Chlorogenic Acid Induced Neuroblastoma Cells Differentiation via the ACAT1-TPK1-PDH Pathway
Abstract
1. Introduction
2. Results
2.1. CHA-Induced Neuroblastoma Cell Differentiation In Vitro and In Vivo
2.2. Mitochondrial ACAT1 Involved in Neuroblastoma Cell Differentiation Induced by CHA
2.3. CHA Restored OXPHOS Capacity in Neuroblastoma Cells
2.4. Thiamine Metabolism Involved in the ACAT-Mediated Differentiation of Neuroblastoma Cells
2.5. TPK1 Promoted the Differentiation of Neuroblastoma Cells
3. Discussion
4. Materials and Methods
4.1. Ethical Approval of the Study Protocol
4.2. Reagents
4.3. Cell Culture
4.4. Public Databases Analysis
4.5. Western Blotting Assays and Immunohistochemistry
4.6. RNA Extraction and Real-Time RT-PCR
4.7. Migration Assay
4.8. Soft Agar Cloning Assay
4.9. Flow Cytometry Assay
4.10. ACAT1 Enzyme Activity Assay
4.11. Mitochondrial Membrane Potential Measurement
4.12. Metabonomics Analysis
4.13. Cellular Metabolism Measurements
4.14. Subcutaneous and Intracranial Xenograft Neuroblastoma Models
4.15. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ritthipichai, K.; Haymaker, C.L.; Martinez, M.; Aschenbrenner, A.; Yi, X.; Zhang, M.; Kale, C.; Vence, L.M.; Roszik, J.; Hailemichael, Y.; et al. Multifaceted Role of BTLA in the Control of CD8+ T-cell Fate after Antigen Encounter. Clin. Cancer Res. 2017, 23, 6151–6164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, J.; Song, X.; Yang, J.; Lei, K.; Ni, Y.; Zhou, F.; Sun, L. Triptolide Inhibits Proliferation and Migration of Human Neuroblastoma SH-SY5Y Cells by Upregulating MicroRNA-181a. Oncol. Res. 2018, 26, 1235–1243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pezeshki, P.S.; Moeinafshar, A.; Ghaemdoust, F.; Razi, S.; Keshavarz-Fathi, M.; Rezaei, N. Advances in pharmacotherapy for neuroblastoma. Expert Opin. Pharmacother. 2021, 22, 2383–2404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lochmann, T.L.; Powell, K.M.; Ham, J.; Floros, K.V.; Heisey, D.A.R.; Kurupi, R.I.J.; Calbert, M.L.; Ghotra, M.S.; Greninger, P.; Dozmorov, M.; et al. Targeted inhibition of histone H3K27 demethylation is effective in high-risk neuroblastoma. Sci. Transl. Med. 2018, 10, eaao4680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seeger, R.C.; Siegel, S.E.; Sidell, N. Neuroblastoma: Clinical perspectives, monoclonal antibodies, and retinoic acid. Ann. Intern. Med. 1982, 97, 873–884. [Google Scholar] [CrossRef] [Scilit]
- Matthay, K.K.; Villablanca, J.G.; Seeger, R.C.; Stram, D.O.; Harris, R.E.; Ramsay, N.K.; Swift, P.; Shimada, H.; Black, C.T.; Brodeur, G.M.; et al. Treatment of high-risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis-retinoic acid. Children’s Cancer Group. N. Engl. J. Med. 1999, 341, 1165–1173. [Google Scholar] [CrossRef] [Scilit]
- Halakos, E.G.; Connell, A.J.; Glazewski, L.; Wei, S.; Mason, R.W. Bottom up proteomics reveals novel differentiation proteins in neuroblastoma cells treated with 13-cis retinoic acid. J. Proteom. 2019, 209, 103491. [Google Scholar] [CrossRef] [Scilit]
- Clark, O.; Daga, S.; Stoker, A.W. Tyrosine phosphatase inhibitors combined with retinoic acid can enhance differentiation of neuroblastoma cells and trigger ERK- and AKT-dependent, p53-independent senescence. Cancer Lett. 2013, 328, 44–54. [Google Scholar] [CrossRef] [Scilit]
- Lampis, S.; Raieli, S.; Montemurro, L.; Bartolucci, D.; Amadesi, C.; Bortolotti, S.; Angelucci, S.; Scardovi, A.L.; Nieddu, G.; Cerisoli, L.; et al. The MYCN inhibitor BGA002 restores the retinoic acid response leading to differentiation or apoptosis by the mTOR block in MYCN-amplified neuroblastoma. J. Exp. Clin. Cancer Res. 2022, 41, 160. [Google Scholar] [CrossRef] [Scilit]
- Campbell, K.; Gastier-Foster, J.M.; Mann, M.; Naranjo, A.H.; Van Ryn, C.; Bagatell, R.; Matthay, K.K.; London, W.B.; Irwin, M.S.; Shimada, H.; et al. Association of MYCN copy number with clinical features, tumor biology, and outcomes in neuroblastoma: A report from the Children’s Oncology Group. Cancer 2017, 123, 4224–4235. [Google Scholar] [CrossRef] [Scilit]
- Xue, N.; Zhou, Q.; Ji, M.; Jin, J.; Lai, F.; Chen, J.; Zhang, M.; Jia, J.; Yang, H.; Zhang, J.; et al. Chlorogenic acid inhibits glioblastoma growth through repolarizating macrophage from M2 to M1 phenotype. Sci. Rep. 2017, 7, 39011. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Yang, X.; You, S.; Hao, M.; Li, J.; Chen, X.; Jin, J. Chlorogenic Acid Relieves the Lupus Erythematosus-like Skin Lesions and Arthritis in MRL/lpr Mice. Pharmaceuticals 2022, 15, 1327. [Google Scholar] [CrossRef] [Scilit]
- Huang, S.; Wang, L.L.; Xue, N.N.; Li, C.; Guo, H.H.; Ren, T.K.; Zhan, Y.; Li, W.B.; Zhang, J.; Chen, X.G.; et al. Chlorogenic acid effectively treats cancers through induction of cancer cell differentiation. Theranostics 2019, 9, 6745–6763. [Google Scholar] [CrossRef] [Scilit]
- Goudarzi, A. The recent insights into the function of ACAT1: A possible anti-cancer therapeutic target. Life Sci. 2019, 232, 116592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, J.; Shan, C.; Kang, H.B.; Elf, S.; Xie, J.; Tucker, M.; Gu, T.L.; Aguiar, M.; Lonning, S.; Chen, H.; et al. Tyr phosphorylation of PDP1 toggles recruitment between ACAT1 and SIRT3 to regulate the pyruvate dehydrogenase complex. Mol. Cell 2014, 53, 534–548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shin, M.; Umezawa, C.; Shin, T. Metabolic Pathways: Metabolism of Minerals and Vitamins. In Encyclopedia of Food Microbiology, 2nd ed.; Batt, C.A., Tortorello, M.L., Eds.; Academic Press: Oxford, UK, 2014; pp. 535–543. [Google Scholar]
- Bettendorff, L.; Wins, P. Biochemistry of thiamine and thiamine phosphate compounds. In Encyclopedia of Biological Chemistry II; Academic Press: Cambridge, MA, USA, 2021. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Ji, M.; Xue, N.; Kang, Z.; Kang, X.; Li, S.; Chen, X. First in human phase I study of chlorogenic acid injection in recurrent high grade glioma. J. Clin. Oncol. 2018, 36 (Suppl. 15), e14081. [Google Scholar] [CrossRef] [Scilit]
- Escobar, S.J.M.; Fong, G.M.; Winnischofer, S.M.B.; Simone, M.; Munoz, L.; Dennis, J.M.; Rocha, M.E.M.; Witting, P.K. Anti-proliferative and cytotoxic activities of the flavonoid isoliquiritigenin in the human neuroblastoma cell line SH-SY5Y. Chem. Biol. Interact. 2019, 299, 77–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coscia, F.; Watters, K.M.; Curtis, M.; Eckert, M.A.; Chiang, C.Y.; Tyanova, S.; Montag, A.; Lastra, R.R.; Lengyel, E.; Mann, M. Integrative proteomic profiling of ovarian cancer cell lines reveals precursor cell associated proteins and functional status. Nat. Commun. 2016, 7, 12645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhai, K.; Brockmüller, A.; Kubatka, P.; Shakibaei, M.; Büsselberg, D. Curcumin’s Beneficial Effects on Neuroblastoma: Mechanisms, Challenges, and Potential Solutions. Biomolecules 2020, 10, 1469. [Google Scholar] [CrossRef] [Scilit]
- Zimmerman, M.W.; Liu, Y.; He, S.; Durbin, A.D.; Abraham, B.J.; Easton, J.; Shao, Y.; Xu, B.; Zhu, S.; Zhang, X.; et al. MYC Drives a Subset of High-Risk Pediatric Neuroblastomas and Is Activated through Mechanisms Including Enhancer Hijacking and Focal Enhancer Amplification. Cancer Discov. 2018, 8, 320–335. [Google Scholar] [CrossRef] [Scilit]
- Bailey, P.; Cushing, H. A Classification of the Tumors of the Glioma Group on a Histogenetic Basis with a Correlated Study of Prognosis. Arch. Neurol. Psychiatry 1927, 17, 570. [Google Scholar]
- Lualdi, M.; Ronci, M.; Zilocchi, M.; Corno, F.; Turilli, E.S.; Sponchiado, M.; Aceto, A.; Alberio, T.; Fasano, M. Exploring the Mitochondrial Degradome by the TAILS Proteomics Approach in a Cellular Model of Parkinson’s Disease. Front. Aging Neurosci. 2019, 11, 195. [Google Scholar] [CrossRef] [Scilit]
- Yamaguchi, S.; Hashimoto, T. [Beta-Ketothiolase deficiency]. Tanpakushitsu Kakusan Koso Protein Nucleic Acid Enzym. 1988, 33, 589–591. [Google Scholar]
- Fan, J.; Lin, R.; Xia, S.; Chen, D.; Elf, S.E.; Liu, S.; Pan, Y.; Xu, H.; Qian, Z.; Wang, M.; et al. Tetrameric Acetyl-CoA Acetyltransferase 1 Is Important for Tumor Growth. Mol. Cell 2016, 64, 859–874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.F.; Haynes, C.M. Metabolism and the UPR(mt). Mol. Cell 2016, 61, 677–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sala, D.; Cunningham, T.J.; Stec, M.J.; Etxaniz, U.; Nicoletti, C.; Dall’Agnese, A.; Puri, P.L.; Duester, G.; Latella, L.; Sacco, A. The Stat3-Fam3a axis promotes muscle stem cell myogenic lineage progression by inducing mitochondrial respiration. Nat. Commun. 2019, 10, 1796. [Google Scholar] [CrossRef] [Scilit]
- Moon, D.K.; Kim, B.G.; Lee, A.R.; In Choe, Y.; Khan, I.; Moon, K.M.; Jeon, R.H.; Byun, J.H.; Hwang, S.C.; Woo, D.K. Resveratrol can enhance osteogenic differentiation and mitochondrial biogenesis from human periosteum-derived mesenchymal stem cells. J. Orthop. Surg. Res. 2020, 15, 203. [Google Scholar] [CrossRef] [Scilit]
- Joyal, J.S.; Sun, Y.; Gantner, M.L.; Shao, Z.; Evans, L.P.; Saba, N.; Fredrick, T.; Burnim, S.; Kim, J.S.; Patel, G.; et al. Retinal lipid and glucose metabolism dictates angiogenesis through the lipid sensor Ffar1. Nat. Med. 2016, 22, 439–445. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Qian, X.; Peng, L.X.; Jiang, Y.; Hawke, D.H.; Zheng, Y.; Xia, Y.; Lee, J.H.; Cote, G.; Wang, H.; et al. A splicing switch from ketohexokinase-C to ketohexokinase-A drives hepatocellular carcinoma formation. Nat. Cell Biol. 2016, 18, 561–571. [Google Scholar] [CrossRef] [Scilit]
- Caino, M.C.; Altieri, D.C. Molecular Pathways: Mitochondrial Reprogramming in Tumor Progression and Therapy. Clin. Cancer Res. 2016, 22, 540–545. [Google Scholar] [CrossRef] [Scilit]
- Bononi, A.; Yang, H.; Giorgi, C.; Patergnani, S.; Pellegrini, L.; Su, M.; Xie, G.; Signorato, V.; Pastorino, S.; Morris, P.; et al. Germline BAP1 mutations induce a Warburg effect. Cell Death Differ. 2017, 24, 1694–1704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kathagen-Buhmann, A.; Maire, C.L.; Weller, J.; Schulte, A.; Matschke, J.; Holz, M.; Ligon, K.L.; Glatzel, M.; Westphal, M.; Lamszus, K. The secreted glycolytic enzyme GPI/AMF stimulates glioblastoma cell migration and invasion in an autocrine fashion but can have anti-proliferative effects. Neuro Oncol. 2018, 20, 1594–1605. [Google Scholar] [CrossRef] [Scilit]
- Muir, A.; Vander Heiden, M.G. The nutrient environment affects therapy. Science 2018, 360, 962–963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Bermudez, J.; Williams, R.T.; Guarecuco, R.; Birsoy, K. Targeting extracellular nutrient dependencies of cancer cells. Mol. Metab. 2020, 33, 67–82. [Google Scholar] [CrossRef] [Scilit]
- Zastre, J.A.; Sweet, R.L.; Hanberry, B.S.; Ye, S. Linking vitamin B1 with cancer cell metabolism. Cancer Metab. 2013, 1, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gangolf, M.; Czerniecki, J.; Radermecker, M.; Detry, O.; Nisolle, M.; Jouan, C.; Martin, D.; Chantraine, F.; Lakaye, B.; Wins, P.; et al. Thiamine status in humans and content of phosphorylated thiamine derivatives in biopsies and cultured cells. PLoS ONE 2010, 5, e13616. [Google Scholar] [CrossRef] [Scilit]
- Ponnala, S.; Chetty, C.; Veeravalli, K.K.; Dinh, D.H.; Klopfenstein, J.D.; Rao, J.S. Metabolic remodeling precedes mitochondrial outer membrane permeabilization in human glioma xenograft cells. Int. J. Oncol. 2012, 40, 509–518. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Li, Q.; Noureen, N.; Fang, Y.; Kurmasheva, R.; Houghton, P.J.; Wang, X.; Zheng, S. PCAT: An integrated portal for genomic and preclinical testing data of pediatric cancer patient-derived xenograft models. Nucleic Acids Res. 2021, 49, D1321–D1327. [Google Scholar] [CrossRef] [Scilit]






| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| MAP2 | CTGCTTTACAGGGTAGCACAA | TTGAGTATGGCAAACGGTCTG |
| NeuN | CCAAGCGGCTACACGTCTC | CGTCCCATTCAGCTTCTCCC |
| GAPDH | GTGGACCTGACCTGCCGTCT | GGAGGAGTGGGTGTCGCTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
You, S.; Wang, M.-J.; Hou, Z.-Y.; Wang, W.-D.; Du, T.-T.; Xue, N.-N.; Ji, M.; Chen, X.-G. Chlorogenic Acid Induced Neuroblastoma Cells Differentiation via the ACAT1-TPK1-PDH Pathway. Pharmaceuticals 2023, 16, 877. https://doi.org/10.3390/ph16060877
You S, Wang M-J, Hou Z-Y, Wang W-D, Du T-T, Xue N-N, Ji M, Chen X-G. Chlorogenic Acid Induced Neuroblastoma Cells Differentiation via the ACAT1-TPK1-PDH Pathway. Pharmaceuticals. 2023; 16(6):877. https://doi.org/10.3390/ph16060877
Chicago/Turabian StyleYou, Shen, Ming-Jin Wang, Zhen-Yan Hou, Wei-Da Wang, Ting-Ting Du, Ni-Na Xue, Ming Ji, and Xiao-Guang Chen. 2023. "Chlorogenic Acid Induced Neuroblastoma Cells Differentiation via the ACAT1-TPK1-PDH Pathway" Pharmaceuticals 16, no. 6: 877. https://doi.org/10.3390/ph16060877
APA StyleYou, S., Wang, M.-J., Hou, Z.-Y., Wang, W.-D., Du, T.-T., Xue, N.-N., Ji, M., & Chen, X.-G. (2023). Chlorogenic Acid Induced Neuroblastoma Cells Differentiation via the ACAT1-TPK1-PDH Pathway. Pharmaceuticals, 16(6), 877. https://doi.org/10.3390/ph16060877
