic pain. Neurochem. Int. 2004, 45, 397–407. [Google Scholar] [CrossRef]
- Tai, Y.H.; Wang, Y.H.; Wang, J.J.; Tao, P.L.; Tung, C.S.; Wong, C.S. Amitriptyline suppresses neuroinflammation and up-regulates glutamate transporters in morphine-tolerant rats. Pain 2006, 124, 77–86. [Google Scholar] [CrossRef]
- Cui, Y.; Liao, X.X.; Liu, W.; Guo, R.X.; Wu, Z.Z.; Zhao, C.M.; Chen, P.X.; Feng, J.Q. A novel role of minocycline: Attenuating morphine antinociceptive tolerance by inhibition of p38 MAPK in the activated spinal microglia. Brain Behav. Immun. 2008, 22, 114–123. [Google Scholar] [CrossRef] [PubMed]
- Matsushita, Y.; Omotuyi, I.O.; Mukae, T.; Ueda, H. Microglia activation precedes the anti-opioid BDNF and NMDA receptor mechanisms underlying morphine analgesic tolerance. Curr. Pharm. Des. 2013, 19, 7355–7361. [Google Scholar] [CrossRef] [PubMed]
- Garrison, C.J.; Dougherty, P.M.; Kajander, K.C.; Carlton, S.M. Staining of glial fibrillary acidic protein (GFAP) in lumbar spinal cord increases following a sciatic nerve constriction injury. Brain Res. 1991, 565, 1–7. [Google Scholar] [CrossRef]
- Garrison, C.J.; Dougherty, P.M.; Carlton, S.M. GFAP expression in lumbar spinal cord of naive and neuropathic rats treated with MK-801. Exp. Neurol. 1994, 129, 237–243. [Google Scholar] [CrossRef]
- Nesic, O.; Lee, J.; Johnson, K.M.; Ye, Z.; Xu, G.Y.; Unabia, G.C.; Wood, T.G.; McAdoo, D.J.; Westlund, K.N.; Hulsebosch, C.E.; et al. Transcriptional profiling of spinal cord injury-induced central neuropathic pain. J. Neurochem. 2005, 95, 998–1014. [Google Scholar] [CrossRef]
- Pan, Y.; Sun, X.; Jiang, L.; Hu, L.; Kong, H.; Han, Y.; Qian, C.; Song, C.; Qian, Y.; Liu, W. Metformin reduces morphine tolerance by inhibiting microglial-mediated neuroinflammation. J. Neuroinflammation 2016, 13, 294. [Google Scholar] [CrossRef] [PubMed]
- Chen, I.J.; Yang, C.P.; Lin, S.H.; Lai, C.M.; Wong, C.S. The Circadian Hormone Melatonin Inhibits Morphine-Induced Tolerance and Inflammation via the Activation of Antioxidative Enzymes. Antioxidants 2020, 9, 780. [Google Scholar] [CrossRef] [PubMed]
- Zhdanova, I.V.; Wurtman, R.J.; Regan, M.M.; Taylor, J.A.; Shi, J.P.; Leclair, O.U. Melatonin treatment for age-related insomnia. J. Clin. Endocrinol. Metab. 2001, 86, 4727–4730. [Google Scholar] [CrossRef]
- Lewy, A.J.; Emens, J.S.; Lefler, B.J.; Yuhas, K.; Jackman, A.R. Melatonin entrains free-running blind people according to a physiological dose-response curve. Chronobiol. Int. 2005, 22, 1093–1106. [Google Scholar] [CrossRef]
- Kuthati, Y.; Lin, S.H.; Chen, I.J.; Wong, C.S. Melatonin and their analogs as a potential use in the management of Neuropathic pain. J. Formos. Med. Assoc. 2019, 118, 1177–1186. [Google Scholar] [CrossRef] [PubMed]
- Ebadi, M.; Govitrapong, P.; Phansuwan-Pujito, P.; Nelson, F.; Reiter, R.J. Pineal opioid receptors and analgesic action of melatonin. J. Pineal Res. 1998, 24, 193–200. [Google Scholar] [CrossRef] [PubMed]
- Ambriz-Tututi, M.; Granados-Soto, V. Oral and spinal melatonin reduces tactile allodynia in rats via activation of MT2 and opioid receptors. Pain 2007, 132, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Fang, Q.; Chen, J.; Wang, Y.; Liu, X.; Zhang, X.; Shi, Y.; Zhan, H.; Zhong, X.; Yao, M.; et al. Melatonin Improves Mitochondrial Dysfunction and Attenuates Neuropathic Pain by Regulating SIRT1 in Dorsal Root Ganglions. Neuroscience 2023, 534, 29–40. [Google Scholar] [CrossRef]
- Lin, S.-H.; Huang, Y.-N.; Kao, J.-H.; Tien, L.-T.; Tsai, R.-Y.; Wong, C.-S. Melatonin reverses morphine tolerance by inhibiting microglia activation and HSP27 expression. Life Sci. 2016, 152, 38–43. [Google Scholar] [CrossRef]
- Fan, Y.; Liang, X.; Wang, R.; Song, L. Role of endogenous melatoninergic system in development of hyperalgesia and tolerance induced by chronic morphine administration in rats. Brain Res. Bull. 2017, 135, 105–112. [Google Scholar] [CrossRef]
- Su, L.-Y.; Liu, Q.; Jiao, L.; Yao, Y.-G. Molecular Mechanism of Neuroprotective Effect of Melatonin on Morphine Addiction and Analgesic Tolerance: An Update. Mol. Neurobiol. 2021, 58, 4628–4638. [Google Scholar] [CrossRef] [PubMed]
- Witt-Enderby, P.A.; Bennett, J.; Jarzynka, M.J.; Firestine, S.; Melan, M.A. Melatonin receptors and their regulation: Biochemical and structural mechanisms. Life Sci. 2003, 72, 2183–2198. [Google Scholar] [CrossRef]
- Song, L.; Wu, C.; Zuo, Y. Melatonin prevents morphine-induced hyperalgesia and tolerance in rats: Role of protein kinase C and N-methyl-D-aspartate receptors. BMC Anesthesiol. 2015, 15, 12. [Google Scholar] [CrossRef]
- Liu, J.; Clough, S.J.; Hutchinson, A.J.; Adamah-Biassi, E.B.; Popovska-Gorevski, M.; Dubocovich, M.L. MT1 and MT2 Melatonin Receptors: A Therapeutic Perspective. Annu. Rev. Pharmacol. Toxicol. 2016, 56, 361–383. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, C.; Mayo, J.C.; Sainz, R.M.; Antolín, I.; Herrera, F.; Martín, V.; Reiter, R.J. Regulation of antioxidant enzymes: A significant role for melatonin. J. Pineal Res. 2004, 36, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Joshi, A.; Upadhyay, K.K.; Vohra, A.; Shirsath, K.; Devkar, R. Melatonin induces Nrf2-HO-1 reprogramming and corrections in hepatic core clock oscillations in Non-alcoholic fatty liver disease. FASEB J. 2021, 35, e21803. [Google Scholar] [CrossRef] [PubMed]
- Wei, C.Y.; Zhang, X.; Si, L.N.; Shu, W.H.; Jiang, S.N.; Ding, P.J.; Cheng, L.Y.; Sun, T.C.; Yang, S.H. Melatonin activates Nrf2/HO-1 signalling pathway to antagonizes oxidative stress-induced injury via melatonin receptor 1 (MT1) in cryopreserved mice ovarian tissue. Reprod. Domest. Anim. 2024, 59, e14598. [Google Scholar] [CrossRef]
- Redondo, A.; Chamorro, P.A.F.; Riego, G.; Leánez, S.; Pol, O. Treatment with Sulforaphane Produces Antinociception and Improves Morphine Effects during Inflammatory Pain in Mice. J. Pharmacol. Exp. Ther. 2017, 363, 293–302. [Google Scholar] [CrossRef]
- Wang, X. The antiapoptotic activity of melatonin in neurodegenerative diseases. CNS Neurosci. Ther. 2009, 15, 345–357. [Google Scholar] [CrossRef] [PubMed]
- Shin, J.W. Neuroprotective effects of melatonin in neurodegenerative and autoimmune central nervous system diseases. Encephalitis 2023, 3, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Jilg, A.; Bechstein, P.; Saade, A.; Dick, M.; Li, T.X.; Tosini, G.; Rami, A.; Zemmar, A.; Stehle, J.H. Melatonin modulates daytime-dependent synaptic plasticity and learning efficiency. J. Pineal Res. 2019, 66, e12553. [Google Scholar] [CrossRef] [PubMed]
- Deleo, J.A.; Tanga, F.Y.; Tawfik, V.L. Neuroimmune Activation and Neuroinflammation in Chronic Pain and Opioid Tolerance/Hyperalgesia. Neuroscientist 2004, 10, 40–52. [Google Scholar] [CrossRef] [PubMed]
- Lindborg, J.A.; Niemi, J.P.; Howarth, M.A.; Liu, K.W.; Moore, C.Z.; Mahajan, D.; Zigmond, R.E. Molecular and cellular identification of the immune response in peripheral ganglia following nerve injury. J. Neuroinflamm. 2018, 15, 192. [Google Scholar] [CrossRef]
- Newton, V.L.; Guck, J.D.; Cotter, M.A.; Cameron, N.E.; Gardiner, N.J. Neutrophils Infiltrate the Spinal Cord Parenchyma of Rats with Experimental Diabetic Neuropathy. J. Diabetes Res. 2017, 2017, 4729284. [Google Scholar] [CrossRef]
- Terminel, M.N.; Bassil, C.; Rau, J.; Trevino, A.; Ruiz, C.; Alaniz, R.; Hook, M.A. Morphine-induced changes in the function of microglia and macrophages after acute spinal cord injury. BMC Neurosci. 2022, 23, 58. [Google Scholar] [CrossRef]
- Trivedi, A.; Olivas, A.D.; Noble-Haeusslein, L.J. Inflammation and Spinal Cord Injury: Infiltrating Leukocytes as Determinants of Injury and Repair Processes. Clin. Neurosci. Res. 2006, 6, 283–292. [Google Scholar] [CrossRef]
- Lv, J.; Li, Z.; She, S.; Xu, L.; Ying, Y. Effects of intrathecal injection of rapamycin on pain threshold and spinal cord glial activation in rats with neuropathic pain. Neurol. Res. 2015, 37, 739–743. [Google Scholar] [CrossRef]
- Yaksh, T.L.; Rudy, T.A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 1976, 17, 1031–1036. [Google Scholar] [CrossRef] [PubMed]
- Tai, Y.H.; Wang, Y.H.; Tsai, R.Y.; Wang, J.J.; Tao, P.L.; Liu, T.M.; Wang, Y.C.; Wong, C.S. Amitriptyline preserves morphine’s antinociceptive effect by regulating the glutamate transporter GLAST and GLT-1 trafficking and excitatory amino acids concentration in morphine-tolerant rats. Pain 2007, 129, 343–354. [Google Scholar] [CrossRef] [PubMed]
- Pan, H.; Xu, Y.; Cai, Q.; Wu, M.; Ding, M. Effects of β-Asarone on Ischemic Stroke in Middle Cerebral Artery Occlusion Rats by an Nrf2-Antioxidant Response Elements (ARE) Pathway-Dependent Mechanism. Med. Sci. Monit. 2021, 27, e931884. [Google Scholar] [CrossRef] [PubMed]
- Puig, S.; Donica, C.L.; Gutstein, H.B. EGFR Signaling Causes Morphine Tolerance and Mechanical Sensitization in Rats. eNeuro 2020, 7, 1–12. [Google Scholar] [CrossRef]
- Yadlapalli, J.S.K.; Dogra, N.; Walbaum, A.W.; Wessinger, W.D.; Prather, P.L.; Crooks, P.A.; Dobretsov, M. Evaluation of Analgesia, Tolerance, and the Mechanism of Action of Morphine-6-O-Sulfate Across Multiple Pain Modalities in Sprague-Dawley Rats. Anesth. Analg. 2017, 125, 1021–1031. [Google Scholar] [CrossRef]
Gene Name | Sequence of Primers |
---|---|
Nrf-2 | Forward: CCCATTGAGGGCTGTGAT Reverse: TTGGCTGTGCTTTAGGTC |
HO-1 | Forward: GCATGTCCCAGGATTTGTCC Reverse: GGTTCTGCTTGTTTCGCTCT |
GAPDH | Forward: ACTCCCATTCTTCCACCTTTG Reverse: CCCTGTTGCTGTAGCCATATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kuthati, Y.; Wong, C.-S. The Melatonin Type 2 Receptor Agonist IIK7 Attenuates and Reverses Morphine Tolerance in Neuropathic Pain Rats Through the Suppression of Neuroinflammation in the Spinal Cord. Pharmaceuticals 2024, 17, 1638. https://doi.org/10.3390/ph17121638
Kuthati Y, Wong C-S. The Melatonin Type 2 Receptor Agonist IIK7 Attenuates and Reverses Morphine Tolerance in Neuropathic Pain Rats Through the Suppression of Neuroinflammation in the Spinal Cord. Pharmaceuticals. 2024; 17(12):1638. https://doi.org/10.3390/ph17121638
Chicago/Turabian StyleKuthati, Yaswanth, and Chih-Shung Wong. 2024. "The Melatonin Type 2 Receptor Agonist IIK7 Attenuates and Reverses Morphine Tolerance in Neuropathic Pain Rats Through the Suppression of Neuroinflammation in the Spinal Cord" Pharmaceuticals 17, no. 12: 1638. https://doi.org/10.3390/ph17121638
APA StyleKuthati, Y., & Wong, C.-S. (2024). The Melatonin Type 2 Receptor Agonist IIK7 Attenuates and Reverses Morphine Tolerance in Neuropathic Pain Rats Through the Suppression of Neuroinflammation in the Spinal Cord. Pharmaceuticals, 17(12), 1638. https://doi.org/10.3390/ph17121638