Depth-Dependent Phenotypic Plasticity Differs Between Two Deep-Freshwater Amphipod Scavengers of the Genus Ommatogammarus Despite Similarly Low Genetic Diversity in Ancient Lake Baikal

Abstract

Although deep-water environments make up the world’s largest ecosystem, they are poorly characterized. Lake Baikal, the only freshwater reservoir possessing rich deep-water fauna, offers unique opportunities to examine the evolutionary processes that occurred independently and concurrently with adaptation to these environments in the ocean. Here, we focus on amphipods as one of the dominant elements of Baikal deep-water fauna. This study examines the genetic diversity across broad vertical (~1 km) and horizontal (~500 km) ranges, as well as depth-related traits in two deep-water scavengers, Ommatogammarus flavus (Dybowsky, 1874) and Ommatogammarus albinus (Dybowsky, 1874). Our results revealed low intraspecific diversity of the cytochrome c oxidase subunit I gene marker fragment across locations and depths, indicating the absence of significant barriers in the distribution of either species and a bottleneck event in their evolutionary histories. At the same time, we found depth-related stratification in carotenoid-based body coloration and eye shape in O. flavus, as well as in eye color for both species. These findings suggest partial isolation between vertically stratified populations and help to characterize the ecological differences between the two studied species.

1. Introduction

Deep-water environments may seem almost empty and hostile, but they play many important roles for humanity [1]. The deep sea, which is commonly defined as depths below 200 m (i.e., beyond the continental shelf depth), is the largest ecosystem on Earth. It covers around 65% of the planet’s surface and ~95% of the ocean volume [1,2,3]. Deep-sea habitats are characterized by a number of unique features connected to extreme values of ecological factors. These features include temperatures below 4 °C, which slow down metabolic processes; near total darkness, which severely restricts photosynthesis-based primary production; and high hydrostatic pressure, which also requires unique adaptations [4]. Despite significant advancements in the study of these adaptations, primarily facilitated by modern sequencing techniques, many aspects of deep-water biology remain to be understood [5].

Ancient Lake Baikal provides unique and, sometimes, more convenient opportunities to study the evolution of deep-water adaptation. The majority of deep-freshwater lakes are anoxic below 250 m [6], while Baikal (maximum depth of 1642 m) is characterized by high oxygen content (up to 80% saturation) along the entire water column, which made possible the independent emergence of the deep-water fauna [7,8]. Most deep-sea challenges apply to the inhabitants of the deep-freshwater zone in this enormous lake: low temperatures (stable at 3.5–4.5 °C below 300 m [9]); low-light conditions (even with the exceptional transparency of Baikal water, the photic zone does not exceed 75 m; [10]); and relatively high hydrostatic pressure (up to 165 atmospheres). Consequently, comparative studies of deep-water animals in the ocean and Lake Baikal are of significant interest in terms of understanding the general evolutionary mechanisms of adaptation to deep-water environments.

While some taxa are exclusive to either saltwater or freshwater ecosystems and cannot thus be used for such comparative studies, others have followed remarkably similar evolutionary paths and undergone fast adaptive radiations. A primary example of such a group would be amphipods (Crustacea: Malacostraca: Amphipoda). This crustacean order comprises over 10,000 species [11,12], which are known to form closely related groups of species, or so-called species flocks, in various seas and lakes [13,14,15,16,17]. Amphipods are the predominant animal taxon within the deepest ocean (hadal) fauna [18]. Similarly, amphipods represent a substantial proportion of the deep-water fauna of Lake Baikal, with over 80 out of over 350 known species and subspecies encountered at depths below 500 m and over 55 at depths documented at depths exceeding 1000 m [19,20].

The unusual evolutionary conditions in deep-water environments are the apparent lack of barriers for dispersal on the one hand [21] and the additional dimension for potential vertical stratification on the other. A general tendency has been proposed that the horizontal (geographic, or across locations) diversity is much less pronounced than the vertical (bathymetric, or across depths) [2], and yet during the past two decades limited amounts of data have been accumulated on the genetic diversity of deep-sea amphipods across vertical distances in comparison to horizontal ones. The patterns of diversity have been found to vary for different species, frequently even within the same genus.

Some species indeed seem to lack dispersal barriers. For example, individuals of Abyssorchomene distinctus (Birstein & Vinogradov, 1960) sampled as far as the Pacific and Indian Oceans shared the same set of haplotypes [22]. Similarly, Paralicella tenuipes Chevreux, 1908, sampled from three oceans, was found to comprise only one genetic group [23]. Hirondellea dubia Dahl, 1959, sampled from three oceans at depths of 4000 to 11,000 m, turned out to be indistinguishable by mitochondrial markers [24].

At the same time, many morphological species were found to comprise cryptic species complexes. Perhaps the most well-studied example is a giant bentho-pelagic scavenger Eurythenes gryllus (Lichtenstein, 1822), which is found in every world ocean and in a huge range of depths, from 550 to 7800 m [25]. The species within the E. gryllus complex did not have strict geographic division, but almost all of them were distributed either above or below 3000 m (the abyssal/hadal border), which might still be a sampling artifact [26]. Paralicella caperesca Shulenberger and Barnard, 1976 was also found to be a complex of potential cryptic species with overlapping ranges, the last common ancestor of which existed approximately 8 million years ago [23]. A cosmopolitan species Bathycallisoma schellenbergi (Birstein & M. Vinogradov, 1958) was revealed to comprise a number of genetic lineages correlated with their geography [27]. It is noteworthy that most hadal amphipods have been described as endemic to particular hadal features, and their genetic structure remains to be studied [18].

In this study, our objective was to provide initial insights into the comparative roles of the horizontal and vertical distances in the diversification of deep-water amphipod fauna in Lake Baikal. Previous studies have examined the genetic diversity of over 20 species of Baikal amphipods, but unsurprisingly most of them inhabit shallow depths [15]. Most, but not all, widely distributed shallow-water morphological species comprise divergent genetic lineages, some of which have documented reproductive barriers [28,29,30,31]. Regarding deep-water species, there are only preliminary reports on the single pelagic Baikal amphipod species Macrohectopus branickii (Dybowsky, 1874), for which no geographically separated genetic lineages have been revealed [32,33].

Here, we focused on two most frequently observed deep-water scavengers of the genus Ommatogammarus Stebbing, 1899, namely Ommatogammarus flavus (Dybowsky, 1874) = Abludogammarus flavus sensu Kamaltynov, 2009 and Ommatogammarus albinus (Dybowsky, 1874). They differ from other species of the genus Ommatogammarus sensu Takhteev, 2000, specifically from three subspecies of Ommatogammarus carneolus [34], by high forehead [35] or by antenna I attached almost in the middle of the head in the lateral view, as described by Karaman [36]. These two species have a number of morphological differences (File S1; Figure S1 and Figure 1). The most evident ones that can also be examined in live animals without dissection are (1) the characteristic shape of the eyes, which are irregularly triangular in O. flavus and with a deeply serrated hind margin in O. albinus, and (2) the length of peduncles of antennae I, which are longer than the head segment in O. flavus but shorter or equal in length to the head segment in O. albinus (Figure 1). Together with O. carneolus melanophthalmus sensu Takhteev, 2000 (=Pretiositus melanophthalmus sensu Kamaltynov, 2009), these two species form a well-supported phylogenetic clade with genetic distances that are much smaller than those within the genus Eulimnogammarus based on the fragments of COI, 16S rRNA, and 18S rRNA genes [37,38]. For the purposes of this manuscript, we will use the names O. flavus and O. albinus, as in the NCBI taxonomy [39], txid75829 and txid315607, but not A. flavus and O. albinus, as in the World Amphipoda Database/WORMS [40], AphiaID 746011 and 746012, and BOLD [41], BOLD:AAX0702, and BOLD:AGK6709.

O. flavus and O. albinus are endemic to the lake and widely distributed both horizontally and vertically. They have been observed in all three basins of the lake at the depth ranges of 2.5–1300 m for O. flavus and 50–1642 m for O. albinus [19,20,34]. They are frequently found together in baited traps. Although the depth ranges largely overlap, these species tend to prefer different depths. O. flavus was most abundant at 100–300 m, while O. albinus was most frequent in the traps at 300–500 m [43]. Thus, relatively shallow-water borders between the basins of Lake Baikal may be more important for geographic separation of O. albinus than O. flavus. Taking into account the wide depth ranges of both species, changes in hydrostatic pressure and solar irradiation may potentially lead to vertical stratification. However, since laboratory experiments showed that ultraviolet caused much more pronounced mortality than pressure decrease [43,44], here we hypothesize that the stratification may be related to adaptations to different illumination conditions.

In this study, we explored the genetic diversity of O. flavus and O. albinus across the three basins of Lake Baikal, as well as their adaptations along the depth gradient at one sampling location, even though it was to a smaller scale than in the deep ocean. We sampled a range of geographic locations to study horizontal diversity (>500 km distance between the furthest points) and a range of depths at a small distance (1 km depth range at 2 km horizontal distance) to study vertical diversity. During the latter sampling, we observed phenotypic differences in body and eye color between individuals of O. flavus from different depths and explored this phenomenon in greater detail, focusing on carotenoid concentration and opsin expression.

2. Materials and Methods

2.1. Sampling, Study Sites, and Fixation

O. flavus and O. albinus were collected at 9 locations spanning the southern, central, and northern basins of Lake Baikal at depths ranging from 25 m to 1000 m in 2020 and 2022–2025 (Figure 2 and Table S1). Amphipods were captured from the lake ice in spring or from a boat in summer using bottom deep-water traps with rotten fish (for more details see [43]). Neither studied species is endangered or protected. All procedures were approved by the Animal Subjects Research Committee of the Institute of Biology at Irkutsk State University (protocol #9/2022).

Amphipods were determined morphologically according to standard keys [34,35,45]. Individuals from Bolshie Koty were preserved in liquid nitrogen immediately after capture, while those from other locations were preserved in ethanol. From each location we sequenced from 2 to 27 animals of each species (Table S1). In total, COI sequences of 66 individuals of O. flavus and 57 of O. albinus were obtained.

The station in Bolshie Koty was used as the major point for studying vertical diversity. It is located in the southwestern part of the lake, which is characterized by steep declining slopes (Ref. [46]; http://bic.iwlearn.org/en/atlas/atlas/127-angles-of-inclination-of-map; accessed on 15 March 2025). This relief feature provided us with a rare opportunity to sample at different depths (25 to 1000 m) at relatively short horizontal distances (around 2 km distance from the shore to 1000 m point). Each animal from Bolshie Koty, which was frozen in liquid nitrogen, was unfrozen and quickly photographed on gray background using millimeter paper and an Olympus Tough TG-5 camera (Olympus, Beijing, China). To assess eye morphology, photographs were taken under a SPM0880 stereomicroscope (Altami, St. Petersburg, Russia). Subsequently, the head with eyes was dissected using scissors and scalpel, then immediately placed in TriReagent (MRC, Cincinnati, OH, Germany) for RNA isolation. Pereiopods were separated for genotyping. The rest of the body was used for carotenoid measurements. Animal body length and eye area were estimated using the ImageJ program (https://imagej.net/ij/, accessed on 15 August 2025) [47], with body length measured from rostrum to telson. Quantitative analysis of pereon color was performed by adjusting the white balance using gray background and identifying the RGB color of the random spot on the sixth or nearest visible segment of the pereon. The ratio of the intensity values in the red and green channels (R/B color index) was utilized as the color index. The method was described in more detail earlier [48].

2.2. Nucleic Acid Extraction, PCR, and Sequencing

DNA was isolated from appendages with a commercial kit “S-sorb” (Syntol, Moscow, Russia) with modifications previously outlined in [49]. Total RNA was extracted from the heads with eyes of O. flavus or O. albinus individuals by homogenizing frozen tissues in TriReagent according to the manufacturer’s protocol using two 3 mm stainless steel beads (Qiagen, Hilden, Germany) in a TissueLyser LT instrument (Qiagen, Hilden, Germany). The methodology for the isolation of total RNA is described in detail in [50]. The homogenate was centrifuged to precipitate steel beads and tissue debris, transferred to a new tube, and mixed with chloroform according to the manufacturer’s protocol, followed by centrifugation and phase separation. The upper phase was carefully removed without contacting the interphase, and then the protocol of the RNeasy mini kit (Qiagen, Hilden, Germany) was followed. RNA integrity was assessed by agarose gel electrophoresis, and the concentration was measured using a Nano-300 spectrophotometer (ALLSHENG, Hangzhou, China). The resulting RNA was purified from residual genomic DNA using a RapidOut DNA removal kit (Thermo Scientific, Vilnius, Lithuania) following the manufacturer’s instructions. To make sure that the sequences that were obtained in different ways (with cDNA or genomic DNA) match, we additionally isolated DNA from the appendages of several animals of both species (from Bolshie Koty). The sequences matched.

The Folmer COI fragment was used as the marker sequence, as this approach has been successfully applied to the study of genetic diversity in other Baikal amphipods and in other deep-water amphipods [15]. The amplification of the cytochrome c oxidase subunit I (COI) gene fragment for O. flavus DNA samples was performed with primers 398_Eve_F4 (TAAACTATAAGCCTTCCAAGC) and 399_Eve_R4 (TGTGAAGTAAGCTCGGGTAT) [31,38]. In the case of O. flavus cDNA (only samples from Bolshie Koty), the primers COI_Ofla_MD_F7 (GTGACTATTTTCTACTAACCA) and COI_Ofla_MD_R7 (AGCCTAGAAAACCAATAGCCAGT) (this study) were used. The primers were designed in the SnapGene Viewer (available at snapgene.com; accessed on 23 December 2023), using mitochondrial sequences of the corresponding species from transcriptome assemblies. COI sequences were retrieved from the transcriptomes [51] reassembled earlier [52]. The transcripts used were TRINITY_DN16_c2_g1_i2 for O. flavus and TRINITY_DN2055_c0_g1_i3 for O. albinus. These sequences were found in the assemblies with exonerate version 2.4.0 [53] using partial sequences published earlier [38] as queries. The sequences with matching primers are available in the Supplementary Materials (Files S2 and S3).

Amplification of the COI fragment from DNA and cDNA of O. albinus (only samples from Bolshie Koty) was performed with primers 0303_LCO_Eve_F1 (TCTCTACTAATCATAAAGATATCGG) and 399_Eve_R4 (TGTGAAGTAAGCTCGGGTAT) [31,38]. The size of the COI product for both species was about 950 bp. In some cases when the concentration of the obtained PCR product was not sufficient for sequencing, re-amplification with different primers was used. For the list of primers and comprehensive information on the primers used for each sample, refer to Table S2 and Table S3, respectively.

According to our previous study based on transcriptome analysis, both species are characterized by a single expressed opsin gene of the long wavelength-sensitive class [52]. Thus, a region of this long wavelength-sensitive (LWS) opsin gene was also sequenced. PCR was performed with primers LWS_4F (GCGGAACTGGAACTGACTACCTCA) and LWS_7R (CACGATGGGGGGTTGTAGAC), which amplify the part of the open reading frame corresponding to amino acids 204–332 in both species [52]. The product length for both species was slightly more than 350 bp.

Amplification of COI and LWS fragments was performed with 2.5x qPCR mix (Syntol, Russia) in the volume of 30–40 μL. The cycling conditions for COI fragments of both species and all primer pairs were as follows: initial denaturation at 95 °C for 5 min; 30 cycles of (denaturation at 95 °C for 30 s; primer annealing at 56 °C for 1 min; and extension at 72 °C for 1 min); and final extension at 72 °C for 5 min. The conditions for LWS amplification were described in detail earlier [52]. PCR products were visualized in a 1% agarose gel in TAE buffer. PCR products were purified with Cleanup Standard or Cleanup mini kits (Evrogen, Moscow, Russia). The quality and concentration of purified PCR products were assessed using a Nano-300 spectrophotometer (ALLSHENG, China). PCR products were sequenced according to the Sanger method with a Nanophor 05 sequencer (Institute for Analytical Instrumentation RAS, St. Petersburg, Russia) in both directions (for combination of primers used for each sample, see Table S3). The BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies, Waltham, MA, USA) was used for the amplification reaction; refer to [49] for further information. For the reverse sequencing reaction, primer COI_HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) [54] was used for some samples.

Quantitative PCR (qPCR) was performed with samples collected in Bolshie Koty. Complementary DNA (cDNA) synthesis was performed using the RevertAid FirstStrand cDNA synthesis kit (Thermo Scientific, Lithuania) with random primers according to the manufacturer’s recommendations. Up to 5% of the cDNA volume was used for qPCR. Amplification was performed using a StepOnePlus (Applied Biosystems, Waltham, MA, USA) using 5X qPCRmix-HS SYBR (Evrogen, Moscow, Russia). The same amount of RNA sample, which was treated similarly but without the addition of reverse transcriptase (-RT), was used to test for genomic DNA contamination. Expression levels of the lws genes were estimated using the housekeeping glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene as a reference. The following primer sequences were used for the qPCR. Primers LWS_4F (GCGGAACTGACTGACTACCTCA) and LWS_4R (GACTCCCATCTTCTTTCTTGGC) flank a 200 bp region of the gene [52]. Expression of the reference gene gapdh was quantified with the primers F-ACTCTACTCACGGCGTCTTCAAG and R-CGCTGGACTCTACGATGTACTCAG (KF293381) [55]. Experimental samples (cDNA) with quantification cycle values over 30 cycles or -RT samples with less than 30 cycles for gapdh were considered below detection or contaminated, respectively, and were therefore discarded from further analysis. Only one sample failed to isolate a high-quality RNA (O. flavus from 25 m #5).

2.3. Extraction and Estimation of Carotenoid Concentration

The total carotenoid content was measured according to the method described in detail earlier [48]. Carotenoid concentration was estimated spectrophotometrically at the wavelengths from 200 to 800 nm using a Cary 50 UV/VIS spectrophotometer (Varian Inc., Belrose, Australia). The purity of the extract was monitored by absorbance at 600 nm, and the concentration of carotenoids was determined in parts per million (ppm) by absorbance at 450 nm (A450) as 4 × A450 × V/M, where V is the volume of petroleum ether used for re-extraction (mL) and M is the crude weight of the sample (g).

2.4. Data Analysis

The raw Sanger sequencing data were processed and basecalled using Mutation Surveyor V 5.1 [56]. Consensus sequences were obtained in the UGENE V 41.0 program [57] by aligning to the reference sequence of the corresponding species retrieved from transcriptome assemblies (see above). Reference LWS opsin sequences were also retrieved from transcriptomes and published earlier [51]. All sequences obtained in this study were deposited in the NCBI GenBank database (https://www.ncbi.nlm.nih.gov/nucleotide/; accessed on 15 August 2025) with the following accession numbers: PV474290–PV474412 for COI and PV491384-PV491410 for LWS opsins, and in the Barcode of Life Datasystems (BOLD) [41] database as the OMM project. The sequences were aligned and trimmed to the shortest sequence in the UGENE program [57] using the MUSCLE algorithm [58]. The haplotype network was constructed in R [59] (R Core Team, 2024) with the pegas package (Population and Evolutionary Genetics Analysis System) [60], using the maximum parsimony method. The presence of a gap between intraspecific and interspecific variability (barcoding gap) was estimated using the ABGD (Automatic Barcode Gap Discovery) and ASAP (Assemble Species by Automatic Partitioning) algorithms in the SpartExplorer web interface (https://spartexplorer.mnhn.fr/; accessed on 15 May 2025); [61,62,63].

To construct the bathymetric map of Lake Baikal we used the GEBCO project data [64], as well as the marmap v1.0.10 [65] and rnaturalearth v1.0.1 [66] packages for R. The qPCR data were presented as relative quantitative cycles (ΔCt), which were obtained by subtracting the quantitative cycle value for the reference gene from the corresponding value of the target gene. Four to seven biological repeats were measured at each point (depth of capture). Each biological repeat was measured in three technical repeats. The values obtained for the lws gene expression and carotenoid from each depth were compared using the Wilcoxon–Mann–Whitney test [67], with Holm’s correction for multiple comparisons [68] implemented in the R environment. All data were analyzed and visualized with the R software network v4.1.2 using suitable packages: ape v5.8.1 [69]; ggplot2 v3.4.2 [70]; pegas v1.3 [60] for haplotype network build; openxlsx v4.2.5 [71]; dplyr v1.1.4 [72]; ggrepel v0.9.6 [73]. The graphs were finalized with Inkscape software V0.92.3 (https://inkscape.org/; accessed on 15 May 2025). All scripts are available on GitHub (https://github.com/Telnes/Population-structure-of-Ommatogammarus-flavus-and-O.-albinus; accessed on 15 August 2025).

3. Results

3.1. Intraspecific Genetic Diversity Is Low and Similar Across Locations and Depths

We started by exploring the genetic diversity of O. flavus and O. albinus from 25 to 1000 m in Bolshie Koty, where the steep slopes of the lake allowed for such analysis. Both studied species were characterized by low COI diversity with two (O. flavus) or one (O. albinus) prevailing haplotypes and several singleton haplotypes differing from the major ones by one substitution (Figure 3). The low diversity means that individuals of the same morphological species at different depths did not form isolated populations, at least for evolutionarily meaningful times. Even more importantly, this homogeneity allowed us to compare the horizontal diversity across the lake because it was not feasible to sample the same depth everywhere.

Then, we analyzed horizontal diversity of O. flavus and O. albinus from nine points in all three basins of the lake (Figure 2). Despite the identification of a few unique haplotypes, the overall COI genetic diversity was still low (2 major and 16 singleton haplotypes for O. flavus and 1 major and 5 singleton haplotypes for O. albinus) and did not correlate with sampling geography (Figure 4 and File S4). The delimitation of the two species was confirmed with both ABGD and ASAP methods as the most optimal number of subsets.

3.2. Analysis of Coloration and Eye Shape Reveals Depth-Related Phenotypes

Notwithstanding the genetic homogeneity within each species, we found that O. flavus from different depths varied in their appearance, most importantly and most clearly in coloration. While the animals sampled in Bolshie Koty from 250 m and above exhibited the characteristic orange coloration and black eyes, the ones sampled from 650 m and below were pale and had red eyes, resembling the description of O. albinus (Figure 5a–d; see also Figures S2–S4). The same tendency was observed in Baikalsk with a smaller sample. However, the main distinguishing morphological character, the shape of the eye, was consistent with molecular species identification. The intensity of orange coloration in amphipods and other crustaceans is mainly determined by the concentration of carotenoids [74,75]. So, in order to quantitatively access the visible differences in color, we measured carotenoid contents in at least four adult animals from each sampling depth. Even though we could not detect statistically significant differences in pairwise comparisons corrected for multiple comparisons, the values obtained from O. flavus samples definitely fell into two groups, up to 250 m vs. 600 m and below (Figure 5e). Moreover, linear regression analysis confirmed the correlation between sampling depth and carotenoid content for O. flavus (Figure 5f). The specimens of O. albinus from different depths differed in neither their visible body color nor their measured carotenoid content.

In order to verify the trend to a paler body coloration at greater depths in adult O. flavus, we quantified the color in a larger sample and confirmed this tendency (Figure 6a). Importantly, the trend of paler O. flavus coloration with greater depths was not absolute, as smaller animals at 1000 m appeared orange. This observation, in conjunction with the unusual appearance of O. flavus from this lowest depth, prompted us to examine the color of individuals of different sizes specifically from this depth. We confirmed that some small-bodied O. flavus from 1000 m, in contrast to larger animals from the same depth, tended to have a much brighter orange coloration (Figure 6b).

Moreover, the shape and coloration of eyes also differed within the adult representatives of O. flavus across sampling depths by becoming more ragged and paler with greater depths (Figure 7 and Figure S4). Reddish eye color in O. flavus from greater depths had been documented earlier [76] but never explored in detail. Color change was also noted for O. albinus eyes, but the difference in shape was not so apparent.

In order to check whether the observed difference in eye coloration and shape may be attributed to an adaptation to extremely low-light conditions, we compared the sequences of opsins (visual proteins) in animals from different depths. The same animals that were used for the eye photographs (Figure 7) and carotenoid extraction (Figure 5) were used. The sequences of the opsin fragment were identical within species and had four substitutions between the species; three of them led to amino acid changes (Figure 8a and File S5). The relative expression levels were also not different between depths or species (Figure 8b). However, it is noteworthy that as the expression was normalized to the expression of a housekeeping gene, it should be proportionally higher in animals with larger eyes.

4. Discussion

In this study, we explored the genetic diversity and illumination-related traits of two deep-water scavenger amphipod species from Lake Baikal, namely O. flavus and O. albinus. The first important result is that we fully confirm the delimitation between these two species with molecular methods in a large sample. Previous works have also shown molecular distance between individuals of these species [37,38,51], but none of them analyzed more than four samples per species or specimens from different locations, which could have largely affected the results. Thus, there is still a question of how two closely related and sympatric species had diverged. A plausible hypothesis could be that these species originally formed and occupied deep-water niches in two different basins of the lake. Then, when the lake progressively deepened, the species came into secondary contact. According to paleogeographic scenarios, depths of hundreds of meters already existed in the future northern and southern Baikal basins at the early substage of the proto-Baikal stage 30–10 million years ago, while the central part of the lake was much shallower [77]. However, before approximately 6 million years ago the deep-water zone was probably anoxic and uninhabitable for multicellular life due to a warmer climate [78,79]. Alternatively, adaptation-driven speciation with O. flavus more resistant to solar radiation and O. albinus better suited to darkness [44] remains a possibility. A further analysis of diversity in Ommatogammarus with more variable markers could be used to trace the origin of each species and test these hypotheses.

While the between-species genetic distance is evident, we found that the genetic diversity of the COI fragment was homogeneous and quite low across a 500 km horizontal distance and almost 1000 m vertical distance. This low intraspecific diversity of both species attracts considerable attention. The usage of the COI fragment might be regarded as a potential drawback of this study, as it lacks sufficient variability to capture the variation occurring within a smaller evolutionary scale. However, we need to emphasize that littoral Eulimnogammarus species, which are closely related to Ommatogammarus sp. [50], had formed divergent COI lineages [31]. Thus, we believe that there is no particular reason for Ommatogammarus species to not accumulate COI differences. The low intraspecific diversity suggests that each of these species has recently come through a bottleneck. The plausibility of this hypothesis may depend on the age of the habitable (cold and thus oxygenated) deep-water zone in Lake Baikal. High depths in Baikal existed for a long time (at least 10 million years [77]), but the lake has undergone several episodes of significant warming [79], which could be the reason for the shrinking of the habitable spaces and thus for a catastrophic population decrease. The specialization of O. flavus and O. albinus for scavenging [80] could also make them susceptible to variations in the ecosystem productivity and cause periodic depopulations for both species. Similar low intraspecific variability and evidence of a bottleneck event have been described for other Baikal species, particularly amphipods Gmelinoides fasciatus (Stebbing, 1899) and a gastropod mollusk Maackia herderiana (Lindholm, 1909) [81]. Some other Baikal animal groups, such as Lumbriculidae (Oligochaeta), underwent explosive speciation around 4–3 million years ago, probably also invading the deeper parts of the lake during this period [82].

The absence of geographically partially or completely isolated genetic lineages suggests that each species is highly connected throughout the lake. However, it does not mean that the individuals within each species have the same probability of mating with each other, i.e., that the whole lake is the habitat of one panmictic population. Even though these animals are highly mobile and can presumably cover large distances while swimming to access food sources based on the chemical cues, it appears implausible that they could cover 100 km distances during a lifetime of several years. This is especially the case for underwater elevations making depths shallower than those preferred by O. albinus. A notable example is the Academician Ridge separating the northern and central basins of the lake, the central part of which is mostly above 350 m in depth [83]. Still, we found no evidence that the elevations can disrupt the interbreeding of O. albinus in evolutionarily meaningful times.

Yet, the most intriguing finding of this study is the vertical variability of O. flavus. Despite the genetic homogeneity of this species, its individuals demonstrated less pigmented eyes with a more ragged edge and a carotenoid-related shift in body coloration with greater depths. Such a phenomenon was not observed in O. albinus except for a slight change in eye pigmentation (Figure 5 and Figure 7). Importantly, both species exhibit comparable and stable opsin expression along the depth gradient (Figure 8), which indicates the leading role of pigments in the adaptation of eyes to different illumination levels. These findings make us question how inclined the scavengers are to migrate to different depths and also highlight the potential adaptation-driven speciation of O. flavus and O. albinus as a plausible hypothesis.

It is hard to imagine how an eye shape could change in an adult animal. At the same time, it is conceivable to suggest that coloration may change throughout life, but this process is slow. Carotenoids are not synthesized by the vast majority of animal species and are thus obtained from food [75]. In our previous work with a shallow-water Baikal amphipod species Eulimnogammarus cyaneus (Dybowsky, 1874), we noticed differences in coloration upon a two-month experimental feeding with diets differing in carotenoid abundance and did not detect any significant changes in the carotenoid content [84]. Thus, it would be logical to suggest that the change that was seen in O. flavus would take at least months. For deep-ocean amphipods Eurythenes gryllus and Anonyx sp. Krøyer, 1838, body color intensity and carotenoid levels have been shown to positively correlate with body length, i.e., animal age [85]. However, in the case of Ommatogammarus, we did not find any clear evidence of ontogenetic depth stratification. In this study, we mostly focused on adult individuals due to the complexity of species identification for small body-sized animals, but closer examination of the samples from 1000 m revealed a number of smaller individuals with a more typical O. flavus appearance (Figure 6).

Further research exploring more variable genetic markers or tracking the distance, which an Ommatogammarus individual can travel, could shed more light on the stratification within these species. However, it is already safe to say that O. flavus is a convenient and promising model species to study the molecular mechanisms behind the phenotypic plasticity of deep-water amphipods in the context of illumination-related traits.

5. Conclusions

In this study, we demonstrate that two species of endemic Baikal deep-water scavenger amphipods, O. flavus and O. albinus, have low intraspecific diversity of the marker fragment of the standard mitochondrial marker, cytochrome c oxidase subunit I gene, at both vertical (bathymetric) and horizontal (geographical) scales. This finding suggests the absence of significant barriers to their distribution in the lake and the presence of a bottleneck event in their history. At the same time, we did find some visible differences (variation in coloration, eye shape and color, and carotenoid contents) between O. flavus from different depths, indicating that the adult animals might not extensively migrate between depths within the lifespan of an individual. The differences in phenotypic plasticity point at a probable evolutionary reduction in molecular mechanisms of pigment accumulation in O. albinus and potentially characterize the distinction in ecological niches between these two closely related species.