G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla
Abstract
:1. Introduction
2. Experimental
2.1. Materials
2.2. Instrumentation
2.3. Assay Procedure
2.4. CD Measurements
3. Results and Discussion
3.1. Principle of the DNAzyme MB Sensor Detecting PH nrDNA ITS Sequence
3.2. Design of Probes
3.3. Optimization of Probe
3.4. CD Spectra of Probes
3.5. Colorimetric Analysis of T-DNA
3.6. Specificity Study
4. Conclusions
Acknowledgments
References
- Reinecke, M.G.; Zhao, Y.Y. Phytochemical studies of the Chinese Herb Ta-zi-shen, Pseudostellaria heterophylla. J. Nat. Prod. 1988, 51, 1236–1240. [Google Scholar]
- Xu, X.Q.; Li, Q.L.; Yuan, J.D. Determination of three kinds of chloroacetanilide herbicides in Radix pseudostellariae by accelerated solvent extraction and gas chromatography-mass specrometry. Chin. J. Anal. Chem. 2007, 35, 206–210. [Google Scholar]
- Shen, Y.; Han, C.; Liu, J.D.; Liu, A.L.; Ji, X.W.; Liu, C.P. Analysis of volatile components of Pseudostellaria heterophylla (Miq.) pax by microwave-assisted solvent extraction and GC-MS. Chromatographia 2008, 68, 679–682. [Google Scholar]
- Lin, H.; Zhao, J.W.; Chen, Q.S.; Zhou, F.; Sun, L. Discrimination of Radix Pseudostellariae according to geographical origins using NIR spectroscopy and support vector data description. Spectrochim. Acta A 2011, 79, 1381–1385. [Google Scholar]
- Zhu, Y.; Qin, M.J.; Hang, Y.Y.; Wang, L.Q. Authentication of Pseudostellaria heterophylla and its counterfeit species by analysis of rDNA ITS sequences. Chin. J. Nat. Med. 2007, 5, 211–215. [Google Scholar]
- Yip, P.Y.; Chau, C.F.; Mak, C.Y.; Kwan, H.S. DNA methods for identification of Chinese medicinal materials. Chin. Med. 2007, 2, 1–19. [Google Scholar]
- Han, C.; Chen, J.H.; Chen, B.; Lee, F.S.C.; Wang, X.R. Fingerprint chromatogram analysis of Pseodostellaria heterophylla (Miq.) Pax root by high performance liquid chromatography. J. Sep. Sci. 2006, 29, 2197–2202. [Google Scholar]
- Han, C.; Shen, Y.; Chen, J.H.; Lee, F.S.C.; Wang, X.R. HPLC fingerprinting and LC-TOF-MS analysis of the extract of Pseudostellaria heterophylla (Miq.) Pax root. J. Chromatogr. B 2008, 862, 125–131. [Google Scholar]
- Li, S.H.; Liu, X.H.; Huang, M.H. Analytical studies on HPCE fingerprint of Radix pseudostellariae. Lishizhen Med. Mater. Med. Res. 2007, 18, 820–821. [Google Scholar]
- Liu, X.H.; Wang, M.; Cai, B.C.; Wang, Y.X.; Lin, X.Y. GC-MS fingerprint of root tuber of Pseudostellaria heterophylla. Chin. Trad.Herbal Drugs 2007, 38, 113–116. [Google Scholar]
- Ruan, G.H.; Li, G.K. The study on the chromatographic fingerprint of Fructus xanthii by microwave assisted extraction coupled with GC-MS. J. Chromatogr. B 2007, 850, 241–248. [Google Scholar]
- Wojciechowski, M.F.; Sanderson, M.J.; Baldwin, B.G.; Donoghue, M.J. Monophyly of aneuploid Astragalus (Fabaceae): Evidence from nuclear ribosomal DNA internal transcribed spacer sequences. Am. J. Bot. 1993, 80, 711–722. [Google Scholar]
- Baldwin, B.G.; Sanderson, M.J.; Porter, J.M.; Wojciechowski, M.F.; Campbell, C.S.; Donoghue, M.J. The ITS region of nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Ann. Missouri Bot. Gard. 1995, 82, 247–277. [Google Scholar]
- Ding, X.Y.; Wang, Z.T.; Xu, H.; Xu, L.S.; Zhou, K.Y. Database establishment of the whole rDNA ITS region of Dendrobium species of “fengdou” and authentication by analysis of their sequences. Acta Pharm. Sin. 2002, 37, 567–573. [Google Scholar]
- Ding, P.; Fang, Q. Ribosomal DNA-ITS sequence analysis and molecular identification of Morinda officinalis and its counterfeit species. Chin. Tradit. Herbal Drugs 2005, 36, 908–911. [Google Scholar]
- Zhao, Z.L.; Zhou, K.Y.; Dong, H.; Xu, L.S. Characters of nrDNA ITS region sequences of fruits of Alpinia galanga and their adulterants. Planta Med. 2001, 67, 381–383. [Google Scholar]
- Bai, D.P.; Brandle, J.; Reeleder, R. Genetic diversity in North American ginseng (Panax quinqnefolins L.) grown in Ontario detected by RAPD analysis. Genome 1997, 40, 111–115. [Google Scholar]
- Fushimi, H.; Komatsu, K.; Isobe, M.; Namba, T. Application of PCR-RFLP and MASA analyses on 18S ribosomal RNA gene sequence for the identification of three Ginseng drugs. Biol. Pharm. Bull. 1997, 20, 765–769. [Google Scholar]
- Wang, H.T.; Kim, M.K.; Kwon, W.S.; Jin, H.Z.; Liang, Z.Q.; Yang, D.C. Molecular authentication of Panax ginseng and ginseng products using robust SNP markers in ribosomal external transcribed spacer region. J. Pharm. Biomed. Anal. 2011, 55, 972–976. [Google Scholar]
- Hon, C.C.; Chow, Y.C.; Zeng, F.Y.; Leung, F.C.C. Genetic authentication of ginseng and other traditional Chinese medicine. Acta Pharmacol. Sin. 2003, 24, 841–846. [Google Scholar]
- Tyagi, S.; Kramer, F.R. Molecular beacons: Probes that fluoresce upon hybridization. Nat. Biotechnol. 1996, 14, 303–308. [Google Scholar]
- Zhang, J.Q.; Wang, Y.S.; Xue, J.H.; He, Y.; Yang, H.X.; Liang, J.; Shi, L.F.; Xiao, X.L. A gold nanoparticles-modified aptamer beacon for urinary adenosine detection based on structure-switching/fluorescence-“turning on” mechanism. J. Pharm. Biomed. Anal. 2012, 70, 362–368. [Google Scholar]
- Yang, R.H.; Jin, J.Y.; Long, L.P.; Wang, Y.X.; Wang, H.; Tan, W.H. Reversible molecular switching of molecular beacon: Controlling DNA hybridization kinetics and thermodynamics using mercury (II) ions. Chem. Commun. 2009. [Google Scholar] [CrossRef]
- Bourdoncle, A.; Estevez Torres, A.; Gosse, C.; Lacroix, L.; Vekhoff, P.; Le Saux, T.; Jullien, L.; Mergny, J.L. Quadruplex-based molecular beacons as tunable DNA probes. J. Am. Chem. Soc. 2006, 128, 11094–11105. [Google Scholar]
- Fang, X.H.; Liu, X.J.; Schuster, S.; Tan, W.H. Designing a novel molecular beacon for surface-immobilized DNA hybridization studies. J. Am. Chem. Soc. 1999, 121, 2921–2922. [Google Scholar]
- Zhang, L.B.; Zhu, J.B.; Li, T.; Wang, E.K. Bifunctional colorimetric oligonucleotide probe based on a G-quadruplex DNAzyme molecular beacon. Anal. Chem. 2011, 83, 8871–8876. [Google Scholar]
- Travascio, P.; Li, Y.F.; Sen, D. DNA-enhanced peroxidase activity of a DNA aptamer-hemin complex. Chem. Biol. 1998, 5, 505–517. [Google Scholar]
- Fu, L.H.; Li, B.X.; Zhang, Y.F. Label-free fluorescence method for screening G-quadruplex ligands. Anal. Biochem. 2012, 421, 198–202. [Google Scholar]
- Cheng, X.H.; Liu, X.J.; Bing, T.; Cao, Z.H.; Shangguan, D.H. General peroxidase activity of G-quadruplex-hemin complexes and its application in ligand screening. Biochemistry 2009, 48, 7817–7823. [Google Scholar]
- Waller, Z.A.E.; Sewitz, S.A.; Hsu, S.T.D.; Balasubramanian, S. A small molecule that disrupts G-quadruplex DNA structure and enhances gene expression. J. Am. Chem. Soc. 2009, 131, 12628–12633. [Google Scholar]
- Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. Catalytic beacons for the detection of DNA and telomerase activity. J. Am. Chem. Soc. 2004, 126, 7430–7431. [Google Scholar]
- Li, T.; Dong, S.J.; Wang, E.K. Enhanced catalytic DNAzyme for label-free colorimetric detection of DNA. Chem. Commun. 2007, 4209–4211. [Google Scholar]
- Deng, M.G.; Zhang, D.; Zhou, Y.Y.; Zhou, X. Highly effective colorimetric and visual detection of nucleic acids using an asymmetrically split peroxidase DNAzyme. J. Am. Chem. Soc. 2008, 130, 13095–13102. [Google Scholar]
- Nakayama, S.; Sintim, H.O. Colorimetric split G-quadruplex probes for nucleic acid sensing: Improving reconstituted ’DNAzyme's catalytic efficiency via probe remodeling. J. Am. Chem. Soc. 2009, 131, 10320–10333. [Google Scholar]
- Fu, R.Z.; Li, T.H.; Lee, S.S.; Park, H.G. DNAzyme molecular beacon probes for target-induced signal-amplifying colorimetric detection of nucleic acids. Anal. Chem. 2011, 83, 494–500. [Google Scholar]
- Qiu, B.; Zheng, Z.Z.; Lu, Y.J.; Lin, Z.Y.; Wong, K.Y.; Chen, G.N. G-quadruplex DNAzyme as the turn on switch for fluorimetric detection of genetically modified organisms. Chem. Commun. 2011, 47, 1437–1439. [Google Scholar]
- Kolpashchikov, D.M. A binary DNA probe for highly specific nucleic acid recognition. J. Am. Chem. Soc. 2006, 128, 10625–10628. [Google Scholar]
- Shlyahovsky, B.; Li, D.; Katz, E.; Willner, I. Proteins modified with DNAzymes or aptamers act as biosensors or biosensor labels. Biosens. Bioelectron. 2007, 22, 2570–2576. [Google Scholar]
- Zhu, D.; Luo, J.J.; Rao, X.Y.; Zhang, J.J.; Cheng, G.F.; He, P.G.; Fang, Y.Z. Utilization of split G-quadruplex makes the design of an assay more flexible. Anal. Chim. Acta 2012, 711, 91–96. [Google Scholar]
- Paramasivan, S.; Rujan, I.; Bolton, P.H. Circular dichroism of quadruplex DNAs: Applications to structure, cation effects and ligand binding. Methods 2007, 43, 324–331. [Google Scholar]
- Rajendran, A.; Nair, B.U. Unprecedented dual binding behaviour of acridine group of dye: A combined experimental and theoretical investigation for the development of anticancer chemotherapeutic agents. Biochim. Biophys. Acta 2006, 1760, 1794–1801. [Google Scholar]





| Oligomer | Sequence (from 5′to 3′) | |
|---|---|---|
| T-DNA | PH | TCGAAACCTG CCCAGC- - - - AGAACGACCA GCGAACA |
| C-DNA | LG | TCG TGACCCT T - - AAC - - - - AA AACAGACC GCGCACG |
| LP | TCAACACGTG TGCAGTTTAG AGCATACT CA ATA AACA | |
| OJ | TCAATACGTG TG - AGTTTA - AGCATACTCA ATA AACA | |
| SS | TCAATACATG TGCAGTTTA - AG CATACTCA GTGAACA | |
| SJ | TCAGTACATG TGCAGTTTAG AGCATA -TCA ATA AACA | |
| probe | probe-1 | GGGATT GGGATT TGTTCGCTGGTCGTTCTGCTGGGCAGGTTTCGA TTAGGG TTAGGG |
| probe-2 | GGGATT GGGATT TGTTCGC TGGTCGTTCTGCTGGGCAGGTTTCGA GCGAACA TTAGGG TTAGGG | |
| probe-3 | GGGATT TGTTCGCTGGTCGTTCTGCTGGGCAGGTTTCGA TTAGGG | |
| probe-4 | GGGATT TGTTCGC TGGTCGTTCTGCTGGGCAGGTTTCGA GCGAACA TTAGGG | |
| Hum24 | (TTAGGG)4 | |
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Zheng, Z.; Han, J.; Pang, W.; Hu, J. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla. Sensors 2013, 13, 1064-1075. https://doi.org/10.3390/s130101064
Zheng Z, Han J, Pang W, Hu J. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla. Sensors. 2013; 13(1):1064-1075. https://doi.org/10.3390/s130101064
Chicago/Turabian StyleZheng, Zhenzhu, Jing Han, Wensheng Pang, and Juan Hu. 2013. "G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla" Sensors 13, no. 1: 1064-1075. https://doi.org/10.3390/s130101064
APA StyleZheng, Z., Han, J., Pang, W., & Hu, J. (2013). G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla. Sensors, 13(1), 1064-1075. https://doi.org/10.3390/s130101064

