Next Article in Journal
Heterobranch Sea Slugs s.l. (Mollusca, Gastropoda) from the Southern Ocean: Biodiversity and Taxonomy
Previous Article in Journal
Annual Dynamics of Phytoplankton Communities in Relation to Environmental Factors in Saline–Alkaline Lakes of Northwest China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 17
Issue 5
10.3390/d17050329
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Variation and Differentiation of Himantoglossum s.s. in Greece

by
Spyros Tsiftsis
1,
Martha Charitonidou
2,
Panagiotis Madesis
3,4,* and
Andreas D. Drouzas
5,*
1
Department of Forest and Natural Environment Sciences, Democritus University of Thrace, GR-66132 Drama, Greece
2
Laboratory of Ecology, Department of Biological Applications and Technology, University of Ioannina, GR-45110 Ioannina, Greece
3
Institute of Applied Biosciences, Centre for Research and Technology-Hellas, GR-57001 Thessaloniki, Greece
4
Laboratory of Molecular Biology of Plants, School of Agricultural Sciences, University of Thessaly, GR-38446 Nea Ionia, Greece
5
Laboratory of Systematic Botany and Phytogeography, School of Biology, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece
*
Authors to whom correspondence should be addressed.
Diversity 2025, 17(5), 329; https://doi.org/10.3390/d17050329
Submission received: 15 March 2025 / Revised: 23 April 2025 / Accepted: 25 April 2025 / Published: 3 May 2025
(This article belongs to the Section Plant Diversity)
Browse Figures
Versions Notes

Abstract

:
The taxonomic identification of plant species is traditionally based on morphological traits, the use of which may create difficulties in cases of close-related species showing great morphological variability. In such cases, the use of DNA markers for species identification and delimitation can be of great help. Himantoglossum W.D.J.Koch (Orchidaceae) is a genus with notable morphological variability, comprising the clade hircinum-caprinum (Himantoglossum s.s.) with nine taxa, from which H. jankae, H. hircinum, H. montis-tauri, H. caprinum and H. samariense have being reported in Greece. However, a previous morphological study of Himantoglossum s.s. from all over Greece could not verify the presence of these reported species, but of only one highly diverse taxon throughout the country. Here, we studied the genetic variation and differentiation of Himantoglossum s.s. populations from the entire distribution of the genus in Greece employing ISSR markers, to further elucidate the taxonomic status of Himantoglossum s.s. in Greece. High genetic variation was revealed, both in the populations of the “core” distribution and in the peripheral/marginal ones, pointing to their evolutionary potential. This variation is mainly attributed to differences within the populations and, to a lesser extent, among them. No differentiation of the populations proposed to belong to a different taxon was found and no species-specific markers were identified that may discriminate the above populations from the rest. In addition, two cpDNA and one nDNA fragments (accD, psbA-trnH and ITS2, respectively) were sequenced in a number of individuals representative of the whole dataset. All three fragments were conserved, showing restricted polymorphism and having no correlation to the populations or to the taxa of Himantoglossum s.s. in Greece. Overall, the high genetic variation of the populations of Himantoglossum s.s. in Greece, especially of the peripheral/marginal ones, is a valuable asset towards their conservation.

1. Introduction

Plant species description and delimitation are majorly based on their morphometric features, combined, when needed, with ecological, phenological, cytological and molecular traits (e.g., [1]). Particularly in European orchids (Orchidaceae Juss.), at least at the species level, the morphology of the flower, primarily the size and the shape of the flower lip (labellum), and secondarily of other flower parts, is of great importance in their classification [2,3]. Although there are orchid genera and species that are easily identified (e.g., Cypripedium, Goodyera, Corallorhiza), in morphologically complex genera, such as Dactylorhiza, Ophrys and Epipactis in Europe, the analysis of extensive morphological data using sophisticated techniques has been widely used in their systematic classification [4,5,6,7,8]. In addition, over the last 30 years, with various molecular techniques and markers widely applied, the orchid family became one of the best-studied families among the Angiosperms regarding their phylogeny [9,10,11]. In some cases, such analyses resulted in the rearrangement of certain taxa to different genera from those in which they initially belonged to (e.g., [12]), whilst DNA analyses have been widely used to discriminate taxonomically complex groups of taxa or even to identify and describe cryptic species [13,14,15,16,17].
Many of the orchid genera found in Europe have been controversial in terms of their taxonomy, especially due to their morphological variability (e.g., Ophrys). Among them, the genus Himantoglossum W.D.J.Koch is characterized by a great inter- and intraspecific morphological variability [18,19,20]. This particular genus has been recently enlarged by including in it species formerly classified in two easily identified genera, Comperia and Barlia [20,21]. The remaining taxa, which constitute the subgenus Himantoglossum, especially those occurring in the southern Balkans and the eastern Mediterranean, raise taxonomic issues which frequently lead to systematic confusion.
Himantoglossum s.s. consists of the hircinum-caprinum clade sensu Bateman et al. [20] and comprises of nine species: H. jankae, H. samariense, H. formosum, H. hircinum, H. adriaticum, H. galilaeum, H. caprinum, H. montis-tauri and H. calcaratum [21]. According to Bateman et al. (2003) [22], the members of Himantoglossum s.s. have 36 chromosomes, whereas according to Sramkó et al. (2014) [21], these chromosome numbers are only confirmed for H. hircinum and H. adriaticum, whereas no chromosome numbers are available for all other taxa of Himantoglossum s.s. The classification of the Himantoglossum s.s. taxa reported in Greece has been based on specific floral attributes, more specifically the lip size, the size of the lobes of its lip (lateral and secondary), as well as on the presence or absence of spots on their surface [2,23,24,25]. According to the aforementioned literature, the following taxa are found in Greece: H. jankae (mostly referred to as H. caprinum; subspecies of H. calcaratum according to [20]) is the most widespread species reported by several authors, H. hircinum (in NW Greece: [24,26]), H. montis-tauri (in Lesvos island: [2,25,27,28,29]) and H. caprinum (referred to as H. affine; in Peloponnese, Crete and Lesvos island: [2,25,30,31,32]). For several years, H. jankae and H. caprinum were considered as two well-delimitated taxa. A heterogeneous population found by Rückbrodt & Rückbrodt [33] in Crete, whose individuals were characterized by floral traits having dimensions between those attributed to H. jankae and H. caprinum. Based on this differentiation, these individuals were later described as a stabilized separate taxon (H. samariense: [31]), possibly of hybrid origin between H. jankae and H. caprinum, which were both considered existing in Crete. The hybrid origin was also supported by the findings of Sramkó et al. [21] and Bateman et al. [20].
The dimensions of the floral traits presented in the orchid taxonomic literature (e.g., [2,25]) are based on sparse morphological data usually originating from few individuals and not on a systematic field survey focusing on the morphological variability of the eastern Mediterranean Himantoglossum s.s. taxa. In 2016, Tsiftsis [19] analyzed a dataset of Himantoglossum s.s. individuals covering the genus’ distribution in mainland Greece and the islands of Lesvos and Evia, concluding that only a single species exists in Greece, which shows high morphological variability (photographs showing this variability are available in Tsiftsis & Antonopoulos [34]). According to the same study, specific floral traits exhibit a latitudinal (south-to-north) differentiation, potentially driven by adaptation in the local climatic conditions, whereas the presence of H. caprinum cannot be verified anywhere in Greece. Comparing the data provided by Rückbrodt & Rückbrodt [33] and Alibertis & Alibertis [31] with the results and data presented by Tsiftsis [19], it can be claimed that H. samariense cannot be morphologically differentiated from the highly variable H. jankae which occurs throughout Greece. However, this conclusion is based exclusively on morphometrics, underlining the need for further investigation by employing DNA markers.
Thus, the scope of the present study was to explore the genetic variation and differentiation of Himantoglossum s.s. in Greece, and if the populations from Crete, Lesvos, and Peloponnese are genetically differentiated from the H. jankae populations occurring in other parts of the country. More specifically the aims were:
(a)
to study the genetic variation of Himantoglossum s.s. in Greece,
(b)
to explore the genetic differentiation of Himantoglossum s.s. in Greece, and in particular, whether H. jankae, the so-called H. samariense, and the populations of the Peloponnese and of Lesvos island are genetically differentiated, and
(c)
to search for DNA polymorphisms capable of discriminating the above taxa and/or the populations.

2. Materials and Methods

2.1. Plant Material

Plant material was collected from twenty-three (23) populations of Himantoglossum jankae and two (2) of H. samariense (Cretan populations), covering the distribution of Himantoglossum s.s. in Greece (Table 1; Figure 1). The plant material analyzed in this study comes from the material used by Tsiftsis [19] to study the morphological variability of Himantoglossum s.s. in Greece and the same population coding was used. As presented in Table 1 and Figure 1, the main distribution of H. jankae is found in three floristic regions of Greece (North-Eastern—NE, North-Central—NC and Northern Pindos—NPi), while the distribution in other floristic regions (Sterea Ellas—StE, West Aegean—Wae, East Aegean -EAe and Peloponnese—Pe) is restricted. As mentioned above, the distribution of H. samariense is confined to the floristic region of Kriti (Crete) and Karpathos (KK). In addition, samples from three individuals of H. galilaeum (also belonging to Himantoglossum s.s.) were included in this study because individuals of this taxon have unspotted (although not brighter in the center) and rather short-sized lip, and morphologically resemble some individuals mostly occurring in the central and southern part of Greece [35]. The collected material was mainly leaves; however, on occasions where the leaves had already withered, bracts and/or flowers were collected. In all cases, plant material collection did not affect the survival of the individuals and was performed according to the Greek legislation (permit number: 144703/2145). Two (2) to eleven (11) individuals were sampled from each population (depending on the population size).

2.2. DNA Extraction

Plant material was initially ground using a pestle and mortar in the presence of liquid nitrogen. Total DNA extraction followed the protocol of Doyle and Doyle [36] with minor modifications. The quality and quantity of the DNA extracted from each individual were checked/measured both spectrophotometrically, using a NanoDrop ND-2000 (Thermo-Fischer Scientific, Waltham, MA, USA) apparatus, and on agarose gel electrophoresis.

2.3. ISSR Markers

Τhe genetic variation and differentiation of Himantoglossum was studied using ISSR markers, due to their ability to reveal high variability and differences in intraspecific levels. Ten (10) ISSR primers obtained from UBC set #9 were selected and initially tested on a randomly selected group of Himantoglossum individuals from all studied populations. The primers were chosen according to the literature, based primarily on their applicability in species belonging to genera closely related to Himantoglossum, or to genera in the same subtribe, as well as on their applicability in other Orchidaceae species (e.g., [37,38,39]). From the tested primers, five (5) that showed repeatability and high numbers of polymorphic fragments were selected (UBC-810, UBC-811, UBC-815, UBC-834, UBC-847; Table 2) and applied to all the populations and individuals. For all five ISSR markers, PCR reactions had a total volume of 20 μL, containing 20 ng of template DNA, 1× PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTPs, 0.8 μΜ of ISSR primer, and 1 U Taq polymerase (Invitrogen, Life Technologies, ThermoFischer Scientific, Waltham, MA, USA). All the PCR reactions were carried out on a Veriti® Thermal Cycler (Applied BioSystems, ThermoFischer Scientific, Waltham, MA, USA). The amplification conditions were as follows:
(a)
for UBC-810, UBC-811 and UBC-834: initial denaturation at 94 °C for 4 min, followed by 45 cycles comprising 30 s at 94 °C, 15 s at 45 °C and 2 min at 72 °C, and a final extension step at 72 °C for 7 min.
(b)
for UBC-815 and UBC-847: initial denaturation at 94 °C for 4 min, followed by 40 cycles comprising 30 s at 94 °C, 30 s at 45 °C and 2 min at 72 °C, and a final extension step at 72 °C for 7 min.
All PCR products were visualized on 1.5% agarose gels (SeaKem LE, Lonza, Rockland, ME, USA) in 1× TAE buffer, with the addition of ethidium bromide.

2.4. Sequencing of cpDNA and nDNA Regions

In order to further investigate for differentiation within Himantoglossum s.s., two regions from the chloroplast DNA (cpDNA), and one from the nuclear DNA (nDNA) were sequenced in a number of individuals representative of the two taxa, which were chosen based on the results from the ISSR markers and, in the case of H. jankae covering its distribution throughout Greece. The coding region accD and the non-coding psbA-trnH intergenic spacer were selected from cpDNA, whereas the ITS2 region was chosen from the nDNA. The accD coding region includes positively-selected sites that are considered important for the adaptive evolution of orchids and for obtaining relevant phylogenetic information (e.g., [40,41,42,43]). The psbA-trnH intergenic region shows great variability in angiosperms (e.g., [44]), it has been proposed for DNA barcoding in plants (e.g., [45]) and it has been used in plant identification and phylogenetic studies (e.g., [46,47]), including orchid species and specifically Himantoglossum (e.g., [21,48,49,50]). The ITS region has been also proposed as for DNA barcoding in plants (e.g., [51]) and it has been widely used in plant identification and phylogenetic studies in many species (e.g., [52,53,54]), including various orchid species and Himantoglossum (e.g., [21,22,49,50,55,56,57,58]). All primers used were according to the Consortium for the Barcode of Life (CBOL) (Table 3). All PCR amplifications followed the protocol of Madesis et al. [59] with modifications. In particular, for all markers, PCR reactions had a total volume of 20 μL, containing 20 ng template DNA, 1Χ PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.25 μΜ of each primer (forward and reverse), and 1 U Taq polymerase (Invitrogen, Life Technologies, ThermoFischer Scientific, USA). All PCR reactions were performed on a Veriti® Thermal Cycler (Applied BioSystems, ThermoFischer Scientific, USA). The best annealing temperature for each region was selected by using Oligo Calculator v. 3.27 (https://www.biosyn.com/gizmo/tools/oligo/oligonucleotide%20properties%20calculator.htm, accessed on 27 August 2015). The amplification conditions were as follows: 94 °C for 4 min for initial denaturation, followed by 30 cycles of denaturation at 94 °C for 30 s, 50 °C (accD) or 52 °C (ITS2) or 53 °C (psbA-trnH) for 30 s for primer annealing, and 72 °C for 45 s min for extension, and one final extension step of 72 °C for 7 min. All PCR products were checked on 1% agarose gels (SeaKem LE, Lonza, Rockland, ME, USA) in 1× TAE buffer, with the addition of ethidium bromide. Sanger sequencing was performed by GENEWIZ (formerly Beckman Coulter Genomics, London, UK). All sequencing results were visualized and edited using the BioEdit v.7.25 [60] software and aligned with the ClustalW 2.0 algorithm [61]. The sequences of the three DNA fragments have been deposited in the GenBank (Accession numbers: ITS2: PV362373-PV362393; accD: PV416406-PV416427; psbA-trnH: PV416428-PV416450).

2.5. Data Analyses

Only concrete and repeatable bands were scored (coded as “1” for present and “0” for absent), for all ISSR markers. To specify the fragments’ length in base pairs (bp), a 2-Log DNA ladder (Quick-Load, New England, Biolabs) was used in each electrophoresis, and ImageJ v.1.49.r [66] and DNAFRAG v.303 [67] software were employed. Given the dominant nature of ISSR markers, that causes some limitations in the genetic variation parameters to be used [68], for each population and species, as well as within each floristic region of Greece, the following genetic variation parameters were estimated: effective number of alleles (Ne), expected heterozygosity (He) (equivalent to Nei’s [69] gene diversity), Shannon’s information index (Ι), number of private bands (PB), percentage of polymorphic loci (P). In addition, within each species, the total expected heterozygosity (Ht), within population heterozygosity (Hs), among populations genetic differentiation (Gst) [70] were calculated using PopGene v.1.32 [71] and GenAlEx v.6.503 [72] software. The genetic differentiation among populations (Gst) was also calculated within each floristic region of Greece. Furthermore, an Analysis of Molecular Variance (AMOVA) [73] was performed for hierarchical estimation of the genetic variation and differentiation within and among populations and floristic regions. A Principal Coordinate Analysis (PCoA) [74] based on the genetic distance was performed for the total number of individuals, whereas Mantel tests (MT) were carried out to check the presence of correlation between Nei’s genetic and geographic distances and isolation by distance, by employing GenAlEx v.6.503. Specifically, the Mantel test was performed (i) for the whole dataset with all the Himantoglossum s.s. populations and taxa (26 populations), (ii) for the whole dataset after removing the populations from Crete (2 populations) and from Peloponnese (2 populations) as well as the H. galilaeum population, and (iii) for the populations from central and northern Greece only. Finally, a dendrogram was constructed based on Nei’s [69] unbiased genetic distance, using the unweighted pair group method with arithmetic mean (UPGMA) cluster algorithm. Lastly, the STRUCTURE 2.3.4 software (accessed on 15 October 2024) [75] was employed to analyze the genetic structure and to define the genetic entities present in the dataset and any possible admixture in the populations. The Admixture ancestry model with correlated allele frequencies was used, with a 100,000 burn-in period and 500,000 MCMC iterations which ran 20 times for each K (K = 2 to K = 10). The optimal K value was obtained using the online facility STRUCTURE selector [76] based on the deltaK method by Evanno et al. [77]. CLUMPAK (https://clumpak.tau.ac.il/; 15 October 2024) [78] was employed to compile and visualize the results for each K, through the StructureSelector web facility (https://lmme.ac.cn/StructureSelector/index.html; 15 October 2024).

2.6. Results

The parameters of genetic diversity of the studied Himantoglossum s.s. populations and taxa are presented in Table 4 and Table 5. The highest values of the genetic variation parameters were found in the Aspraggeloi population (Asp-NPi: Ne = 1.485, P = 83.8%, He = 0.289, I = 0.435), while high values in most of the parameters were found in the populations Lesvos (Les-EAe: Ne = 1.373, P = 75.8%, He = 0.227, I = 0.350), Evia (Evv-WAe: Ne = 1.467, P = 69.7%, He = 0.265, I = 0.390), Ganadio (Gan-NPi: Ne = 1.407, P = 74.8%, He = 0.246, I = 0.374) and Asvesti (Asv-StE: Ne = 1.360, P = 69.7%, He = 0.216, I = 0.331). On the contrary, the population with the lowest genetic variation values was Mt. Parnonas (Par-Pe: Ne = 1.086, P = 12.1%, He = 0.050, I = 0.073). The two Cretan populations showed contradictory values of the genetic variation parameters, with the Omalos population (Fou-KK) having high values (Ne = 1.364, P = 64.7%, He = 0.216, I = 0.327) and the Katafygio population (Kat-KK) having low values (Ne = 1.087, P = 14.1%, He = 0.052, I = 0.078). The population of H. galilaeum showed even lower values (Ne = 1.071, P = 9.1%, He = 0.039, I = 0.056), which were the lowest among all studied populations.
Within the floristic regions, the populations of H. jankae showed high values in the genetic variation parameters, with the highest ones observed in Northern Pindos (NPi: P = 97.9%, He = 0.289, I = 0.446) and the lowest in Peloponnese (Pe: P = 49.5%, He = 0.185, I = 0.274). Overall, the populations from the floristic regions North-Eastern Greece (NE), North-Central Greece (NC) and Peloponnese (Pe) showed lower heterozygosity values (h < 0.2) compared to the ones from the floristic regions North Pindos (NPi), Sterea Ellas (StE), West Aegean islands (WAe) and East Aegean islands (EAe) (h ≥ 0.2). The genetic differentiation among the populations was high (Gst = 0.398), while the one among the floristic regions was relatively low (Gst = 0.159), with the highest value observed in Peloponnese (Gst = 0.524) and the lowest in Northern Pindos (Gst = 0.175). The two Cretan populations, grouped together, showed high values of genetic variation parameters (P = 70.7%, He = 0.232, I = 0.351), and high genetic differentiation among the two populations (Gst = 0.366). The respective overall values of the genetic variation parameters for all the H. jankae populations were even higher (P = 98.99%, He = 0.275, I = 0.416), while the differentiation among the H. jankae populations was similar to the one in H. samariense (Gst = 0.355) (Table 5). In both species, most of the genetic variation observed is due to differences within the populations (Ht vs. Hs, Table 5), while the genetic differentiation between H. jankae and H. samariense is very small (Gst = 0.033). Furthermore, no species-specific ISSR bands were found and only the populations Gan-NPi and Les-WAe showed one private band each. The Analysis of Molecular Variance (AMOVA) showed that most of the genetic variation in Himantoglossum s.s. results from differences within the populations (72%), rather than among the populations (24%) or among the floristic regions (4%) (Figure 2).
The Principal Coordinate Analysis (PCoA) was carried out based on the individuals (Figure 3a), on the populations (Figure 3b) and on the floristic regions in Greece (Figure 3c) of Himantoglossum s.s., so as to study the structure at different levels. In Figure 3a, the Himantoglossum s.s. individuals form a group, with a few individuals from various populations being outliers. The first three PCoA axes exhibited 26.76% of the total variance, with the first PCoA axis accumulating 15.36% of the variance, whereas the second and the third axes accounted for 6.05% and 5.35%, respectively.
A similar picture is obtained in Figure 3b, where most of the Himantoglossum s.s. populations form a wide diverse group, with the population Par-Pe from Peloponnese being differentiated to this group. The other population from Peloponnese (Tai-Pe), the population from Lesvos island together with the Cretan populations and the H. galilaeum population are placed within the wide diverse group together with the H. jankae populations. In this case, the first three PCoA axes exhibited 49.41% of the total variance, with the first PCoA axis accumulating 24.01% of the variance, the second 14.69% and the third 10.71%, respectively. Finally, in Figure 3c, the populations from the floristic regions NE, NC, NPi and EAe (Lesvos isl.) form a group, while the southern floristic regions, Pe and KK (and to a lesser extent StE and WAe) are differentiated. Noteworthy is the clinal topology of the populations from north to south along the first axis. The first three PCoA axes accounted for 40.81%, 23.70% and 16.08%, respectively, while in total, the first three PCoA axes accounted for 80.59% of the total variance.
Given the great geographical distance among some of the Himantoglossum s.s. populations within Greece (e.g., the ones from central and, mainly, southern Greece, including the ones of H. samariense), the Mantel test was used to check for the presence of isolation by distance. The test was carried out: (i) for the whole set of Himantoglossum s.s. populations (Figure 4a), (ii) for all the Himantoglossum s.s. populations from mainland Greece, excluding the ones from Peloponnese and the islands (Figure 4b), and (iii) only for the Himantoglossum s.s. populations from northern Greece (excluding the ones from Sterea Ellas, Peloponnese and the islands) (Figure 4c). The results show the presence of isolation by distance in the first two cases (Rxy = 0.420, p = 0.01 and Rxy = 0.182, p = 0.036, respectively) but not in the third case, among the populations from northern Greece (Rxy = 0.117, p = 0.176). Overall, the Mantel tests showed that the correlation of genetic and geographic distances was significant when the southernmost and the island populations were included, and non-significant when only the northern populations were analyzed.
The UPGMA dendrogram based on Nei’s unbiased genetic distances among pairs of populations, is shown in Figure 5. A major group is formed, consisting of populations from almost all the floristic regions, which may be further divided into two to three subgroups, without, however, any correlation to the floristic region or the location of the populations. The only populations not joining this major group are the ones from Peloponnese (Par-Pe and Tai-Pe), one of the Cretan populations (Kat-KK) and the population of H. galilaeum. The other Cretan population (Fou-KK) and the population from Lesvos island (Les-EAe) are placed within the major group, among the H. jankae populations. It should be noted that the populations not joining the major group were represented by a small sample size (two to four individuals).
The results of the STRUCTURE software and of the STRUCTURE Selector are shown in Figure 6. The optimal deltaK value was K = four, while a second peak was present for K = two (Figure 6a), indicating the presence of either four or two genetic groups in the dataset, respectively. The structure of the populations for K= and K = four is shown in Figure 6b, where no clear structuring is observed in either case, but rather admixed populations. In particular, for K = two almost all the populations (including the ones of H. samariense and H. galilaeum) are admixed to a bigger or lesser extent, with the ones from the floristic region of North Central Greece (NC) (especially the 2-Fal-NE, 5-Lek-NE and 10-Seih-NE populations) to be less admixed compared to the others. For K = four, the populations from Peloponnese, Crete and the population Kal-StE seem to majorly belong to a genetic group, for which also Rod-NE shows affinity, the populations Kom-NE, Amy-NE and Amf-NE seem to majorly belong to another group, while the populations Fal-NE, Tax-NE, Nik-NE, Lek-NE, Evr-NE, Seih-NE and Bel-NC seem to majorly belong to a third group. The rest of the populations are admixed to a bigger or lesser extent, while a fourth genetic entity is partly present in some of the populations (e.g., Leu-NC, Gan-NPi, Asp-NPi, Les-EAe). In both cases, H. galilaeum shows restricted admixture and a genetic structure similar to the one of the H. jankae populations in North-Eastern Greece.
Sequencing the cpDNA fragments accD and psbA-trnH retrieved 165 and 847 bp, respectively. The accD fragment was highly conserved, since no difference at all present among the individuals and taxa analyzed. Similarly, the psbA-trnH was also conserved; a duplication of an 11bp fragment was found only in the individual from population Bel (NPi) and a SNP was present in position 603, without any correlation to the populations or to the taxa of Himantoglossum s.s. (Table 6). Sequencing the ITS2 nDNA region retrieved 449 bp, where five SNPs were identified with most of the individuals showing heterozygous pattern (dual peaks) (Table 6). Similarly, to psbA-trnH, the observed polymorphism had no correlation to the populations or to the taxa of Himantoglossum s.s.

3. Discussion

Previous morphological studies on Himantoglossum s.s. [19,20] revealed a remarkable floral morphological variation, which makes species’ accurate classification and identification quite problematic, especially in the southern Balkan populations. Apart from the morphological data, this problem cannot be investigated from a karyological point of view due to the limited availability of chromosomal data [21]. The results of the present study demonstrate that high genetic variability is present in Himantoglossum s.s. populations in Greece as well. The higher percentage of this variability is due to differences within populations and, to a much lesser extent, among them, while a very small percentage of the variation is due to differences among the taxa.
The genetic diversity in all the Himantoglossum s.s. populations studied was equal to 0.269, with the two taxa from Greece exhibiting similar values (H. jankae = 0.265, H. samariense = 0.232), while H. galilaeum showed limited gene diversity (0.039), potentially due to the limited sample size. Overall, H. jankae showed higher values in all the genetic variation parameters. The lower values in H. samariense may be due to the restricted sample size (no. of populations and individuals) analyzed compared to the ones of H. jankae. Still, the genetic diversity values recorded for both taxa are higher compared to the average heterozygosity value for the Orchidaceae family (He = 0.137) [79].
It is well documented—albeit with some exceptions—that species range size plays an important role in the levels of genetic variation, with the first being directly analogous to the latter [80,81]. This is confirmed in the case of Himantoglossum jankae, which is the most dominant and widespread species of the hircinum-caprinum clade in the southern Balkan Peninsula [2,20], but not for H. samariense, which was considered as a regional/local endemic [31]. Himantoglossum jankae and H. hircinum have almost the same spatial distribution [20] but the levels of genetic diversity of H. jankae were found to be higher compared to those of H. hircinum [82,83]. On the other hand, despite its restricted range size, the levels of genetic diversity in the Cretan Himantoglossum populations are between those of H. jankae and H. hircinum. In particular, the expected heterozygosity (He) of H. jankae was found to be 0.265 (ranging between 0.050–0.289), whereas the respective value of H. hircinum was 0.200 (ranging between 0.062–0.217), and the one of the Cretan populations (identified as ‘H. samariense’) was 0.232 (ranging between 0.052–0.216). In the case of H. hircinum, Pfeifer et al. [83] observed a significant decrease in the genetic diversity from the center towards the edges of its distribution range. Although it has been suggested that edge populations may have reduced levels of genetic diversity compared to core populations [84], our results show that this pattern is not valid for Himantoglossum s.s. in Greece, since the values of the genetic variation parameters in edge and isolated populations (e.g., the ones in Crete, Lesvos, and Evia islands) were similar to the ones of the Greek mainland populations. An exception was the two populations from the Peloponnese (Par-Pe and Tai-Pe), a result that may be due to the small number of individuals analyzed. Similar results within the Orchidaceae family have been found for Dactylorhiza majalis subsp. majalis, where, using both plastid and nuclear markers, the marginal populations from Scandinavia showed little difference in genetic diversity parameters compared to the populations from central Europe [85].
In both studied species (H. jankae and H. samariense), most of the genetic variation resides within the populations, while great genetic differentiation is observed among them (Gst = 0.398; Table 5). A factor that influences the levels and patterns of genetic differentiation among populations is the breeding system [38,79,86]. Gijbels et al. [86], in their meta-analysis, found that the rewarding orchids had significantly higher values of FST compared to the deceptive orchids (rewarding orchids: mean FST = 0.24; deceptive orchids: mean FST = 0.10), confirming the findings of Cozzolino & Widmer [87] who found that the Gst values of rewarding species ranged between 0.2 and 0.3, whereas those of deceptive species were lower (Gst = 0.1–0.15). The Himantoglossum s.s. taxa studied here, as all the members of the genus, are food-deceptive [20]; thus, one should expect that genetic differentiation among their populations to be rather low. However, both H. jankae and H. samariense are characterized by a great intra-specific differentiation with higher values than those referred to above for deceptive orchids, as well as compared to the mean Gst values reported by Forrest et al. [88] (mean Gst = 0.187). The rather high values of genetic differentiation among populations of the two studied taxa reflect the low gene flow among them. Moreover, the reduced gene flow among the Himantoglossum jankae populations, together with its spatial patterns, may have caused significant differentiation and genetic drift, especially towards the southern populations. This is also evident in the Mantel test results, which showed that there is a significant relationship between genetic and geographic distance, suggesting isolation by distance. Although this pattern was detected when all Himantoglossum s.s. populations were included in the analyses (all mainland and island populations), such a relationship was not significant when only the populations from northern Greece were analyzed. This finding can be attributed to the distribution pattern of H. jankae, which is rather common and widespread in northern Greece, whereas in central Greece (Sterea Ellas-StE), in Peloponnese (Pe) and on the islands (WAe, EAe) is scarce, forming only small-sized populations located far away from the ones in northern Greece. In particular, the Peloponnesian and Cretan Himantoglossum s.s. populations, as well as the ones from central Greece (albeit to a lesser extent), are rather isolated from the northern ones; thus, the reduced gene flow may have resulted in significant genetic drift [86]. On the contrary, in northern Greece the numerous existing populations occurring in relatively close distances, usually consist of several individuals, which makes gene flow among populations easier through pollinator behavior and seed dispersal.
The studied Himantoglossum s.s. taxa could not be clearly discriminated either in terms of the PCoA or by the cluster analysis. Specifically, the position of the Himantoglossum s.s. individuals along the first two PCoA axes did not show any clear discrimination between the different populations of the two taxa, as these overlap to a greater or lesser extent. Only a few individuals seem to slightly differentiate compared to the rest. A similar result was obtained from the PCoA on the populations, where only one of them from Peloponnese (Par-Pe) is differentiated from the rest. However, in the PCoA for the floristic regions, Peloponnese (Pe) and Kriti and Karpathos (KK) are clearly differentiated from the rest of the floristic regions. These findings are in line with the results of the Mantel test carried out at the different levels, and show the differentiation of the southern populations, probably due to their well-established geographic isolation from the rest, and a subsequent genetic drift or potential adaptation [89].
Furthermore, the UPGMA clustering is in line with the above, as the two Peloponnesian and one of the two Cretan populations were not grouped with any other population. However, without overlooking the small sample size in some of the populations, the lack of a clear differentiation between the two studied taxa (H. jankae and H. samariense) can also be attributed to the limited genetic differentiation detected among them (as revealed by Gst). Moreover, the genetic similarity of the two species is further confirmed by the lack of species-specific ISSR bands and nucleotide polymorphisms, capable of discriminating H. samariense from H. jankae. The same applies to the populations from Lesvos island and from Peloponnese. All the above are in accordance with the results from the morphological traits’ analyses [19], where great morphological variability but no discrimination was observed between the different H. jankae populations of the mainland or the populations from Lesvos island and the Peloponnese. Sramkó et al. [21] and Bateman et al. [20] suggested a hybrid origin of the Peloponnesian and Cretan Himantoglossum s.s. populations, a hypothesis that is not in line with the results of the present study. The aforementioned studies were based on a small sample size, consisting of three Himantoglossum individuals collected from Mt. Taigetos (Peloponnese), Samaria area (west Crete) and Kato Symi (east Crete).
H. samariense has been described on the basis of specific morphological traits that cannot discriminate it from the highly variable H. jankae [19]. Over the last 30 years, over-splitting of taxa within the Orchidaceae family has become a rather common phenomenon. Many of the taxa deriving from over-splitting could not be supported by the results of molecular phylogenetic studies, demonstrating that species morphotypes and ecotypes may have been erroneously treated by taxonomists as distinct species [90,91,92]. There is an ongoing controversy as to the number of Himantoglossum taxa-species in the eastern Mediterranean, including whether H. samariense is different from H. jankae. The results of the present study cannot support that the Cretan populations should be treated as a separate species, even though one of its populations (Kat-KK) seemed to differentiate from the rest, similarly to the two populations from the Peloponnese (Figure 5). If not to the small sample size analyzed, this differentiation may be attributed to geographic isolation of these populations, and subsequent genetic drift as an adaptation to local conditions, which, however, has not reached speciation, since the variation in the morphological traits is similar in all the populations, with differences among them arising randomly. Similarly, the differences observed in the nucleotide sequences of both ITS2 and psbA- trnH were random, without any relation to the taxon or the floristic region of the populations. However, the presence of many “heterozygote” positions (double peaks) in ITS2 is noteworthy and in accordance with the great genetic variation of the populations, as well as with the results on the genetic structure of the populations and the presence of two or four genetic entities/clusters in the dataset (Figure 6), with almost all the populations being admixed to a bigger or lesser extent. In either case (K = two or K = four), the observed clustering was not related to the species that exist (or are assumed to exist) in Greece. The aforementioned results can be further supported by the findings of a recent study employing target capture NGS with the Angiosperm353 kit for the discrimination of eastern Mediterranean orchid species, where H. samariense could not be distinguished from H. jankae [93]. Consequently, the populations of Himantoglossum s.s. in Greece are characterized by high genetic variation and differentiation among the populations, while the two supposedly different species (H. jankae and H. samariense) cannot be discriminated. This result may have its origin in a unique, widely-distributed and variable species present in the whole area, which gradually became fragmented due to various geographic and/or environmental factors. The populations that became isolated diverged from the “core” ones due to adaptation, without, however, reaching speciation and forming distinct species. The recent emergence of the hircinum-jankae group (1.5 Mya, [21]) corroborates such a scenario, while the fragmentation may have been caused by the Pleistocene glaciations. The differences observed in the isolated populations may have led to proposals for the presence of additional taxa in Greece (H. calcaratum, H. samariense, H. montis-tauri and H. galilaeum) (e.g., [2,31,94]). The alternation of glacial and interglacial periods during the Pleistocene may have caused the convergence of isolated Himantoglossum “lineages”, leading to the exchange of genetic material and to the creation of high genetic variation and admixed populations. An alternative hypothesis might be that the wider Aegean region was the meeting point of different Himantoglossum lineages, which formed a highly diverse group of admixed individuals and populations present and observable until today, given the relatively young age of the hircinum-jankae group [21]. To this end, the populations Par-Pe, Tai-Pe, Fou-KK, Kat-KK, and Kal-StE may represent one lineage, the populations Kom-NE, Amy-NE and Amf-NE may represent a second one, and the populations Fal-NE, Tax-NE, Nik-NE, Lek-NE, Evr-NE, Seih-NE, Bel-NC and Asv-StE may represent a third lineage, while the rest of the populations seem to be admixed (Figure 6b for K = four). Interestingly, the populations Par-Pe, Tai-Pe, Fou-KK, Kat-KK, and Kal-StE are located in high altitude areas (>1100 m), while the populations Kom-NE, Amy-NE and Amf-NE are located in very low altitude areas (~100 m). Even though we sampled populations covering the entire distribution range of Himantoglossum s.s. in Greece, including and analyzing even more populations and individuals per population could help to elucidate further the evolutionary history of Himantoglossum s.s. and the delimitation of the taxa that it comprises.

4. Implications for Conservation

The ultimate goal of conservation is to ensure the continuous survival of populations and to maintain their evolutionary potential by preserving the levels of genetic diversity. Based on the results of this study, as well as of previous ones, the populations of Himantoglossum s.s. in Greece are highly polymorphic and harbor high genetic variation, with the ones located in central and northern Greece show higher genetic similarity, compared to the ones from southern Greece (Peloponnese and Crete), which are differentiated. All of them, however, are characterized by high genetic variation. Thus, for effective conservation, special attention should be given to the southern isolated populations [81,95,96], apart from the populations located at the center of the species distribution (“core” populations), since both the “core” and the isolated populations may face threats in the near future, either from overharvesting for salep or from the changes in the grazing practices [34].

5. Conclusions

Overall, all the populations of Himantoglossum s.s. in Greece showed high genetic variation, both the ones in the center of the distribution and the peripheral/marginal ones. Some of the peripheral/marginal populations showed differentiation from the “core” ones; however, no differentiation of the populations proposed to belong to a different taxon (e.g., Les-WAe, Par-Pe, Tai-Pe, Kat-KK and Fou-KK) was present, and no polymorphism was identified that may discriminate the above populations from the rest. The southern populations of Himantoglossum s.s. in Greece showed high genetic variation, even though a small number of individuals were studied per population, which, combined with their marginal status, qualifies them as a priority for conservation.

Author Contributions

Conceptualization, S.T., P.M. and A.D.D.; Formal analysis, S.T., M.C., P.M. and A.D.D.; Methodology, S.T., M.C., P.M. and A.D.D.; Resources, S.T. and M.C.; Supervision, A.D.D.; Writing—original draft, S.T. and A.D.D.; Writing—review and editing, S.T., M.C., P.M. and A.D.D. All authors have read and agreed to the published version of the manuscript.

Funding

The field work of this research was financially supported by the Percy Sladen Memorial Fund and the Greek Ministry of Environment through the Program “Monitoring and assessment of the conservation status of species of Community interest in Greece”. Part of this work was carried out and financially supported within the framework of the Postgraduate Studies Program “Conservation of Biodiversity and Sustainable Exploitation of Native Plants”, School of Biology, AUTH.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available because Himantoglossum species are protected by law.

Acknowledgments

The authors cordially thank Vangelis Papiomytoglou (Crete-Greece) and Ishi Talmon, who kindly provided leaf material of H. samariense and H. galilaeum, respectively. The authors kindly thank three anonymous reviewers for providing very constructive and thoughtful comments and suggestions that considerably improved the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Duminil, J.; Di Michele, M. Plant species delimitation: A comparison of morphological and molecular markers. Plant Biosyst. 2009, 143, 528–542. [Google Scholar] [CrossRef]
  2. Delforge, P. Orchids of Europe, North Africa and the Middle East, 3rd ed.; A&C Black: London, UK, 2006. [Google Scholar]
  3. Kretzschmar, H.; Eccarius, W.; Dietrich, H. The Orchid Genera Anacamptis, Orchis and Neotinea. Phylogeny, Taxonomy, Morphology, Biology, Distribution, Ecology and Hybridisation; EchinoMedia Verlag: Bürgel, Germany, 2007. [Google Scholar]
  4. Andersson, E. On the identity of orchid populations: A morphometric study of the Dactylorhiza traunsteineri complex in eastern Sweden. Nord. J. Bot. 1994, 14, 269–275. [Google Scholar] [CrossRef]
  5. Dufrêne, M.; Gathoye, J.-L.; Tyteca, D. Biostatistical studies on western European Dactylorhiza (Orchidaceae)—D. maculata group. Plant Syst. Evol. 1991, 175, 55–72. [Google Scholar] [CrossRef]
  6. Tyteca, D.; Dufrêne, M. On the use of distances in the taxonomic study of critical plant groups—Case studies of Western European Orchidaceae. Ann. Bot. 1993, 71, 257–277. [Google Scholar] [CrossRef]
  7. Amich, F.; García-Barriuso, M.; Crespí, A.; Bernardos, S. Taxonomy, morphometric circumscription and karyology of the Mediterranean African representatives of Ophrys sect. Pseudophrys (Orchidaceae). Plant Biosyst. 2009, 143, 47–61. [Google Scholar] [CrossRef]
  8. Véla, E.; Rebbas, K.; Martin, R.; de Premorel, G.; Tison, J.-M. Waiting for integrative taxonomy: Morphospecies as an operational proxy for the radiative and reticulate genus Ophrys L. (Orchidaceae)? Eur. J. Environ. Scie. 2015, 5, 153–157. [Google Scholar] [CrossRef]
  9. Chase, M.W.; Cameron, K.M.; Barrett, R.L.; Freudenstein, J.V. DNA data and Orchidaceae systematics: A new phylogenetic classification. In Orchid Conservation; Dixon, K.W., Kell, S.P., Barrett, R.L., Crib, P.J., Eds.; Natural History Publications (Borneo): Kota Kinabalu, Malaysia, 2003; pp. 69–89. [Google Scholar]
  10. Freudenstein, J.V. Orchid phylogenetics and evolution: History, current status and prospects. Ann. Bot. 2024, mcae202. [Google Scholar] [CrossRef] [PubMed]
  11. Pérez-Escobar, O.A.; Bogarín, D.; Przelomska, N.A.S.; Ackerman, J.D.; Balbuena, J.A.; Bellot, S.; Bühlmann, R.P.; Cabrera, B.; Cano, J.A.; Charitonidou, M.; et al. The Origin and Speciation of Orchids. N. Phytol. 2024, 242, 700–716. [Google Scholar] [CrossRef]
  12. Bateman, R.M.; Pridgeon, A.M.; Chase, M.W. Phylogenetics of subtribe Orchidinae (Orchidoideae, Orchidaceae) based on nuclear ITS sequences. 2. Infrageneric relationships and reclassification to achieve monophyly of Orchis sensu stricto. Lindleyana 1997, 12, 113–141. [Google Scholar]
  13. Ennos, R.A.; French, G.C.; Hollingsworth, P.M. Conserving taxonomic complexity. Trends Ecol. Evol. 2005, 20, 164–168. [Google Scholar] [CrossRef]
  14. Hollingsworth, P.M.; Squirrell, J.; Richards, A.J.; Bateman, R.M.; Hollingsworth, M.L. Taxonomic Complexity, Conservation and Recurrent Origins of Self-Pollination in Epipactis (Orchidaceae). In Current Taxonomic Research on the British & European Flora; Bailey, J.P., Ellis, R.G., Eds.; Botanical Society of the British Isles: London, UK, 2006; pp. 27–44. [Google Scholar]
  15. Adhikari, B.; Wallace, L.E. Does the Platanthera dilatata (Orchidaceae) complex contain cryptic species or continuously variable populations? Plant Syst. Evol. 2014, 300, 1465–1476. [Google Scholar] [CrossRef]
  16. Li, Y.L.; Tong, Y.; Xing, F.W. DNA Barcoding Evaluation and Its Taxonomic Implications in the Recently Evolved Genus Oberonia Lindl. (Orchidaceae) in China. Front. Plant Sci. 2016, 7, 1791. [Google Scholar] [CrossRef] [PubMed]
  17. Gale, S.W.; Li, J.; Suddee, S.; Traiperm, P.; Craig, I.P.; Buruwate, T.; Crain, B.J.; McCormick, M.K.; Whigham, D.F.; Musthofa, A.; et al. Molecular phylogenetic analyses reveal multiple long-distance dispersal events and extensive cryptic speciation in Nervilia (Orchidaceae), an isolated basal Epidendroid genus. Front. Plant Sci. 2025, 15, 1495487. [Google Scholar] [CrossRef]
  18. Bateman, R.M.; Rudall, P.J.; Hawkins, J.A.; Sramkó, G. Himantoglossum hircinum (Lizard Orchid) reviewed in the light of new morphological and molecular observations. N. J. Bot. 2013, 3, 122–140. [Google Scholar] [CrossRef]
  19. Tsiftsis, S. Morphological variability of Himantoglossum s.s. (Orchidaceae) in Greece. Phytotaxa 2016, 245, 17–30. [Google Scholar] [CrossRef]
  20. Bateman, R.M.; Molnár, V.A.; Sramkó, G. In situ morphometric survey elucidates the evolutionary systematics of the Eurasian Himantoglossum clade (Orchidaceae: Orchidinae). PeerJ 2017, 5, e2893. [Google Scholar] [CrossRef] [PubMed]
  21. Sramkó, G.; Molnár, A.V.; Hawkins, J.A.; Bateman, R.M. Molecular phylogeny and evolutionary history of the Eurasiatic orchid genus Himantoglossum s.l. (Orchidaceae). Ann. Bot. 2014, 114, 1609–1626. [Google Scholar] [CrossRef]
  22. Bateman, R.M.; Hollingsworth, P.M.; Preston, J.; Yi-Bo, L.; Pridgeon, A.M.; Chase, M.W. Molecular phylogenetics and evolution of Orchidinae and selected Habenariinae (Orchidaceae). Bot. J. Linn. Soc. 2003, 142, 1–40. [Google Scholar] [CrossRef]
  23. Sundermann, H. Europäische und Mediterrane Orchideen; Kurt Schmersow: Hildesheim, Germany, 1975. [Google Scholar]
  24. Tutin, T.G.; Heywood, V.H.; Burges, N.A.; Moore, D.M.; Valentine, D.H.; Walters, S.M.; Webb, D.A. Flora Europaea, 5, Alismataceae to Orchidaceae; Cambridge University: Cambridge, UK, 1980. [Google Scholar]
  25. Baumann, H.; Künkele, S.; Lorenz, R. Orchideen Europas Mit Angrenzenden Gebieten; Eugen Ulmer: Stuttgart, Germany, 2006. [Google Scholar]
  26. Petrou, N.; Petrou, M.; Giannakoulias, M. Orchids of Greece; Koan Publishing House: Athens, Greece, 2011; 320p. [Google Scholar]
  27. Kreutz, C.A.J. Drei neue Orchideenarten aus der Südwesttürkei: Himantoglossum montis-tauri, Ophrys hygrophila und Ophrys labiosa. J. Eur. Orchid. 1997, 29, 653–698. [Google Scholar]
  28. Biel, B. Die Orchideenflora der Insel Lesvos (Griechenland). J. Eur. Orchid. 1998, 30, 251–443. [Google Scholar]
  29. Wielinga, A.; Wielinga, R. Op zoek naar Orchideeën op Lesbos. Eurorchis 2004, 16, 5–11. [Google Scholar]
  30. Vöth, W. Himantoglossum affine aus dem Peloponnes. Die Orchid. 1978, 29, 113–114. [Google Scholar]
  31. Alibertis, C.; Alibertis, A. The Orchids of Crete; Ch. & A. Alibertis: Iraklion, Greece, 1989. (In Greek) [Google Scholar]
  32. Devillers, P.; Baeten, F.; Dedroog, L.; Devillers-Terschuren, J.; Flausch, A. Orchids of Lesvos: Distributional and biogeographical notes. Les Nat. Belg. 2010, 91, 206–245. [Google Scholar]
  33. Rückbrodt, U.; Rückbrodt, D. Himantoglossum affine (Boiss.) Schltr. auf Kreta? Berichte Aus Arbeitskreisen Heim. Orchid. 1987, 4, 314–321. [Google Scholar]
  34. Tsiftsis, S.; Antonopoulos, Z. Atlas of the Greek Orchids; Mediterraneo Editions: Rethymno, Greece, 2017; Volume 1. [Google Scholar]
  35. Shifman, A. Himantoglossum galilaeum (Orchidaceae), a new Orchid in Northern Israel. J. Eur. Orch. 2008, 40, 727–748. [Google Scholar]
  36. Doyle, J.J.; Doyle, J.L. A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  37. Sreedar, R.V.; Venkatachalam, L.; Roohie, K.; Bhagyalakshimi, N. Molecular analysis of Vanilla planifolia cultivated in India using RAPD and ISSR markers. Orchid. Sci. Biotechnol. 2007, 1, 25–30. [Google Scholar]
  38. George, S.; Sharma, J.; Yadon, V.L. Genetic diversity of the endangered and narrow endemic Piperia yadonii (Orchidaceae) assessed with ISSR polymorphisms. Am. J. Bot. 2009, 96, 2022–2030. [Google Scholar] [CrossRef]
  39. Warghat, A.R.; Bajpai, P.K.; Srivastava, R.B.; Chaurasia, O.P.; Sood, H. Population genetic structure and conservation of small fragmented locations of Dactylorhiza hatagirea in Ladakh region of India. Sci. Hortic. 2013, 164, 448–454. [Google Scholar] [CrossRef]
  40. Luo, J.; Hou, B.W.; Niu, Z.T.; Liu, W.; Xue, Q.Y.; Ding, X.Y. Comparative Chloroplast Genomes of Photosynthetic Orchids: Insights into Evolution of the Orchidaceae and Development of Molecular Markers for Phylogenetic Applications. PLoS ONE 2014, 9, e99016. [Google Scholar] [CrossRef]
  41. Dong, W.-L.; Wang, R.-N.; Zhang, N.-Y.; Fan, W.-B.; Fang, M.-F.; Li, Z.-H. Molecular Evolution of Chloroplast Genomes of Orchid Species: Insights into Phylogenetic Relationship and Adaptive Evolution. Int. J. Mol. Sci. 2018, 19, 716. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, H.; Ye, H.; Zhang, N.; Ma, J.; Wang, J.; Hu, G.; Li, M.; Zhao, P. Comparative Analyses of Chloroplast Genomes Provide Comprehensive Insights into the Adaptive Evolution of Paphiopedilum (Orchidaceae). Horticulturae 2022, 8, 391. [Google Scholar] [CrossRef]
  43. Liu, L.; Du, J.; Liu, Z.; Zuo, W.; Wang, Z.; Li, J.; Zeng, Y. Comparative and phylogenetic analyses of nine complete chloroplast genomes of Orchidaceae. Sci. Rep. 2023, 13, 21403. [Google Scholar] [CrossRef]
  44. Štorchová, H.; Olson, M. The architecture of the chloroplast psbA-trnH non-coding region in angiosperms. Plant Syst. Evol. 2007, 268, 235–256. [Google Scholar] [CrossRef]
  45. Kress, W.; Erickson, D. A two-locus global DNA barcode for land plants: The coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2007, 2, e508. [Google Scholar] [CrossRef] [PubMed]
  46. Loera-Sánchez, M.; Studer, B.; Kölliker, R. DNA barcode trnH-psbA is a promising candidate for efficient identification of forage legumes and grasses. BMC Res. Notes 2020, 13, 35. [Google Scholar] [CrossRef]
  47. Yao, R.; Guo, R.; Liu, Y.; Kou, Z.; Shi, B. Identification and phylogenetic analysis of the genus Syringa based on chloroplast genomic DNA barcoding. PLoS ONE 2022, 17, e0271633. [Google Scholar] [CrossRef]
  48. Devey, D.S.; Bateman, R.M.; Fay, M.F.; Hawkins, J.A. Friends or relatives? Phylogenetics and species delimitation in the controversial European orchid genus Ophrys. Ann. Bot. 2008, 101, 385–402. [Google Scholar] [CrossRef] [PubMed]
  49. Raskoti, B.B.; Ale, R. DNA barcoding of medicinal orchids in Asia. Sci. Rep. 2021, 11, 23651. [Google Scholar] [CrossRef]
  50. Chen, Z.; Gao, L.; Wang, H.; Feng, S. Molecular Identification and Phylogenetic Analysis of Cymbidium Species (Orchidaceae) Based on the Potential DNA Barcodes matK, rbcL, psbA-trnH, and Internal Transcribed Spacer. Agronomy 2024, 14, 933. [Google Scholar] [CrossRef]
  51. Kress, W.J.; Wurdack, K.J.; Zimmer, E.A.; Weigt, L.A.; Janzen, D.H. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. USA 2005, 102, 8369–8374. [Google Scholar] [CrossRef] [PubMed]
  52. Baldwin, B.G. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: An example from the Compositae. Mol. Phyl. Evol. 1992, 1, 3–16. [Google Scholar] [CrossRef]
  53. Inda, L.A.; Pimentel, M.; Chase, M.W. Phylogenetics of tribe Orchideae (Orchidaceae: Orchidoideae) based on combined DNA matrices: Inferences regarding timing of diversification and evolution of pollination syndromes. Ann. Bot. 2012, 110, 71–90. [Google Scholar] [CrossRef] [PubMed]
  54. Cheng, L.; Lin, Z.; Xin, C.; Sun, H.; Li, X. Molecular identification and phylogenetic analysis of Papaver based on ITS2 barcoding. J. Forensic. Sci. 2022, 67, 712–719. [Google Scholar] [CrossRef]
  55. Xiang, X.G.; Hu, H.; Wang, W.; Jin, X.H. DNA barcoding of the recently evolved genus Holcoglossum (Orchidaceae: Aeridinae): A test of DNA barcode candidates. Mol. Ecol. Resour. 2011, 11, 1012–1021. [Google Scholar] [CrossRef]
  56. Xiang, X.G.; Schuiteman, A.; Li, D.Z.; Huang, W.C.; Chung, S.W.; Li, J.W.; Zhou, H.L.; Jin, W.T.; Lai, Y.J.; Li, Z.Y.; et al. Molecular systematics of Dendrobium (Orchidaceae, Dendrobieae) from mainland Asia based on plastid and nuclear sequences. Mol. Phylogenet. Evol. 2013, 69, 950–960. [Google Scholar] [CrossRef]
  57. Soliva, M.; Kocyan, A.; Widmer, A. Molecular phylogenetics of the sexually deceptive orchid genus Ophrys (Orchidaceae) based on nuclear and chloroplast DNA sequences. Mol. Phylogenet. Evol. 2001, 20, 78–88. [Google Scholar] [CrossRef] [PubMed]
  58. Ghorbani, A.; Gravendeel, B.; Selliah, S.; Zarre, S.; de Boer, H. DNA barcoding of tuberous Orchidoideae: A resource for identification of orchids used in Salep. Mol. Ecol. Res. 2017, 17, 342–352. [Google Scholar] [CrossRef]
  59. Madesis, P.; Ganopoulos, I.; Ralli, P.; Tsaftaris, A. Barcoding the major Mediterranean leguminous crops by combining universal chloroplast and nuclear DNA sequence targets. Genet. Mol. Res. 2012, 11, 2548–2558. [Google Scholar] [CrossRef]
  60. Hall, T. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  61. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. ClustalW and ClustalX version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
  62. Sang, T.; Crawford, D.J.; Stuessy, T.F. Chloroplast DNA Phylogeny, Reticulate Evolution, and Biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 1997, 84, 1120–1136. [Google Scholar] [CrossRef]
  63. Tate, J.A.; Simpson, B.B. Paraphyly of Tarasa philippi (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 2003, 28, 723–737. [Google Scholar]
  64. Ford, C.S.; Ayres, K.L.; Toomey, N.; Haider, N.; van Alphen Stahl, J.; Kelly, L.J.; Winstrom, N.; Hollingsworth, P.M.; Duff, R.J.; Hoot, S.B.; et al. Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. Soc. 2009, 159, 1–11. [Google Scholar] [CrossRef]
  65. Chen, S.; Yao, H.; Han, J.; Liu, C.; Song, J.; Shi, L.; Zhu, Y.; Ma, X.; Gao, T.; Pang, X.; et al. Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef] [PubMed]
  66. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
  67. Schaffer, H.E.; Sederoff, R.R. Improved estimation of DNA fragment lengths from agarose gels. Anal. Biochem. 1981, 115, 113–122. [Google Scholar] [CrossRef]
  68. Culley, T.M. Population Genetic Analysis of ISSR Data. 2005. Available online: https://scholar.google.com/scholar?hl=el&as_sdt=0%2C5&q=Culley+T.M.+Population+Genetic+Analysis+of+ISSR+Data.&btnG= (accessed on 5 April 2025).
  69. Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef]
  70. Nei, M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978, 89, 583–590. [Google Scholar] [CrossRef]
  71. Yeh, F.C.; Yang, R.; Boyle, T. POPGENE, the User-Friendly Shareware for Population Genetic Analysis. Molecular Biology and Biotechnology Center. 1997. Available online: http://www.ualberta.ca/~fyeh/ (accessed on 13 March 2025).
  72. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  73. Excoffier, L.; Smouse, P.E.; Quattro, J.M. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 1992, 131, 479–491. [Google Scholar] [CrossRef] [PubMed]
  74. Orloci, L. Multivariate Analysis in Vegetation Research; Dr. W. Junk B.V.: The Hague, The Netherlands, 1978. [Google Scholar]
  75. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  76. Li, Y.L.; Liu, J.X. StructureSelector: A web based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef]
  77. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
  78. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [PubMed]
  79. Hamrick, J.L.; Godt, J.W. Effects of life history traits on genetic diversity in plant species. Philos. Trans. R. Soc. London Ser. B Biol. Sci. 1996, 351, 1291–1298. [Google Scholar]
  80. Hamrick, J.L.; Godt, M.J.W. Allozyme diversity in plant species. In Plant Population Genetics, Breeding, and Genetic Resources; Brown, A.H.D., Clegg, M.T., Kahler, A.L., Weir, B.S., Eds.; Sinnauer Associates Inc.: Sunderland, MA, USA, 1990; pp. 43–63. [Google Scholar]
  81. Pillon, Y.; Fay, M.; Shipunov, A.; Chase, M. Species diversity versus phylogenetic diversity: A practical study in the taxonomically difficult genus Dactylorhiza (Orchidaceae). Biol. Conserv. 2006, 129, 4–13. [Google Scholar] [CrossRef]
  82. Pfeifer, M.; Jetschke, G. Influence of geographical isolation on genetic diversity of Himantoglossum hircinum (Orchidaceae). Folia Geobot. 2006, 41, 3–20. [Google Scholar] [CrossRef]
  83. Pfeifer, M.; Schatz, B.; Xavier Picó, F.; Passalacqua, N.G.; Fay, M.F.; Carey, P.D.; Jeltsch, F. Phylogeography and genetic structure of the orchid Himantoglossum hircinum (L.) Spreng. across its European central-marginal gradient. J. Biogeogr. 2009, 36, 2353–2365. [Google Scholar] [CrossRef]
  84. Vucetich, J.A.; Waite, T.A. Spatial patterns of demography and genetic processes across the species’ range: Null hypotheses for landscape conservation genetics. Conserv. Genet. 2003, 4, 639–645. [Google Scholar] [CrossRef]
  85. Hedrén, M.; Nordström Olofsson, S. High levels of genetic diversity in marginal populations of the marsh orchid Dactylorhiza majalis subsp. majalis. Nord. J. Bot. 2018, 36, e01747. [Google Scholar] [CrossRef]
  86. Gijbels, P.; De Hert, K.; Jacquemyn, H.; Honnay, O. Reduced fecundity and genetic diversity in small populations of rewarding versus deceptive orchid species: A meta-analysis. Plant Ecol. Evol. 2015, 148, 153–159. [Google Scholar] [CrossRef]
  87. Cozzolino, S.; Widmer, A. Orchid diversity: An evolutionary consequence of deception? Trends Ecol. Evol. 2005, 20, 487–494. [Google Scholar] [CrossRef]
  88. Forrest, A.D.; Hollingsworth, M.L.; Hollingsworth, P.M.; Sydes, C.; Bateman, R.M. Population genetic structure in European populations of Spiranthes romanzoffiana set in the context of other genetic studies on orchids. Heredity 2004, 92, 218–227. [Google Scholar] [CrossRef]
  89. Tremblay, R.L.; Ackerman, J. The genetic structure of orchid populations and its evolutionary importance. Lankesteriana 2003, 7, 87–92. [Google Scholar]
  90. Pillon, Y.; Chase, M.W. Taxonomic exaggeration and its effects on orchid conservation. Conserv. Biol. 2007, 21, 263–265. [Google Scholar] [CrossRef]
  91. Janes, J.K.; Steane, D.A.; Vaillancourt, R.E. What does population structure analysis reveal about the Pterostylis longifolia complex (Orchidaceae)? Ecol. Evol. 2012, 2, 2631–2644. [Google Scholar] [CrossRef]
  92. Hedrén, M.; Nordström, S.; Persson, H.; Pedersen, H.Æ.; Hansson, S. Patterns of polyploidy evolution in Greek Dactylorhiza (Orchidaceae) as revealed by allozymes, AFLPs and plastid DNA data. Am. J. Bot. 2007, 94, 1205–1218. [Google Scholar] [CrossRef]
  93. Anthoons, B.; Veltman, M.A.; Tsiftsis, S.; Gravendeel, B.; Drouzas, A.D.; de Boer, H.J.; Madesis, P. Exploring the Potential of Angiosperms353 Markers for Species Identification of Eastern Mediterranean Orchids. Mol. Phyl. Evol. 2005, 209, 108360. [Google Scholar] [CrossRef]
  94. Delforge, P. Contribution taxonomique et nomenclaturale au genere Himantoglossum (Orchidaceae). Nat. Belg. 1999, 80, 387–408. [Google Scholar]
  95. Ilves, A.; Metsare, M.; Seliškar, A.; García, M.B.; Vassiliou, L.; Pierce, S.; Tatarenko, I.; Tali, K.; Kull, T. Genetic diversity patterns of the orchid Anacamptis pyramidalis at the edges of its distribution range. Plant Syst. Evol. 2016, 302, 1227–1238. [Google Scholar] [CrossRef]
  96. Tian, H.Z.; Han, L.X.; Zhang, J.L.; Li, X.L.; Kawahara, T.; Yukawa, T.; Lopez-Pujol, J.; Kumar, P.; Chung, M.G.; Chung, M.Y. Genetic diversity in the endangered terrestrial orchid Cypripedium japonicum in East Asia: Insights into population history and implications for conservation. Sci. Rep. 2018, 8, 6467. [Google Scholar] [CrossRef] [PubMed]
Diversity 17 00329 g001
Figure 1. Map with the location of Himantoglossum s.s. populations used in the present study. Shaded area corresponds to the known distribution area of Himantoglossum s.s. in Greece. Full names of and detailed information on the populations are provided in Table 1.
Figure 1. Map with the location of Himantoglossum s.s. populations used in the present study. Shaded area corresponds to the known distribution area of Himantoglossum s.s. in Greece. Full names of and detailed information on the populations are provided in Table 1.
Diversity 17 00329 g001
Diversity 17 00329 g002
Figure 2. AMOVA analysis for the structure of genetic variation in Himantoglossum s.s.
Figure 2. AMOVA analysis for the structure of genetic variation in Himantoglossum s.s.
Diversity 17 00329 g002
Diversity 17 00329 g003
Figure 3. PCoA based on the distance among the individuals (a), among the populations (b) and among the floristic regions (c) of Himantoglossum s.s. in Greece. (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Figure 3. PCoA based on the distance among the individuals (a), among the populations (b) and among the floristic regions (c) of Himantoglossum s.s. in Greece. (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Diversity 17 00329 g003
Diversity 17 00329 g004
Figure 4. Mantel test based on (a) all the Himantoglossum s.s. populations from Greece, (b) on all the Himantoglossum s.s. populations from Greece, excluding the ones from Peloponnese and from the islands and (c) only on the Himantoglossum s.s. populations from central and northern Greece, floristic regions NE, NC and NPi (excluding the ones from Sterea Ellas, Peloponnese and the islands). The blue triangles correspond to the individuals’ values, while the red line is the regression line. (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Figure 4. Mantel test based on (a) all the Himantoglossum s.s. populations from Greece, (b) on all the Himantoglossum s.s. populations from Greece, excluding the ones from Peloponnese and from the islands and (c) only on the Himantoglossum s.s. populations from central and northern Greece, floristic regions NE, NC and NPi (excluding the ones from Sterea Ellas, Peloponnese and the islands). The blue triangles correspond to the individuals’ values, while the red line is the regression line. (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Diversity 17 00329 g004
Diversity 17 00329 g005
Figure 5. UPGMA clustering (based on Nei’s unbiased genetic distance) of all the Himantoglossum s.s. populations. In each population, an indication of the floristic region has been added. Color coding corresponds to the one in Figure 1 and Figure 3 (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Figure 5. UPGMA clustering (based on Nei’s unbiased genetic distance) of all the Himantoglossum s.s. populations. In each population, an indication of the floristic region has been added. Color coding corresponds to the one in Figure 1 and Figure 3 (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Diversity 17 00329 g005
Diversity 17 00329 g006
Figure 6. Results obtained from the STRUCTURE software, regarding the genetic structure of the populations/taxa: (a) estimation of optimal K using the method by Evanno et al. [77] and employing the StructureSelector web facility, (b) the genetic structure of the populations/taxa for K = two and K = four.
Figure 6. Results obtained from the STRUCTURE software, regarding the genetic structure of the populations/taxa: (a) estimation of optimal K using the method by Evanno et al. [77] and employing the StructureSelector web facility, (b) the genetic structure of the populations/taxa for K = two and K = four.
Diversity 17 00329 g006
Table 1. Himantoglossum s.s. populations, geographical data and number of individuals used in the analyses.
Table 1. Himantoglossum s.s. populations, geographical data and number of individuals used in the analyses.
PopulationPopulation
Code		Floristic Region of GreeceLatitude
N		Longitude
E		Elevation
(m)		No of Individuals
(Ns)
1Mt. Rodopi (Drama)RodNE41°25′24°17′10357
2Mt. Falakron (Drama)FalNE41°20′24°11′4709
3Taxiarches (Drama)TaxNE41°12′24°11′3807
4Nikiforos (Drama)NikNE41°10′24°20′2559
5Mt. Lekani (Kavala)LekNE41°09′24°30′9929
6Iasmos (Rodopi)KomNE41°08′25°12′6010
7Amygdaleonas (Kavala)AmyNE40°58′24°21′1209
8Dikella (Evros)EvrNE40°54′25°41′23011
9Amfipoli (Serres)AmfNE40°49′23°51′868
10Seih Sou (Thessaloniki)SeihNE40°35′23°02′2908
11Leucopetra (Imathia)LeuNC40°26′22°10′5543
12Belos (Kastoria)BelNC40°23′21°18′6208
13Omali (Kozani)OmaNPi40°16′21°14′8106
14Mt. Grammos (Kastoria)GraNPi40°13′20°59′7888
15Ganadio (Ioannina)GanNPi40°07′20°49′89010
16Aspraggeloi (Ioannina)AspNPi39°45′20°52′7158
17Asvesti (Fthiotis)AsvStE39°02′22°06′7309
18Kaloskopi (Fthiotis)KalStE38°41′22°18′12003
19Nea Pavliani (Fthiotis)PavStE38°44′22°22′9056
20Evia Island (Evia)EvvWAe38°36′24°00′8506
21Lesvos Island (Lesvos)LesEae39°01′26°22′65010
22Mt. Parnonas (Arcadia)ParPe37°15′22°35′14202
23Mt. Taigetos (Lakonia)TaiPe36°57′22°22′11194
24Omalos (Chania)FouΚΚ35°21′23°54′11107
25Katafygio (Samaria)KatΚΚ35°19′23°55′12113
26H. galilaeumGal-32°59′35°23′ 3
Total 183
Table 2. ISSR primers used, their sequence and number of bands scored in each primer.
Table 2. ISSR primers used, their sequence and number of bands scored in each primer.
PrimerSequenceRange of FragmentsNumber of Bands
UBC-810(CA)8T500–240024
UBC-811(GA)8 C 450–200017
UBC-815(GA)8YT500–175016
UBC-834(AG)8 YT 310–280023
UBC-847(CA)8 RC 350–200019
Total 99
Table 3. Primers used for amplifying the two cpDNA and the ITS2 regions.
Table 3. Primers used for amplifying the two cpDNA and the ITS2 regions.
DNA RegionPrimersSequenceReference
psbA-trnHpsbA3_f GTTATGCATGAACGTAATGCTC [62]
trnHf_05 CGCGCATGGTGGATTCACAATCC [63]
accDaccD-FGGR GCA CGT ATG CAA GAA GG[64]
accD-RTCT TTT ACC CGC AAA TGC AAT[64]
ITS2ITS2-S2FATGCGATACTTGGTGTGAAT[65]
ITS2-S3RGACGCTTCTCCAGACTACAAT[65]
Table 4. Genetic diversity parameters for each Himantoglossum population studied and per floristic region of Greece [Ns: number of individuals per population; Ne: effective number of alleles; He: expected heterozygosity; I: Shannon diversity index; P: percentage of polymorphic loci; PB: number of private bands; Gst: genetic diversity among populations]. (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Table 4. Genetic diversity parameters for each Himantoglossum population studied and per floristic region of Greece [Ns: number of individuals per population; Ne: effective number of alleles; He: expected heterozygosity; I: Shannon diversity index; P: percentage of polymorphic loci; PB: number of private bands; Gst: genetic diversity among populations]. (NE: North-Eastern Greece, NC: North-Central Greece, NPi: North Pindos, StE: Sterea Ellas, WAe: West Aegean islands, EAe: East Aegean islands, Pe: Peloponnese, KK: Kriti and Karpathos).
Population
Code-Floristic Region		No of Individuals (Ns) NeP
%		HeIPBP
%		He IGst
1Rod-NE71.27143.4 0.1580.235093.90.2230.3570.334
2Fal-NE91.24839.40.1410.2100
3Tax-NE71.29445.50.1690.2500
4Nik-NE91.27350.50.1650.2510
5Lek-NE91.18429.30.1100.1630
6Kom-NE101.28159.60.1710.2660
7Amy-NE91.26848.50.1620.2460
8Evr-NE111.23344.40.1430.2180
9Amf-NE81.21739.40.1280.1940
10Seih-NE81.24035.40.1380.2020
11Leu-NC31.29248.50.1760.264075.80.2020.3190.202
12Bel-NC81.27955.60.1650.2540
13Oma-NPi61.37760.60.2180.325097.90.2890.4460.175
14Gra-NPi81.33851.50.1940.2870
15Gan-NPi101.40774.80.2460.3741
16Asp-NPi81.48583.80.2890.4350
17Asv-StE91.36069.70.2160.331087.90.2590.3970.188
18Kal-StE31.40057.60.2280.3340
19Pav-StE61.32457.60.1900.2880
20Evv-WAe61.46769.70.2650.390069.70.2640.390-
21Les-EAe101.37375.80.2270.350175.80.2270.350-
22Par-Pe21.08612.10.0500.073049.50.1850.2740.524
23Tai-Pe41.23428.30.1250.1780
24Fou-KK71.36464.70.2160.327070.70.2320.3510.366
25Kat-KK31.08714.10.0520.0780
26Gal-1.0719.10.0390.0560----
Among the floristic regions 0.159
Overall 1.28799.00.2690.422-99.00.2690.4220.398
Table 5. Genetic diversity parameters for the two Himantoglossum taxa and for Himantoglossum s.s. in Greece [N: number of individuals sampled; Ne: effective number of alleles; He: expected heterozygosity; I: Shannon diversity index; P: percentage of polymorphic loci; Ht: total expected heterozygosity; Hs: heterozygosity within populations; Gst: genetic diversity among populations].
Table 5. Genetic diversity parameters for the two Himantoglossum taxa and for Himantoglossum s.s. in Greece [N: number of individuals sampled; Ne: effective number of alleles; He: expected heterozygosity; I: Shannon diversity index; P: percentage of polymorphic loci; Ht: total expected heterozygosity; Hs: heterozygosity within populations; Gst: genetic diversity among populations].
TaxonNNeHeIPHtHsGst
H. jankae1701.4240.2650.41699.00.2750.1770.355
H. samariense101.3890.2320.35170.70.2110.1340.366
Between the two taxa 0.033
Himantoglossum s.s. in Greece1801.4320.2690.42199.00.2790.1740.398
Table 6. Sequence/nucleotide variations obtained after aligning the chloroplast DNA psbA-trnH sequences and the nuclear DNA ITS2 sequences.
Table 6. Sequence/nucleotide variations obtained after aligning the chloroplast DNA psbA-trnH sequences and the nuclear DNA ITS2 sequences.
psbA-trnHITS2
Base
Position 		244–25560329104204207247
Sample
Rod7-NE - - - - - - - - - - -AC/TCCAG/T
Fal1-NE - - - - - - - - - - -GCC/TCA/GG
Lek13-NE - - - - - - - - - - -GC/TC/TCAG
Evr3-NE - - - - - - - - - - -GC/TC/TCA/GG/T
Amf4-NE - - - - - - - - - - -GCC/TCA/GG
Seih1-NE- - - - - - - - - - -GCC/TCA/GG
Bel6-NCT A A G A T A A G T AAC/TC/TCA/GG
Gra14-NPi - - - - - - - - - - -AC/TC/TCA/GG
Asp3-NPi - - - - - - - - - - -AC/TC/TCA/GG/T
Asv9-StE - - - - - - - - - - -ACC/TCA/GG
Pav1-StE - - - - - - - - - - -GCC/TCA/GG
Evv9-WAe - - - - - - - - - - -AC/TCCAG
Les15-EAe - - - - - - - - - - -ACTCGG
Par1-Pe - - - - - - - - - - -ACC/TCA/GG
Par2-Pe - - - - - - - - - - -ACTCA/GG
Tai2-Pe - - - - - - - - - - -ACC/TCA/GG
Fou1-KK - - - - - - - - - - -ACC/TG/CA/GG
Fou2-KK - - - - - - - - - - -ACC/TG/CA/GG
Fou5-KK - - - - - - - - - - -ACTCGG
Fou7-KK - - - - - - - - - - -ACTCGG
Kat1-KK - - - - - - - - - - -A-----
Kat3-KK - - - - - - - - - - -ACC/TCA/GG
gal2 - - - - - - - - - - -A-----
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tsiftsis, S.; Charitonidou, M.; Madesis, P.; Drouzas, A.D. Genetic Variation and Differentiation of Himantoglossum s.s. in Greece. Diversity 2025, 17, 329. https://doi.org/10.3390/d17050329

AMA Style

Tsiftsis S, Charitonidou M, Madesis P, Drouzas AD. Genetic Variation and Differentiation of Himantoglossum s.s. in Greece. Diversity. 2025; 17(5):329. https://doi.org/10.3390/d17050329

Chicago/Turabian Style

Tsiftsis, Spyros, Martha Charitonidou, Panagiotis Madesis, and Andreas D. Drouzas. 2025. "Genetic Variation and Differentiation of Himantoglossum s.s. in Greece" Diversity 17, no. 5: 329. https://doi.org/10.3390/d17050329

APA Style

Tsiftsis, S., Charitonidou, M., Madesis, P., & Drouzas, A. D. (2025). Genetic Variation and Differentiation of Himantoglossum s.s. in Greece. Diversity, 17(5), 329. https://doi.org/10.3390/d17050329

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop