Role of Ezrin/Radixin/Moesin in the Surface Localization of Programmed Cell Death Ligand-1 in Human Colon Adenocarcinoma LS180 Cells
Abstract
:1. Introduction
2. Results
2.1. Gene and Protein Expression Analysis of PD-L1 and the EMR Proteins in LS180 Cells
2.2. Subcellular Localization of PD-L1 and the ERM Proteins in LS180 Cells
2.3. Molecular Interaction between PD-L1 and the ERM Proteins in LS180 Cells
2.4. Effect of siRNAs for Each ERM on the Expression Levels of Target mRNAs in LS180 Cells
2.5. Effect of ERM Silencing on Gene and Protein Expression of PD-L1 in LS180 Cells
2.6. Gene Correlation Analysis of PD-L1 with Ezrin and Radixin in Human Colon Adenocarcinoma
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Transfection of Cells with siRNAs
4.3. RNA Isolation and Real-Time RT-qPCR
4.4. CLSM Analysis
4.4.1. Single Immunofluorescence Staining
4.4.2. Double Immunofluorescence Staining
4.5. Flow Cytometry Analysis
4.6. Protein Isolation
4.7. Western Blotting
4.8. Immunoprecipitation Assay
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Dai, Y.; Zhao, W.; Yue, L.; Dai, X.; Rong, D.; Wu, F.; Gu, J.; Qian, X. Perspectives on Immunotherapy of Metastatic Colorectal Cancer. Front. Oncol. 2021, 11, 659964. [Google Scholar] [CrossRef] [PubMed]
- Hull, R.; Francies, F.Z.; Oyomno, M.; Dlamini, Z. Colorectal Cancer Genetics, Incidence and Risk Factors: In Search for Targeted Therapies. Cancer Manag. Res. 2020, 12, 9869–9882. [Google Scholar] [CrossRef] [PubMed]
- Vaghari-Tabari, M.; Majidinia, M.; Moein, S.; Qujeq, D.; Asemi, Z.; Alemi, F.; Mohamadzadeh, R.; Targhazeh, N.; Safa, A.; Yousefi, B. MicroRNAs and colorectal cancer chemoresistance: New solution for old problem. Life Sci. 2020, 259, 118255. [Google Scholar] [CrossRef]
- Yarla, N.S.; Madka, V.; Pathuri, G.; Rao, C.V. Molecular Targets in Precision Chemoprevention of Colorectal Cancer: An Update from Pre-Clinical to Clinical Trials. Int. J. Mol. Sci. 2020, 21, 9609. [Google Scholar] [CrossRef]
- Jung, E.; Choi, J.; Kim, J.S.; Han, T.S. MicroRNA-Based Therapeutics for Drug-Resistant Colorectal Cancer. Pharmaceuticals 2021, 14, 136. [Google Scholar] [CrossRef]
- Shi, L.; Chen, S.; Yang, L.; Li, Y. The role of PD-1 and PD-L1 in T-cell immune suppression in patients with hematological malignancies. J. Hematol. Oncol. 2013, 6, 74. [Google Scholar] [CrossRef] [Green Version]
- Ohaegbulam, K.C.; Assal, A.; Lazar-Molnar, E.; Yao, Y.; Zang, X. Human cancer immunotherapy with antibodies to the PD-1 and PD-L1 pathway. Trends Mol. Med. 2015, 21, 24–33. [Google Scholar] [CrossRef] [Green Version]
- Garon, E.B.; Rizvi, N.A.; Hui, R.; Leighl, N.; Balmanoukian, A.S.; Eder, J.P.; Patnaik, A.; Aggarwal, C.; Gubens, M.; Horn, L.; et al. Pembrolizumab for the treatment of non-small-cell lung cancer. N. Engl. J. Med. 2015, 372, 2018–2028. [Google Scholar] [CrossRef]
- Gatalica, Z.; Snyder, C.; Maney, T.; Ghazalpour, A.; Holterman, D.A.; Xiao, N.; Overberg, P.; Rose, I.; Basu, G.D.; Vranic, S.; et al. Programmed cell death 1 (PD-1) and its ligand (PD-L1) in common cancers and their correlation with molecular cancer type. Cancer Epidemiol. Biomark. Prev. 2014, 23, 2965–2970. [Google Scholar] [CrossRef] [Green Version]
- Tu, X.; Qin, B.; Zhang, Y.; Zhang, C.; Kahila, M.; Nowsheen, S.; Yin, P.; Yuan, J.; Pei, H.; Li, H.; et al. PD-L1 (B7-H1) Competes with the RNA Exosome to Regulate the DNA Damage Response and Can Be Targeted to Sensitize to Radiation or Chemotherapy. Mol. Cell 2019, 74, 1215–1226.e4. [Google Scholar] [CrossRef]
- Qin, W.; Hu, L.; Zhang, X.; Jiang, S.; Li, J.; Zhang, Z.; Wang, X. The Diverse Function of PD-1/PD-L Pathway Beyond Cancer. Front. Immunol. 2019, 10, 2298. [Google Scholar] [CrossRef]
- Nixon, N.A.; Blais, N.; Ernst, S.; Kollmannsberger, C.; Bebb, G.; Butler, M.; Smylie, M.; Verma, S. Current landscape of immunotherapy in the treatment of solid tumours, with future opportunities and challenges. Curr. Oncol. 2018, 25, e373–e384. [Google Scholar] [CrossRef] [Green Version]
- Gong, J.; Chehrazi-Raffle, A.; Reddi, S.; Salgia, R. Development of PD-1 and PD-L1 inhibitors as a form of cancer immunotherapy: A comprehensive review of registration trials and future considerations. J. Immunother. Cancer 2018, 6, 8. [Google Scholar] [CrossRef]
- Yarchoan, M.; Johnson, B.A., 3rd; Lutz, E.R.; Laheru, D.A.; Jaffee, E.M. Targeting neoantigens to augment antitumour immunity. Nat. Rev. Cancer 2017, 17, 569. [Google Scholar] [CrossRef]
- Melillo, G.; Chand, V.; Yovine, A.; Gupta, A.; Massacesi, C. Curative-Intent Treatment with Durvalumab in Early-Stage Cancers. Adv. Ther. 2021, 38, 2759–2778. [Google Scholar] [CrossRef]
- Wilson, K.C.; Flood, M.P.; Oh, D.; Calvin, N.; Michael, M.; Ramsay, R.G.; Heriot, A.G. Immune Checkpoint Blockade in Lower Gastrointestinal Cancers: A Systematic Review. Ann. Surg. Oncol. 2021. [Google Scholar] [CrossRef]
- Agarwal, P.; Le, D.T.; Boland, P.M. Immunotherapy in colorectal cancer. Adv. Cancer Res. 2021, 151, 137–196. [Google Scholar]
- Yuan, Z.; Fan, G.; Wu, H.; Liu, C.; Zhan, Y.; Qiu, Y.; Shou, C.; Gao, F.; Zhang, J.; Yin, P.; et al. Photodynamic Therapy Synergize with PD-L1 Checkpoint Blockade for Immunotherapy of Colorectal Cancer by Multifunctional Nanoparticle. Mol. Ther. 2021. [Google Scholar] [CrossRef]
- Hogner, A.; Thuss-Patience, P. Immune Checkpoint Inhibition in Oesophago-Gastric Carcinoma. Pharmaceuticals 2021, 14, 151. [Google Scholar] [CrossRef]
- Cha, J.H.; Chan, L.C.; Li, C.W.; Hsu, J.L.; Hung, M.C. Mechanisms Controlling PD-L1 Expression in Cancer. Mol. Cell 2019, 76, 359–370. [Google Scholar] [CrossRef]
- Zaretsky, J.M.; Garcia-Diaz, A.; Shin, D.S.; Escuin-Ordinas, H.; Hugo, W.; Hu-Lieskovan, S.; Torrejon, D.Y.; Abril-Rodriguez, G.; Sandoval, S.; Barthly, L.; et al. Mutations Associated with Acquired Resistance to PD-1 Blockade in Melanoma. N. Engl. J. Med. 2016, 375, 819–829. [Google Scholar] [CrossRef]
- Sharma, P.; Hu-Lieskovan, S.; Wargo, J.A.; Ribas, A. Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. Cell 2017, 168, 707–723. [Google Scholar] [CrossRef] [Green Version]
- Koyama, S.; Akbay, E.A.; Li, Y.Y.; Herter-Sprie, G.S.; Buczkowski, K.A.; Richards, W.G.; Gandhi, L.; Redig, A.J.; Rodig, S.J.; Asahina, H.; et al. Adaptive resistance to therapeutic PD-1 blockade is associated with upregulation of alternative immune checkpoints. Nat. Commun. 2016, 7, 10501. [Google Scholar] [CrossRef]
- Wang, Z.; Wu, X. Study and analysis of antitumor resistance mechanism of PD1/PD-L1 immune checkpoint blocker. Cancer Med. 2020, 9, 8086–8121. [Google Scholar] [CrossRef]
- Perez-Ruiz, E.; Melero, I.; Kopecka, J.; Sarmento-Ribeiro, A.B.; Garcia-Aranda, M.; De Las Rivas, J. Cancer immunotherapy resistance based on immune checkpoints inhibitors: Targets, biomarkers, and remedies. Drug Resist. Updates 2020, 53, 100718. [Google Scholar] [CrossRef]
- Ni, W.; Mo, H.; Liu, Y.; Xu, Y.; Qin, C.; Zhou, Y.; Li, Y.; Li, Y.; Zhou, A.; Yao, S.; et al. Targeting Cholesterol Biosynthesis Promotes Anti-tumor Immunity by Inhibiting Long Noncoding RNA SNHG29 Mediated YAP Activation. Mol. Ther. 2021. [Google Scholar] [CrossRef]
- Llosa, N.J.; Cruise, M.; Tam, A.; Wicks, E.C.; Hechenbleikner, E.M.; Taube, J.M.; Blosser, R.L.; Fan, H.; Wang, H.; Luber, B.S.; et al. The vigorous immune microenvironment of microsatellite instable colon cancer is balanced by multiple counter-inhibitory checkpoints. Cancer Discov. 2015, 5, 43–51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, Y.; Freeman, G.J. The microsatellite instable subset of colorectal cancer is a particularly good candidate for checkpoint blockade immunotherapy. Cancer Discov. 2015, 5, 16–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Omura, Y.; Toiyama, Y.; Okugawa, Y.; Yin, C.; Shigemori, T.; Kusunoki, K.; Kusunoki, Y.; Ide, S.; Shimura, T.; Fujikawa, H.; et al. Prognostic impacts of tumoral expression and serum levels of PD-L1 and CTLA-4 in colorectal cancer patients. Cancer Immunol. Immunother. 2020, 69, 2533–2546. [Google Scholar] [CrossRef]
- Xu, J.; Zhao, W.; Liao, K.; Tu, L.; Jiang, X.; Dai, H.; Yu, Y.; Xiong, Q.; Xiong, Z. Clinical retrospective study on the expression of the PD-L1 molecule in sporadic colorectal cancer and its correlation with K-ras gene mutations in Chinese patients. Am. J. Transl. Res. 2021, 13, 6142–6155. [Google Scholar]
- Wang, Y.N.; Lee, H.H.; Hsu, J.L.; Yu, D.; Hung, M.C. The impact of PD-L1 N-linked glycosylation on cancer therapy and clinical diagnosis. J. Biomed. Sci. 2020, 27, 77. [Google Scholar] [CrossRef]
- Li, S.M.; Zhou, J.; Wang, Y.; Nie, R.C.; Chen, J.W.; Xie, D. Recent Findings in the Posttranslational Modifications of PD-L1. J. Oncol. 2020, 2020, 5497015. [Google Scholar] [CrossRef]
- Fernandez-Ponce, C.; Geribaldi-Doldan, N.; Sanchez-Gomar, I.; Quiroz, R.N.; Ibarra, L.A.; Escorcia, L.G.; Fernandez-Cisnal, R.; Martinez, G.A.; Garcia-Cozar, F.; Quiroz, E.N. The Role of Glycosyltransferases in Colorectal Cancer. Int. J. Mol. Sci. 2021, 22, 5822. [Google Scholar] [CrossRef]
- Mezzadra, R.; Sun, C.; Jae, L.T.; Gomez-Eerland, R.; de Vries, E.; Wu, W.; Logtenberg, M.E.W.; Slagter, M.; Rozeman, E.A.; Hofland, I.; et al. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators. Nature 2017, 549, 106–110. [Google Scholar] [CrossRef]
- Burr, M.L.; Sparbier, C.E.; Chan, Y.C.; Williamson, J.C.; Woods, K.; Beavis, P.A.; Lam, E.Y.N.; Henderson, M.A.; Bell, C.C.; Stolzenburg, S.; et al. CMTM6 maintains the expression of PD-L1 and regulates anti-tumour immunity. Nature 2017, 549, 101–105. [Google Scholar] [CrossRef] [Green Version]
- Ogihara, T.; Mizoi, K.; Kamioka, H.; Yano, K. Physiological Roles of ERM Proteins and Transcriptional Regulators in Supporting Membrane Expression of Efflux Transporters as Factors of Drug Resistance in Cancer. Cancers 2020, 12, 3352. [Google Scholar] [CrossRef]
- Kobori, T.; Harada, S.; Nakamoto, K.; Tokuyama, S. Mechanisms of P-glycoprotein alteration during anticancer treatment: Role in the pharmacokinetic and pharmacological effects of various substrate drugs. J. Pharmacol. Sci. 2014, 125, 242–254. [Google Scholar] [CrossRef] [Green Version]
- Luciani, F.; Molinari, A.; Lozupone, F.; Calcabrini, A.; Lugini, L.; Stringaro, A.; Puddu, P.; Arancia, G.; Cianfriglia, M.; Fais, S. P-glycoprotein-actin association through ERM family proteins: A role in P-glycoprotein function in human cells of lymphoid origin. Blood 2002, 99, 641–648. [Google Scholar] [CrossRef]
- Kawaguchi, K.; Yoshida, S.; Hatano, R.; Asano, S. Pathophysiological Roles of Ezrin/Radixin/Moesin Proteins. Biol. Pharm. Bull. 2017, 40, 381–390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Asp, N.; Kvalvaag, A.; Sandvig, K.; Pust, S. Regulation of ErbB2 localization and function in breast cancer cells by ERM proteins. Oncotarget 2016, 7, 25443–25460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rudnicka, D.; Oszmiana, A.; Finch, D.K.; Strickland, I.; Schofield, D.J.; Lowe, D.C.; Sleeman, M.A.; Davis, D.M. Rituximab causes a polarization of B cells that augments its therapeutic function in NK-cell-mediated antibody-dependent cellular cytotoxicity. Blood 2013, 121, 4694–4702. [Google Scholar] [CrossRef] [PubMed]
- Clucas, J.; Valderrama, F. ERM proteins in cancer progression. J. Cell Sci. 2014, 127, 267–275. [Google Scholar] [CrossRef] [Green Version]
- Meng, F.; Su, Y.; Xu, B. Rho-associated protein kinase-dependent moesin phosphorylation is required for PD-L1 stabilization in breast cancer. Mol. Oncol. 2020, 14, 2701–2712. [Google Scholar] [CrossRef]
- Yang, Q.; Onuki, R.; Nakai, C.; Sugiyama, Y. Ezrin and radixin both regulate the apical membrane localization of ABCC2 (MRP2) in human intestinal epithelial Caco-2 cells. Exp. Cell Res. 2007, 313, 3517–3525. [Google Scholar] [CrossRef]
- Kobori, T.; Tameishi, M.; Tanaka, C.; Urashima, Y.; Obata, T. Subcellular distribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells. PLoS ONE 2021, 16, e0250889. [Google Scholar] [CrossRef]
- Cancer Genome Atlas, N. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012, 487, 330–337. [Google Scholar] [CrossRef] [Green Version]
- Chandrashekar, D.S.; Bashel, B.; Balasubramanya, S.A.H.; Creighton, C.J.; Ponce-Rodriguez, I.; Chakravarthi, B.; Varambally, S. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia 2017, 19, 649–658. [Google Scholar] [CrossRef]
- Nowak, D.; Mazur, A.J.; Popow-Wozniak, A.; Radwanska, A.; Mannherz, H.G.; Malicka-Blaszkiewicz, M. Subcellular distribution and expression of cofilin and ezrin in human colon adenocarcinoma cell lines with different metastatic potential. Eur. J. Histochem. 2010, 54, e14. [Google Scholar] [CrossRef] [Green Version]
- Kanaan, Z.; Qadan, M.; Eichenberger, M.R.; Galandiuk, S. The actin-cytoskeleton pathway and its potential role in inflammatory bowel disease-associated human colorectal cancer. Genet. Test. Mol. Biomark. 2010, 14, 347–353. [Google Scholar] [CrossRef]
- Jiang, Q.H.; Wang, A.X.; Chen, Y. Radixin enhances colon cancer cell invasion by increasing MMP-7 production via Rac1-ERK pathway. Sci. World J. 2014, 2014, 340271. [Google Scholar] [CrossRef] [Green Version]
- Yang, A.; Li, M.Y.; Zhang, Z.H.; Wang, J.Y.; Xing, Y.; Ri, M.; Jin, C.H.; Xu, G.H.; Piao, L.X.; Jin, H.L.; et al. Erianin regulates programmed cell death ligand 1 expression and enhances cytotoxic T lymphocyte activity. J. Ethnopharmacol. 2021, 273, 113598. [Google Scholar] [CrossRef]
- Yuan, W.; Deng, D.; Li, H.; Hu, X.; Shang, X.; Hou, X.; Jiang, H.; He, H. IFNgamma/PD-L1 Signaling Improves the Responsiveness of Anti-PD-1 Therapy in Colorectal Cancer: An in vitro Study. OncoTargets Ther. 2021, 14, 3051–3062. [Google Scholar] [CrossRef]
- Berggren, S.; Gall, C.; Wollnitz, N.; Ekelund, M.; Karlbom, U.; Hoogstraate, J.; Schrenk, D.; Lennernas, H. Gene and protein expression of P-glycoprotein, MRP1, MRP2, and CYP3A4 in the small and large human intestine. Mol. Pharm. 2007, 4, 252–257. [Google Scholar] [CrossRef]
- Gerlach, J.H. Structure and function of P-glycoprotein. Cancer Treat. Res. 1989, 48, 37–53. [Google Scholar]
- Ogihara, T.; Kamiya, M.; Ozawa, M.; Fujita, T.; Yamamoto, A.; Yamashita, S.; Ohnishi, S.; Isomura, Y. What kinds of substrates show P-glycoprotein-dependent intestinal absorption? Comparison of verapamil with vinblastine. Drug Metab. Pharmacokinet. 2006, 21, 238–244. [Google Scholar] [CrossRef] [Green Version]
- Ghosh, S.; Di Bartolo, V.; Tubul, L.; Shimoni, E.; Kartvelishvily, E.; Dadosh, T.; Feigelson, S.W.; Alon, R.; Alcover, A.; Haran, G. ERM-Dependent Assembly of T Cell Receptor Signaling and Co-stimulatory Molecules on Microvilli prior to Activation. Cell Rep. 2020, 30, 3434–3447.e6. [Google Scholar] [CrossRef] [Green Version]
- Hoshi, Y.; Uchida, Y.; Kuroda, T.; Tachikawa, M.; Couraud, P.O.; Suzuki, T.; Terasaki, T. Distinct roles of ezrin, radixin and moesin in maintaining the plasma membrane localizations and functions of human blood-brain barrier transporters. J. Cereb. Blood Flow Metab. 2020, 40, 1533–1545. [Google Scholar] [CrossRef]
- Zhang, Y.; Dong, J.; Zhu, X.; Wang, W.; Yang, Q. The effect of sphingomyelin synthase 2 (SMS2) deficiency on the expression of drug transporters in mouse brain. Biochem. Pharmacol. 2011, 82, 287–294. [Google Scholar] [CrossRef]
- Kobori, T.; Fujiwara, S.; Miyagi, K.; Harada, S.; Nakamoto, K.; Nakagawa, T.; Takahashi, H.; Narita, M.; Tokuyama, S. Involvement of moesin in the development of morphine analgesic tolerance through P-glycoprotein at the blood-brain barrier. Drug Metab. Pharmacokinet. 2014, 29, 482–489. [Google Scholar] [CrossRef]
- Yano, K.; Otsuka, K.; Kato, Y.; Kawabata, H.; Ohmori, S.; Arakawa, H.; Ogihara, T. Different regulation of P-glycoprotein function between Caco-2 and Caki-1 cells by ezrin, radixin and moesin proteins. J. Pharm. Pharmacol. 2016, 68, 361–367. [Google Scholar] [CrossRef]
- Song, Y.; Ma, X.; Zhang, M.; Wang, M.; Wang, G.; Ye, Y.; Xia, W. Ezrin Mediates Invasion and Metastasis in Tumorigenesis: A Review. Front. Cell Dev. Biol. 2020, 8, 588801. [Google Scholar] [CrossRef]
- Federici, C.; Brambilla, D.; Lozupone, F.; Matarrese, P.; de Milito, A.; Lugini, L.; Iessi, E.; Cecchetti, S.; Marino, M.; Perdicchio, M.; et al. Pleiotropic function of ezrin in human metastatic melanomas. Int. J. Cancer 2009, 124, 2804–2812. [Google Scholar] [CrossRef]
- Brambilla, D.; Fais, S. The Janus-faced role of ezrin in “linking” cells to either normal or metastatic phenotype. Int. J. Cancer 2009, 125, 2239–2245. [Google Scholar] [CrossRef]
- Takamatsu, H.; Espinoza, J.L.; Lu, X.; Qi, Z.; Okawa, K.; Nakao, S. Anti-moesin antibodies in the serum of patients with aplastic anemia stimulate peripheral blood mononuclear cells to secrete TNF-alpha and IFN-gamma. J. Immunol. 2009, 182, 703–710. [Google Scholar] [CrossRef]
- Suzuki, K.; Nagao, T.; Itabashi, M.; Hamano, Y.; Sugamata, R.; Yamazaki, Y.; Yumura, W.; Tsukita, S.; Wang, P.C.; Nakayama, T.; et al. A novel autoantibody against moesin in the serum of patients with MPO-ANCA-associated vasculitis. Nephrol. Dial. Transplant. 2014, 29, 1168–1177. [Google Scholar] [CrossRef] [Green Version]
- Kobori, T.; Hamasaki, S.; Kitaura, A.; Yamazaki, Y.; Nishinaka, T.; Niwa, A.; Nakao, S.; Wake, H.; Mori, S.; Yoshino, T.; et al. Interleukin-18 Amplifies Macrophage Polarization and Morphological Alteration, Leading to Excessive Angiogenesis. Front. Immunol. 2018, 9, 334. [Google Scholar] [CrossRef] [PubMed]
- Hamasaki, S.; Kobori, T.; Yamazaki, Y.; Kitaura, A.; Niwa, A.; Nishinaka, T.; Nishibori, M.; Mori, S.; Nakao, S.; Takahashi, H. Effects of scavenger receptors-1 class A stimulation on macrophage morphology and highly modified advanced glycation end product-protein phagocytosis. Sci. Rep. 2018, 8, 5901. [Google Scholar] [CrossRef] [PubMed]
- Kobori, T.; Harada, S.; Nakamoto, K.; Tokuyama, S. Changes in PtdIns(4,5)P2 induced by etoposide treatment modulates small intestinal P-glycoprotein via radixin. Biol. Pharm. Bull. 2014, 37, 1124–1131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kobori, T.; Harada, S.; Nakamoto, K.; Tokuyama, S. Radixin influences the changes in the small intestinal p-glycoprotein by Etoposide treatment. Biol. Pharm. Bull. 2013, 36, 1822–1828. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Sequence (5′→3′) |
---|---|
h-β-Actin (forward) | TGGCACCCAGCACAATGAA |
h-β-Actin (reverse) | CTAAGTCATAGTCCGCCTAGAAGCA |
h-PD-L1 (forward) | CAATGTGACCAGCACACTGAGAA |
h-PD-L1 (reverse) | GGCATAATAAGATGGCTCCCAGAA |
h-Ezrin (forward) | ACCATGGATGCAGAGCTGGAG |
h-Ezrin (reverse) | CATAGTGGAGGCCAAAGTACCACA |
h-Radixin (forward) | GAATTTGCCATTCAGCCCAATA |
h-Radixin (reverse) | GCCATGTAGAATAACCTTTGCTGTC |
h-Moesin (forward) | CCGAATCCAAGCCGTGTGTA |
h-Moesin (reverse) | GGCAAACTCCAGCTCTGCATC |
h-IFN-ɤ (forward) | CTTTAAAGATGACCAGAGCATCCAA |
h-IFN-ɤ (reverse) | GGCGACAGTTCAGCCATCAC |
h-TNF (forward) | ACAACCCTCAGACGCCACAT |
h-TNF (reverse) | GTGGAGCCGTGGGTCAGTAT |
h-IL-6 (forward) | AAGCCAGAGCTGTGCAGATGAGTA |
h-IL-6 (reverse) | TGTCCTGCAGCCACTGGTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kobori, T.; Tanaka, C.; Tameishi, M.; Urashima, Y.; Ito, T.; Obata, T. Role of Ezrin/Radixin/Moesin in the Surface Localization of Programmed Cell Death Ligand-1 in Human Colon Adenocarcinoma LS180 Cells. Pharmaceuticals 2021, 14, 864. https://doi.org/10.3390/ph14090864
Kobori T, Tanaka C, Tameishi M, Urashima Y, Ito T, Obata T. Role of Ezrin/Radixin/Moesin in the Surface Localization of Programmed Cell Death Ligand-1 in Human Colon Adenocarcinoma LS180 Cells. Pharmaceuticals. 2021; 14(9):864. https://doi.org/10.3390/ph14090864
Chicago/Turabian StyleKobori, Takuro, Chihiro Tanaka, Mayuka Tameishi, Yoko Urashima, Takuya Ito, and Tokio Obata. 2021. "Role of Ezrin/Radixin/Moesin in the Surface Localization of Programmed Cell Death Ligand-1 in Human Colon Adenocarcinoma LS180 Cells" Pharmaceuticals 14, no. 9: 864. https://doi.org/10.3390/ph14090864