Next Article in Journal
Effects of the Diurnal Light and Temperature Fluctuations on the Growth, Photosynthesis and Biochemical Composition of Terrestrial Oleaginous Microalga Vischeria sp. WL1 (Eustigmatophyceae)
Next Article in Special Issue
Herbert D. Athearn and the Museum of Fluviatile Mollusks
Previous Article in Journal
Ecological Factors Associated with Burrow System Occupancy by Great Desert Skinks (Liopholis kintorei)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Status and Life History Traits of Simpsonaias ambigua (Salamander Mussel) in Ontario, Canada

by
Isabel Porto-Hannes
1,2,*,
Kelly A. McNichols-O’Rourke
2,
Mandy P. Gibson
2 and
Todd J. Morris
2
1
Department of Environment and Sustainability, University at Buffalo, Buffalo, NY 14260, USA
2
Great Lakes Laboratory for Fisheries and Aquatic Sciences, Fisheries and Oceans Canada, 867 Lakeshore Drive, Burlington, ON L7S 1A1, Canada
*
Author to whom correspondence should be addressed.
Diversity 2025, 17(2), 133; https://doi.org/10.3390/d17020133
Submission received: 17 January 2025 / Revised: 5 February 2025 / Accepted: 13 February 2025 / Published: 15 February 2025
(This article belongs to the Special Issue Ecology and Conservation of Freshwater Mollusks)

Abstract

Simpsonaias ambigua (Salamander Mussel) is a freshwater mussel of the Family Unionidae endemic to North America, and it is considered endangered across most of its range. This species is unique among the Unionidae, because it uses the salamander, Necturus maculosus (Mudpuppy), as its larval host rather than fish like all other unionids. The overall goal of this study was to obtain baseline data on the current distribution and life history traits of S. ambigua in Ontario, Canada. These data are critical for future recovery efforts to protect, restore, or augment populations of S. ambigua across its range. Conventional survey methods were adapted to target S. ambigua, and an additional method was employed to detect this species: trapping N. maculosus and inspecting for signs of encysted glochidia. Both methods were successful at detecting S. ambigua when they were present. Furthermore, Simpsonaias ambigua’s life history traits were investigated, and more information is now available on the reproductive timing windows related to gonad and glochidia development and the host infestation period, as well as on longevity.

1. Introduction

Simpsonaias ambigua (Say, 1825), Salamander Mussel, is a freshwater mussel of the Family Unionidae. It is small (a maximum length of 50 mm and a height of 28 mm), with a thin, elongated, and elliptical shell. This species is unique among the Unionidae, as it uses an aquatic salamander, Necturus maculosus (Rafinesque, 1818), Mudpuppy, with external gills as its host [1] rather than a fish like all other North American freshwater mussels. Simpsonaias ambigua is found within medium to large rivers or lakes, in areas of swift current burrowed in mud, silt, sand, or gravel [2]. This mussel is almost exclusively found beneath large, flat stones or under ledges of rock walls in habitats that most likely facilitate contact with its amphibian host [1]. Other potentially suitable habitats are among the roots of emergent vegetation, large woody debris, and undercuts of banks [1,3].
Simpsonaias ambigua is endemic to North America, where it is found within the Great Lakes drainage, the upper Mississippi River drainage, and as far south as the Cumberland River drainage of Tennessee [4]; however, it is considered critically imperiled, imperiled, or extirpated across most of its range [5,6,7]. This species is listed as globally vulnerable by the IUCN [6], as endangered under the Species at Risk Act (SARA) in Canada [8], and is a candidate to be evaluated under the Endangered Species Act in the U.S. [9].
Simpsonaias ambigua has always been considered rare within Canada, since it was first collected in 1965 [10]. In 2017, at the onset of this project, Fisheries and Oceans Canada’s Lower Great Lakes Unionid Database (LGLUD) included over 20,000 collection records covering more than 130 years of sampling yet contained only 30 records representing 59 live individuals of S. ambigua. Recent survey efforts since the species was first assessed by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC) in 2001 [2] are responsible for nearly two-thirds of these live S. ambigua records (37 of 59). Historical collections (i.e., before the year 2001) of S. ambigua (shells or live individuals) are limited to the Sydenham River [11,12], the Detroit River [4], the St. Clair River delta, and the Thames River [12]. Recent collections (2001–2021) have been limited to the East Branch of the Sydenham River (live animals) [10]. More recently, three weathered valves were collected from a single site in the lower Grand River, one in 2019 [10] and two in 2020 [13], and one weathered valve in Bear Creek (north branch of the Sydenham River; St. Clair Region Conservation Authority, unpubl. data). These additional shells suggest that the species’ distribution may have been larger at one time, but it is now considered restricted to just the East Branch of the Sydenham River in the Lake St. Clair watershed.
The paucity of records for S. ambigua in Canada may accurately represent the current status and distribution of the species, or it may be an artifact of current and historical survey efforts targeting habitat not reflective of the unique habitat preferences of S. ambigua. As these more often sampled habitat areas (e.g., riffles and areas with gravel/cobble substrates) do not represent ideal habitat for S. ambigua or its host, effort concentrated in these areas fails to address knowledge gaps in the status and distribution of S. ambigua. As a result, despite the large effort that has taken place to survey freshwater mussels in Ontario, detailed knowledge of S. ambigua population densities, age structure, and current distribution is lacking [12,14,15].
The overall goal of this study was to obtain baseline data on the current distribution, abundance, and life history traits of S. ambigua in Ontario, Canada. Conventional survey methods were adapted to target S. ambigua. An additional method was tested to detect this species: trapping N. maculosus and inspecting for signs of encysted glochidia. Furthermore, life history traits, including reproductive timing of gonad and glochidia development, host infestation period, and longevity, were investigated for the species. These data are critical for future recovery efforts to restore or augment populations of S. ambigua across North America.

2. Materials and Methods

2.1. Surveys

The conventional survey method employed here, called “rock-flipping” is described in detail in Porto-Hannes et al. [16]. The rock-flipping method consisted of lifting flat rocks (>50 cm long) to find live mussels for an initial search time of 1.5 person-hours. If S. ambigua was found alive during the initial 1.5 person-hours, the search time was doubled to 3 person-hours. Surveys were conducted by wading throughout a site and searching for large flat rocks or other potentially suitable habitat such as bank undercuts or underneath sunken trees. When a flat rock was located, two D-rim (30 cm) nets (500 µm mesh size, Hoskin Scientific) were placed at the downstream end of the rock to catch any mussels that became dislodged while lifting the rock or during the search. The rock was raised from one side, and the substrate under the rock was collected by hand and placed in a mesh sieve (7 mm mesh size). The substrate was searched thoroughly to locate any live S. ambigua or shells. Live S. ambigua were placed in buckets with river water in cool shaded areas until processing.
Rock-flipping surveys were conducted in the summers of 2018 to 2020 in four rivers in southwestern Ontario (Figure 1 and Figure 2, Table 1). During the 2018 survey, the method was applied at sites where S. ambigua was known to occur in the East Sydenham River, Ontario, Canada, with the purpose of refining the methodology in areas of known occurrence prior to applying it in areas where detection was less likely (Figure 1a). This involved sampling six sites (with one site sampled four times), with search times varying based on the number of people searching.
In 2019, surveys occurred at locations within the suspected 76 river km occupied reach of the East Sydenham River (Figure 1b,c) but where no previous sampling had been conducted. This stretch was divided into 20 segments (each 2–4 km in length depending on access to the river) (Figure 1b). Each segment was canoed, and when suitable S. ambigua habitat was found (e.g., areas of large, flat rocks), the rock-flipping survey method was conducted. Sites surveyed in 2018 were not resampled in 2019.
The goal of the 2020 sampling was to survey sites with historical records in southwestern Ontario beyond the East Sydenham River (Bear Creek, Thames River, and Grand River, Figure 2). The focus of these surveys was to sample rivers at sites where spent shells of S. ambigua had been found but where live animals had never been collected. This included one site in the Thames River, one site in the Grand River, and three sites in Bear Creek (Figure 2). At Bear Creek two historical records exist (Figure 2); however, we sampled an additional site between these records where habitat was presumed suitable.
Throughout all surveys, live animals were sexed when possible, photographed, and a non-lethal mantle swabs (Adecco LLC 400 PCS Micro Applicator Brushes) were taken following [17]; swabs were stored in lysis buffer for future genetic analysis. Live individuals were enumerated, and shell length (maximum anterior–posterior) was measured to the nearest millimeter using vernier calipers. Individuals were returned to their exact location in the riverbed where they were found. Spent shells were also counted, measured, and kept for ageing purposes (see Ageing).

2.2. Life History Characterization

2.2.1. Ageing

All S. ambigua spent shells were aged by thin sectioning the shells and counting internal yearly growth lines (annuli) using a multiple-observer method [18]. Additionally, spent shells from eight hatchery-raised individuals younger than 1 year old (provided by M. Bradley, Genoa National Fish Hatchery, US Fish and Wildlife Service) were also aged to use as a comparison given their exact ages were known. Shells were prepared following a Fisheries and Oceans standard operating protocol for ageing mussel shells, which was developed using [18,19,20] as well as input from various experts in the field. Simpsonaias ambigua shells are very thin and fragile; therefore, the entire valve was set in epoxy resin (Buehler EpoThin™ 2 Epoxy Resin and Hardener) before cutting. To determine which cut provides the best visualization of annuli, two cuts, one through the umbo to the posterior-ventral margin (“length-cut”) and one through the umbo straight down to the ventral portion of the shell (“height-wise”), were made using a Buehler IsoMet® 4000 Linear Precision Saw (Figure 3a). Following sectioning, one half of the shell was mounted on a microscope slide using LePage® Two-Part Epoxy Gel and left to set for at least 24 h. A second cut was made using a Buehler IsoMet® Glass Slide Chuck to create a thin section of shell. All cut surfaces were wet-sanded from coarser to finer grit using 3M™ Wetordry™ Sandpaper (600 grit, 1200 grit, and 2000 grit, respectively) throughout thin section preparation to remove saw markings for clear visualization of annuli. Using a compound microscope, each thin section was viewed and interpreted by at least two and up to four individuals. True annuli start at the umbo and are traceable to the margin of the shell [18,20], and each annulus corresponds to one year (Figure 3b). In S. ambigua, the annuli compress (merge together) along the shell axis, making them indistinguishable from each other; therefore, only annuli that were observed at the umbo and then again through the prismatic layer were counted (Figure 3b). Despite the use of multiple agers, recuts, and recounts, there were times when an age consensus could not be reached, and these shells were not included in the analysis.
Using shell length and internal annuli counts as age, a von Bertalanffy growth curve (VBGF) was created [21,22] in RStudio 2021.09.0.351 [23]:
L t = L 1 e k t
where Lt is length at age t, L is asymptotic length, and k is the growth coefficient. All individuals younger than 1 year (i.e., no annuli) were assigned to be 0.5 years of age to denote that they are younger than 1 year, but not zero. Therefore, to be mathematically consistent, 0.5 was added to all ages during VGBF development. To estimate age at maturity Tmat, a method developed by Haag [21] was used using the VBGF coefficient k, written as follows:
T m a t = 0.69 k 1.031 1

2.2.2. Reproductive Biology

To assess gamete and glochidial development in S. ambigua, gonad and marsupial gill samples were collected every 3–4 weeks (depending on water level conditions) from July through October in both 2018 and 2019 until glochidia were observed (Table 2). To collect gonad samples, methods from Galbraith and Vaughn [24] were used. A 5 mL syringe with a 22-gauge needle was inserted into the gonad, and a very small amount of fluid from the gonad (~0.25 mL or less) was collected. If S. ambigua marsupial gills were visibly swollen, they were inspected for glochidia development by collecting samples from the water tubes. A 5 mL syringe with a 22-gauge needle was filled with water and carefully inserted into a water tube. The water in the syringe was flushed through the tube, and the contents were collected in a small Whirl-Pak® (Nasco). All gonad and marsupial gill samples were placed in a cooler with ice until processing, which occurred within 24 h from collection. At the laboratory, the fresh samples were placed on individual microscope slides and observed under a compound microscope. Pictures were taken using an eyepiece microscope camera (5MP USB 2.0 Color CMOS Digital Eyepiece Microscope Camera, AmScope™, Irvine, CA, USA).

2.2.3. Mudpuppy (Host) Capture

To determine the timing of glochidia encystment on the host, N. maculosus capture was conducted using modified funnel-type minnow traps [25,26,27,28], where the two openings of the trap were widened to 6.0 cm to allow the entry of adult N. maculosus [25,27]. Trapping was conducted at one site on the East Sydenham River once per month between October 2018 and March 2019 (except for the month of February; see results). Forty traps spaced at 5 m intervals were placed for one night per site, unless there were no captured N. maculosus; then the traps were placed for one to two additional nights (depending on conditions) until N. maculosus was trapped. Traps were completely submerged under water, secured to the shoreline with a metal cable or rope, and baited with store-bought sardines, smelt, or cat food [25,27]. The traps were installed at sunset and lifted early in the morning the following day (12 to 16 h sets), minimizing the time the animals spend in the traps to reduce stress, injury, or potential cannibalism [27].
Captured N. maculosus were handled according to the Canadian Council for Animal Care (CCAC) [29] species-specific recommendations on amphibians and reptiles. The animals were restrained with an open flat hand applying even pressure over the animal’s entire body, ensuring that no pressure was applied to the tail. Trapped N. maculosus were placed in plastic containers filled with fresh river water and visually inspected for signs of glochidial infestation in the gills, the ventral edge of the tail, and in between the toes. Furthermore, the sex and total length (snout–vent length) of all individuals were recorded, and photographs were taken. Inspection of N. maculosus was carried out by a two-person team to minimize the handling time.
To confirm that the glochidia-like structures on the gills of N. maculosus were S. ambigua glochidia, gill filaments were clipped and genetically barcoded using S. ambigua-specific primers [30]. Two sites were chosen for this purpose in March of 2020. To safely collect glochidia observed on N. maculosus gill filaments, individuals caught were anesthetized by submersion in a mild solution (0.25 g/L, 0.025%) of MS-222 (Tricaine methane-sulfonate). This dose of MS-222 is recommended when water temperatures range between 0 and 6 °C [27], which is the water temperature at which the trapping and handling of the N. maculosus occurred. This dose was successfully used by Gendron et al. [27] and McDaniel et al. [25] to anesthetize N. maculosus with no subsequent mortality. Upon anesthetization, a small clip of the gill filament that contained the glochidia-like structure was removed. Gill clips were placed in 1 mL polypropylene tubes with 95% denatured ethanol. All filament gill clips were observed under the microscope and photographed using AmScope. A detailed step-by-step protocol of N. maculosus trapping, anesthesia, and gill filament clipping can be found in Porto-Hannes et al. [16].
DNA was extracted from a subset of gill clips containing glochidia using the Qiagen DNeasy Blood and Tissue extraction kit (Qiagen, Valencia, CA, USA) following manufacturer’s protocol. Simpsonaias ambigua NADH dehydrogenase (ND1) species-specific primers previously developed for eDNA detection were used for barcoding. The primer set included SamND1_Fwd 5′ACTAGGGCTTAGTGGCATTCC, SamND1_Rvs 5′AGGGCGAGTATAGTTATTGGGG, and SamND1_probe 5′-AACCCGCAGCAGACGCCTTG. ND1 mitochondrial gene was amplified via a quantitative polymerase chain reaction (qPCR) in a 20 μL reaction containing the following concentrations: 2 ng/µ of genomic DNA, 1X TaqMan™ Environmental Master Mix 2.0 (Applied Biosystems™, Foster City, CA, USA), 0.9 μM of each primer, and 0.25 μM of Probe with a ZEN/Iowa Black FQ quencher (IDT, Coralville, IA, USA). The amplification conditions were as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s and annealing at 60 °C for 1 min. A standard curve was constructed using gBlock gene fragments (IDT, Coralville, IA, USA) developed using S. ambigua sequences. Standard curves consisted of 1:10 serial dilutions of the gBlock oligo from 1 to 1 × 107 copies per reaction. Confirmation of S. ambigua DNA was determined when amplification was below the threshold (Cq ≤ 38).

3. Results

3.1. Surveys

A total of 34 live S. ambigua individuals were found at four of the six sites surveyed in 2018 during the development of the rock-flipping method in the East Sydenham River (82.5 total person-hours effort) (Figure 1a, Table 1). Total live abundance in a single survey ranged from zero (SR-01 and SR-06) to seven (SR-05) individuals. One site was surveyed four times with 18 live S. ambigua found during 20.7 person hours of searching. Shells/valves of S. ambigua were observed at one site (SR-06) where no live individuals were found. LSC-SYR-29 was surveyed for the first time in 2018, and 10 live individuals and 39 spent shells/valves were found.
Surveys in 2019 were completed at 13 sites, which were distributed across 10 of the 20 segments (Figure 1b,c). Three segments had more than one area with suitable S. ambigua habitat; therefore, two surveys were completed within each segment. A total of 10 segments were not surveyed due to high water levels at the time of the survey, obstruction by impassable log jams, or water depth greater than 1 m even at low flows. A total of 17 live S. ambigua were found during the 2019 surveys in the East Sydenham River (Figure 1c, Table 1). Total live abundance in a single survey ranged from zero to eight individuals (LSC-SYR-35, Table 1). Only one shell/valve was found at a site where no live S. ambigua was found (LSC-SYR-32, Table 1). This site is 1 km upstream of the Town of Alvinston, where a single gravid female was found (LSC-SYR-33, Table 1), and it represents the most upstream record of the species in the East Sydenham River. In 2019, we surveyed 100 m downstream of LSC-SYR-29 and found another eight live mussels (LSC-SYR-35, Table 1). The reach from LSC-SYR-29 to SR-07 (Figure 1a) is where the greatest number of live S. ambigua have been found. Additionally, sites LSC-SYR-33, LSC-SYR-36, and LSC-SYR-39 (Table 1) surveyed in 2019 also represent new record locations of live mussels.
A total of five sites were surveyed in 2020 in waterbodies where spent shells of S. ambigua have been found. These included one site in the Thames River, one site in the Grand River, and three sites in Bear Creek. No live S. ambigua or spent shells were found at any of these sites using the rock-flipping method.

3.2. Life History Characterization

3.2.1. Ageing

A total of 133 spent shells were cut for ageing purposes. Of the 133 spent shells, an age consensus was reached for 72 individuals; the maximum number of annuli counted and agreed upon was 8. Shell length varied from 12 mm to 49.19 mm, and size per age group varied from up to ~16 mm (age 3) (Figure 4). However, there were four individuals (lengths: 43–50.41 mm) where annuli count varied from 6 to 8 years, and these were recut and recounted. The consensus age for three of these (sizes: 43–45 mm) was estimated to be five. However, a consensus age was not reached for the remaining shell (length: 50.41 mm), aside from agreement that >6 annuli were counted.

3.2.2. Reproductive Biology

A total of 39 individuals across four sites were examined for gametes and glochidia in July through October in both 2018 and 2019. Gametes were observed in gonad samples starting in July (Table 2). Eggs were observed in marsupial gill water tubes in August through October. Fully developed glochidia were observed in September and October (Table 2) in six individuals. Using the k value (0.59809) from the VBGF [21], an age of maturity was calculated to be 0.172, suggesting that S. ambigua become mature early within their first year of life.

3.2.3. Mudpuppy (Host) Capture

No N. maculosus were found during the manual surveys (while searching for S. ambigua) at any site during the months of July and August in 2018. During winter 2018–2019, a total of three N. maculosus were trapped at SR-05, two in November 2018 and one in March 2019. In January 2019, the traps filled with frazil ice which covered the entrance; therefore, no trapping occurred in February 2019, when water temperatures remained at 0 °C. In March, when the water temperature was 2–3 °C, trapping resumed. Trapped N. maculosus were visually inspected for signs of encysted glochidia by non-invasive procedures, and glochidia-like structures were observed in the gills of two N. maculosus (Figure 5a,b).
During the March 2020 trapping event, four N. maculosus were collected at LSC-SYR-29, while none were found at SR-05. All animals were anesthetized and visually inspected. Glochidia-like structures were observed in all animals. Given the small size of gill filaments, the limited amount of time to clip the filaments, and the medium (submerged in water), the number of clipped filaments varied among individuals. Glochidia found on the gills (Figure 5c,d) were confirmed to be S. ambigua via DNA barcoding. No mortality or injuries were observed during the trapping or handling of captured N. maculosus. After inspection and anesthesia, all N. maculosus individuals recovered well and were carefully returned to the river at the location where they were captured.
Due to travel restrictions due to SARS-COVID-19, N. maculosus trapping did not occur at other sites in the East Sydenham River or in any other waterbodies as originally planned (e.g., Bear Creek, Thames River, and Grand River).

4. Discussion

4.1. Surveys

Conventional survey methods were used to develop a rock-flipping method targeting S. ambigua’s preferred habitat. The method was then employed at locations where live and/or spent shells have been reported to obtain data on the current distribution of this species in Ontario, Canada. The surveys conducted in 2018 and 2019 in the East Sydenham River confirmed the presence of a reproducing population of S. ambigua along a 76 km stretch of the river. The detection of a gravid female at the most upstream site (LSC-SYR-33) suggests that the distribution likely extends further upstream than we have been able to determine. The area where the majority of S. ambigua were found covered a ~12 km stretch starting at site LSC-SYR-29 and extending downstream to SR-05. As expected, Necturus maculosus were also successfully trapped at these sites. Despite these positive results, the instream and riparian habitat in some upstream sites (e.g., LSC-SYR-33) was highly degraded, presumably due to high deforestation of riparian forest and the presence of cattle farms.
Although the results of this study show that S. ambigua persists in the Sydenham River, there have been no formal quantitative surveys to determine if this population is declining, stable, or expanding. Despite anecdotal records reporting previous large (15–20 live individuals under a single rock) collections (Morris, T. pers. observ.) in this river, the smaller number of live individuals found in our study is in accordance with other targeted survey results of this species across its geographic range [3,31]. The rock-flipping method employed here is qualitative; however, a semi-quantitative approach could be adopted by spatially bounding the area in which the rock-flipping is conducted. The use of quadrats is highly discouraged given the clustered and low-density distribution of this species [32]. Qualitative searches, such as those employed in this study, are appropriate when investigating an area for the first time for the presence of S. ambigua; however, quantitative are required for estimates of density and monitoring.
Rock-flipping surveys were conducted at sites with records of S. ambigua outside the East Sydenham River (Bear Creek, Thames River, and Grand River); unfortunately, no live S. ambigua were collected at any of these rivers. The habitat in Bear Creek was deemed not suitable for S. ambigua as the substrate was predominantly soft sediments (e.g., silt and mud), and no large rocks were found. The spent shells found at the two locations in Bear Creek in 1999 and 2017 may be relics of a population that no longer exists. Upstream of the record sites, there is a reservoir that was built in 1971 (St. Clair Region Conservation Authority pers. comm., 2020) that may have modified river flow and as a result changed the habitat. There is no mussel survey data prior to the construction of the reservoir; therefore, no direct relationship can be established. In the Thames River, only a single record of a spent shell of S. ambigua exists from 1998. This species was not observed at any of the other 15 sites surveyed within the watershed, either during this period [15,33] or in recent years [34,35,36,37]. Although there has been a fair amount of work conducted in the Grand River over the past three decades [34,35,38,39,40], evidence of S. ambigua had not been observed in the system until 2019. In 2019, a single weathered valve was found during a 4.5 person hour timed-search (DFO unpubl. data) and in 2020, two weathered valves were found during an extensive quadrat-based mussel relocation survey [13] ~350 m downstream of the 2019 valve. Given the recent detection of shells in this system, it is recommended to deploy a broader sampling collection across the entire Grand River using the survey methods described here or eDNA [30].
An alternative method to determine the presence or distribution of S. ambigua is to trap its host and look for signs of glochidial infestation. In this study, N. maculosus were trapped at two locations where S. ambigua is considered abundant in the Sydenham River; however, trapping success and glochidial infestation at SR-05 were very low in contrast with LSC-SYR-29. This is likely due to the fact that there was more suitable habitat (e.g., large, flat stones) at LSC-SYR-29. Necturus maculosus is common in the Sydenham River [25] and in other parts of the Great Lakes [41]; however, current evidence suggests some populations are declining, particularly in the Midwest and Northeast of the United States [42,43]. Trapping of the host species is particularly useful when the population of N. maculosus has a high density and when water visibility or depth are limiting factors. Even though trapping has shown year-round success in deep rivers or lakes (reviewed by [44]), there are limitations when trapping in shallow, small-medium rivers, such as the Sydenham River. The results of this study suggest that trapping is most successful when water temperature is between 0 °C and 5 °C, as below −0 °C weather causes ice to accumulate inside the minnow traps, which covers the entrance to the bait.

4.2. Life History Characterization

One of our study goals was to fill in knowledge gaps associated with aspects of S. ambigua life history with the hope that these will guide future conservation and recovery efforts. Prior to this study, gravid S. ambigua had not been observed in Canada [8]; however, Barnhart et al. [45] observed a single gravid female and an infested N. maculosus in April in the Meramec River in Missouri and observed that at 20 °C, metamorphosis and drop-off occurred between 19 and 28 days post infestation. Conversely, in this study, gravid females were found in July through October, suggesting that reproductive timing likely varies depending on environmental conditions. The gills of gravid females were not visually very swollen compared to Simpson’s [46] description: “Brood pouch filling the entire outer gills and forming enormously thickened pads”. Eggs and sperm were observed in the gonads mostly in July and August. Glochidia were found in the marsupial gills in September and October. Unfortunately, no reproductive sampling occurred after October, when air temperatures drop, which poses increased freezing danger to mussels if exposed to air. Laboratory experiments mimicking natural water temperatures to track egg and glochidial development through the winter and spring should be conducted to determine the onset of gamete and glochidial development.
Howard [1] suggested that the S. ambigua glochidia overwinter on their host, as glochidia were observed on N. maculosus in October. In this study, infested N. maculosus were found in October and in March, suggesting overwintering of the glochidia on the host may be occurring; however, overwintering of the glochidia in the female cannot be discounted, as gravid females have also been collected in the spring (M. Bradley pers. comm. 2019).
To the author’s knowledge, this is the first study to age S. ambigua, and we found that they are relatively short-lived with a maximum observed age of eight. Young individuals (<1 year) grow rapidly with up to ~30 mm in length accumulated during the first year, which corresponds to more than half of the observed maximum length. Reproductive maturity was estimated to occur at less than one year of age using Haag’s [21] relationship with k, and we detected eggs and sperm in the gonads of animals between 1 and 4 years of age, confirming that maturity occurs early in this species.
The results of the life history investigation in this study support Haag’s [21] suggestion that the genus Simpsonaias does have characteristics that indicate a periodic life history strategy. This species is small, appears to have a short lifespan (estimated at eight in this study, although it is possible that the ages found here do not represent the maximum life span), and has an early age of maturity (estimated at <1 in this study).

5. Conclusions

In this study, conventional survey methods were adapted to target S. ambigua, and an additional method was tested to detect this species: trapping N. maculosus and inspecting for signs of encysted glochidia. Both methods used were successful at detecting S. ambigua when they were present. Furthermore, S. ambigua’s life history traits were investigated, and more information is now available on the reproductive timing windows related to gonad and glochidia development, and host infestation period, as well as on longevity. These data are critical for future recovery efforts to restore or augment populations of S. ambigua in North America.

Author Contributions

Conceptualization, I.P.-H. and T.J.M.; methodology, I.P.-H., K.A.M.-O. and M.P.G.; formal analysis, I.P.-H., K.A.M.-O. and M.P.G.; writing—original draft preparation, I.P.-H. and T.J.M.; writing—review and editing, I.P.-H., K.A.M.-O., M.G. and T.J.M.; supervision, T.J.M.; funding acquisition, T.J.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Fisheries and Oceans Canada, Species at Risk Program.

Institutional Review Board Statement

The study was conducted in accordance with the Canada Animal Care Committee (ACC) Standard Operating Procedure (SOP)-1975, approved on 2020, and the Animal Care Committee (ACC) Standard Operating Procedure (SOP)-10, approved on 2002.

Data Availability Statement

Data are available upon request.

Acknowledgments

Margaret Gougen (Fisheries and Oceans Canada) provided invaluable support in the field and the laboratory. Tana McDaniel and Glenn Barrett (Environment and Climate Change Canada) provided meaningful insight for trapping Mudpuppies in the winter, and Adam Haines (Buffalo State College) captured Mudpuppies in the summer. Megan Bradley (Genoa National Fish Hatchery, US Fish and Wildlife Service) provided guidance on how to visualize and identify encysted glochidia. We would like to thank Fisheries and Oceans Canada’s Victoria Tousaw, Emily Robson, Maria Dolan, Brooklyn Foucault, Kali Zammit, and Samuel Turner for their support in the field, as well as Adam van der Lee for the VBGF R code. Additionally, the authors would like to thank the St. Clair Region Conservation Authority staff, especially Erin Carroll and Emily De Cloet, for the assistance with planning for the S. ambigua surveys. We would like to thank the three anonymous reviewers for their meaningful contributions to improving this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
CCACCanadian Council for Animal Care
COSEWICCommittee on the Status of Endangered Wildlife in Canada
DFODepartment of Fisheries and Oceans
eDNAenvironmental DNA
LGLUDLower Great Lakes Unionid Database
VGBFvon Bertalanffy growth curve
qPCRquantitative polymerase chain reaction

References

  1. Howard, A.D. Some exceptional cases of breeding among the Unionidae. Nautilus 1915, 29, 4–11. [Google Scholar]
  2. Watson, E.; Metcalfe-Smith, J.; Di Maio, J. COSEWIC Status Report on the Mudpuppy Mussel Simpsonaias ambigua; Committee on the Status of Endangered Wildlife in Canada: Ottawa, ON, Canada, 2001; pp. 1–45. [Google Scholar]
  3. Bogan, A.; Locy, D. Current distribution of the Salamander Mussel, Simpsonaias ambigua (Say, 1825). Pennsylvania. Ellipsaira 2009, 11, 11–12. [Google Scholar]
  4. Clarke, A.H. The Tribe Alasmidontini (Unionidae: Anodontinae), Part II: Lasmigona and Simpsonaias; Smithsonian Institution Press: Washington, DC, USA, 1985; Volume 399, p. 75. [Google Scholar]
  5. Roe, K.J. Conservation Assessment for the Salamander Mussel (Simpsonaias ambigua) Say, 1825; USDA Forest Service, Eastern Region: St. Louis, MO, USA, 2003.
  6. Bogan, A.E.; Woolnough, D.A.; Seddon, M.B. Simpsonaias ambigua. In The IUCN Red List of Threatened Species 2017: e.T20247A62905797; IUCN: Grand, Switzerland, 2017. [Google Scholar] [CrossRef]
  7. NatureServe. NatureServe Network Biodiversity Location Data. NatureServe, Arlington, Virginia. Available online: https://explorer.natureserve.org/Taxon/ELEMENT_GLOBAL.2.114652/Simpsonaias_ambigua (accessed on 9 January 2025).
  8. Morris, T.J.; Burridge, M. Recovery Strategy for Northern Riffleshell, Snuffbox, Round Pigtoe, Salamander Mussel and Rayed Bean in Canada; Fisheries and Oceans Canada: Ottawa, ON, Canada, 2006; X + 76p. [Google Scholar]
  9. U.S. Fish and Wildlife Service (USFWS). National Listing Workplan. Available online: https://www.fws.gov/project/national-listing-workplan (accessed on 9 January 2025).
  10. Lower Great Lakes Unionid Database (LGLUD). Lower Great Lakes Unionid Database; Fisheries and Oceans Canada, Great Lakes Laboratory for Fisheries and Aquatic Sciences (GLFAS): Burlington, ON, Canada, 2025. [Google Scholar]
  11. Clarke, A.H. The Tribe Alasmidontini (Unionidae: Anodontinae), Part I: Pegias, Alasmidonta, and Arcidens; Smithsonian Institution Press: Washington, DC, USA, 1981; Volume 326, p. 101. [Google Scholar]
  12. Metcalfe-Smith, J.; Staton, S.; Mackie, G.; West, E. Assessment of the Current Conservation Status of Rare Species of Freshwater Mussels in Southern Ontario; NWRI Contribution; National Water Research Institute: Burlington, ON, Canada, 1998. [Google Scholar]
  13. Natural Resource Solutions Inc. Argyle Street Bridge, Grand River, Caledonia. Mussel Species at Risk Summary Report Permitting Report. Prepared for Ministry of Transportation Ontario and Dufferin Construction Company; Natural Resource Solutions Inc.: Waterloo, ON, Canada, 2021; p. 368. [Google Scholar]
  14. Committee on the Status of Endangered Wildlife in Canada (COSEWIC). COSEWIC Status Appraisal Summary on the Salamander Mussel Simpsonaias ambigua in Canada; COSEWIC: Ottawa, ON, Canada, 2011; p. 15. [Google Scholar]
  15. Metcalfe-Smith, J.L.; Staton, S.K.; Mackie, G.L.; Scott, I.M. Range, Population Stability and Environmental Requirements of Rare Species of Freshwater Mussels in Southern Ontario; National Water Research Institute Contribution: Burlington, ON, Canada, 1999. [Google Scholar]
  16. Porto-Hannes, I.; McNichols-O’Rourke, K.; Goguen, M.; Fang, M.; Morris, T.J. Sampling Protocol for the Freshwater Mussel Simpsonaias ambigua (Salamander Mussel) in Canada; Canadian Technical Report of Fisheries and Aquatic Sciences 3411; Fisheries and Oceans Canada: Ottawa, ON, Canada, 2021; vii + 60p. [Google Scholar]
  17. Henley, W.F.; Grobler, P.J.; Neves, R.J. Non-invasive method to obtain DNA from freshwater mussels (Bivalvia: Unionidae). J. Shellfish Res. 2006, 25, 975–977. [Google Scholar]
  18. Neves, R.J.; Moyer, S.N. Evaluation of techniques for age determination of freshwater mussels (Unionidae). Am. Malacol. Bull. 1988, 6, 179–188. [Google Scholar]
  19. Veinott, G.I.; Cornett, R.J. Identification of annually produced opaque bands in the shell of the freshwater mussel Elliptio complanata using the seasonal cycle of δ18 O. Can. J. Fish. Aquat. Sci. 1996, 53, 372–379. [Google Scholar] [CrossRef]
  20. Haag, W.R.; Commens-Carson, A.M. Testing the assumption of annual shell ring deposition in freshwater mussels. Can. J. Fish. Aquat. Sci. 2008, 65, 493–508. [Google Scholar] [CrossRef]
  21. Haag, W.R. North American Freshwater Mussels: Natural History, Ecology, and Conservation; Cambridge University Press: New York, NY, USA, 2012; p. 505. [Google Scholar]
  22. van der Lee, A.S.; Goguen, M.N.; McNichols-O’Rourke, K.A.; Morris, T.J.; Koops, M.A. Evaluating the Status and Population Biology of an Imperiled Freshwater Mussel, Purple Wartyback Cyclonaias tuberculata, in Southern Ontario, Canada. Freshw. Mollusk Biol. Conserv. 2024, 27, 27–38. [Google Scholar] [CrossRef]
  23. RStudio Team. RStudio: Integrated Development Environment for R; RStudio, PBC: Boston, MA, USA, 2021. [Google Scholar]
  24. Galbraith, H.S.; Vaughn, C.C. Temperature and food interact to influence gamete development in freshwater mussels. Hydrobiologia 2009, 636, 35–47. [Google Scholar] [CrossRef]
  25. McDaniel, T.V.; Martin, P.A.; Barrett, G.C.; Hughes, K.; Gendron, A.D.; Shirose, L.; Bishop, C.A. Relative abundance, age structure, and body size in mudpuppy populations in southwestern Ontario. J. Great Lakes Res. 2009, 35, 182–189. [Google Scholar] [CrossRef]
  26. Gendron, A. Status Report on the Mudpuppy, Necturus maculosus; Prepared for the Committee on the Status of Endangered Wildlife in Canada: Ottawa, ON, Canada, 1999. [Google Scholar]
  27. Gendron, A.D.; Bishop, C.A.; Fortin, R.; Hontela, A. In vivo testing of the functional integrity of the corticosterone-producing axis in Mudpuppy (Amphibia) exposed to chlorinated hydrocarbons in the wild. Environ. Toxicol. Chem. 1997, 16, 1694–1706. [Google Scholar] [CrossRef]
  28. Chellman, I.C.; Parrish, D.L.; Donovan, T.M. Estimating Mudpuppy (Necturus maculosus) abundance in the Lamoille River, Vermont, USA. Herpetol. Conserv. Biol. 2017, 12, 422–434. [Google Scholar]
  29. Canadian Council for Animal Care (CCAC). Species-Specific Recommendations on: Amphibians and Reptiles; Canadian Council for Animal Care (CCAC): Ottawa, ON, Canada, 2021; Available online: https://ccac.ca/Documents/Standards/Guidelines/CCAC_Guidelines-Amphibians.pdf (accessed on 12 February 2025).
  30. Porto-Hannes, I.; Sassoubre, L.M.; Sansom, B.J.; Morris, T.J. Applying Environmental DNA methods to inform detection of Simpsonaias ambigua under varying water velocities in a river. Freshw. Mollusk Biol. Conserv. 2023, 26, 54–68. [Google Scholar] [CrossRef]
  31. Womble, K.I.; Dinkins, G.R.; Alford, J.B.; Harris, M.H. New Species Distribution Record for Simpsonaias ambigua (Say)(Salamander Mussel, Bivalvia: Unionidae) in the Harpeth River, Tennessee. Southeast. Nat. 2020, 19, N24. [Google Scholar] [CrossRef]
  32. Reid, S.M.; Morris, T.J. Tracking the Recovery of Freshwater Mussel Diversity in Ontario Rivers: Evaluation of a Quadrat-Based Monitoring Protocol. Diversity 2017, 9, 5. [Google Scholar] [CrossRef]
  33. Metcalfe-Smith, J.L.; Staton, S.K.; Mackie, G.L.; Lane, N.M. Changes in the biodiversity of freshwater mussels in the Canadian waters of the lower Great Lakes drainage basin over the past 140 years. J. Great Lakes Res. 1998, 24, 854. [Google Scholar] [CrossRef]
  34. Sheldon, M.N.; McNichols-O’Rourke, K.A.; Morris, T.J. Summary of Initial Surveys at Index Stations for Long-Term Monitoring of Freshwater Mussels in Southwestern Ontario Between 2007 and 2018; Canadian Manuscript Report of Fisheries and Aquatic Sciences 3203; Fisheries and Oceans Canada: Burlington, ON, Canada, 2020; vii + 85p. [Google Scholar]
  35. Goguen, M.N.; McNichols-O’Rourke, K.A.; Morris, T.J. Freshwater Mussel Timed-Search Surveys at Historically Sampled Sites in the Grand River and Thames River Watersheds, Ontario, 2021; Canadian Data Report of Fisheries and Aquatic Sciences 1352; Fisheries and Oceans Canada: Burlington, ON, Canada, 2023; v + 23p. [Google Scholar]
  36. Gibson, M.P.; McNichols-O’Rourke, K.A.; Morris, T.J. Targeted Sampling of Toxolasma parvum (Lilliput) in Southwestern Ontario, 2022; Canadian Data Report of Fisheries and Aquatic Sciences 1362; Fisheries and Oceans Canada: Burlington, ON, Canada, 2023; vi + 29p. [Google Scholar]
  37. McNichols-O’Rourke, K.A.; Goguen, M.; Wright, K.; Morris, T.J. Thames River Monitoring-The good, the bad and the TBD. In Proceedings of the 2021 Canadian Freshwater Mollusc Research Meeting, Virtually, 7–8 December 2021. [Google Scholar]
  38. Metcalfe-Smith, J.L.; Mackie, G.L.; Di Maio, J.; Staton, S.K. Changes Over Time in the Diversity and Distribution of Freshwater Mussels (Unionidae) in the Grand River, Southwestern Ontario. J. Great Lakes Res. 2000, 26, 445–459. [Google Scholar] [CrossRef]
  39. Mackie, G.L. Diversity and Status of Unionidae (Bivalvia) in the Grand River, a Tributary of Lake Erie and Its Drainage Basin; Prepared for the Ministry of Natural Resources Land and Natural Heritage Branch: Ottawa, ON, Canada, 1996; p. 39. [Google Scholar]
  40. McNichols-O’Rourke, K.A.; Robinson, A.; Morris, T.J. Summary of Freshwater Mussel Timed Search Surveys in Southwestern Ontario in 2010 and 2011; Canadian Manuscript Report of Fisheries and Aquatic Sciences 3009; Fisheries and Oceans Canada: Burlington, ON, Canada, 2012; vi + 42p. [Google Scholar]
  41. Eycleshymer, A.C. The habits of Necturus maculosus. Am. Nat. 1906, 40, 123–136. [Google Scholar] [CrossRef][Green Version]
  42. King, R.B.; Oldham, M.J.; Weller, W.F.; Wynn, D. Historic and current amphibian and reptile distributions in the island region of western Lake Erie. Am. Midl. Nat. 1997, 138, 153–173. [Google Scholar] [CrossRef]
  43. Harding, J.H.; Mifsud, D.A. Amphibians and Reptiles of the Great Lakes Region; University of Michigan Press: Ann Arbor, MI, USA, 2017. [Google Scholar]
  44. Murphy, M.O.; Price, S.J.; Hime, P.M.; Drayer, A.N.; Weisrock, D.W. A review of Common Mudpuppy (Necturus maculosus) capture methods and description of a revised trap design. Herpetol. Rev. 2016, 47, 575–578. [Google Scholar]
  45. Barnhart, C.; Riusech, F.; Baird, M. Hosts of salamander mussel (Simpsonaias ambigua) and snuffbox (Epioblasma triquetra) from the Meramec River system, Missouri. Triannual Unionid Rep. 1998, 16, 34. [Google Scholar]
  46. Simpson, C.T. A Descriptive Catalogue of the Naiades or Pearly Fresh-Water Mussels; Bryant Walker: Detroit, MI, USA, 1914. [Google Scholar]
Figure 1. Simpsonaias ambigua survey sites in the East Sydenham River during 2018 (a) and 2019 (b,c). In 2019, a 76 km stretch of river was divided into 20 segments (black squares) (b); each segment was canoed, and if suitable S. ambigua habitat was found, the “rock-flipping” survey method was conducted at the site (c). Circles represent survey sites; live individuals were found at eight sites (green); no live mussels were found at six sites (white) across several years. For simplicity purposes, only names for sites with live mussels are shown in panel (c); however, detailed data are found in Table 1. In all maps, grey arrows indicate flow direction. The map was created in ArcGIS Desktop 10.8.2.
Figure 1. Simpsonaias ambigua survey sites in the East Sydenham River during 2018 (a) and 2019 (b,c). In 2019, a 76 km stretch of river was divided into 20 segments (black squares) (b); each segment was canoed, and if suitable S. ambigua habitat was found, the “rock-flipping” survey method was conducted at the site (c). Circles represent survey sites; live individuals were found at eight sites (green); no live mussels were found at six sites (white) across several years. For simplicity purposes, only names for sites with live mussels are shown in panel (c); however, detailed data are found in Table 1. In all maps, grey arrows indicate flow direction. The map was created in ArcGIS Desktop 10.8.2.
Diversity 17 00133 g001aDiversity 17 00133 g001b
Figure 2. Simpsonaias ambigua 2020 surveys using rock flipping (a) in Bear Creek (b), Thames River (c), and Grand River (d) where spent shell records (black stars) have been reported. The East Sydenham River was not surveyed in 2020 but is shown in the (a) panel for reference. In all maps, black arrows indicate flow direction. Detailed data are found in Table 1.
Figure 2. Simpsonaias ambigua 2020 surveys using rock flipping (a) in Bear Creek (b), Thames River (c), and Grand River (d) where spent shell records (black stars) have been reported. The East Sydenham River was not surveyed in 2020 but is shown in the (a) panel for reference. In all maps, black arrows indicate flow direction. Detailed data are found in Table 1.
Diversity 17 00133 g002
Figure 3. Simpsonaias ambigua shell cut length-cut and height-wise (a) and thin sections of the shells showing three annuli (b).
Figure 3. Simpsonaias ambigua shell cut length-cut and height-wise (a) and thin sections of the shells showing three annuli (b).
Diversity 17 00133 g003
Figure 4. The von Bertalanffy curve (VGBF) for Simpsonaias ambigua using 72 spent shells. Age (years) was estimated counting internal annuli from thin shell sections. All individuals younger than 1 year (i.e., no annuli) were assigned to be 0.5 years of age to denote that they are younger than 1 year, but not zero. To be mathematically consistent, 0.5 was added to all ages.
Figure 4. The von Bertalanffy curve (VGBF) for Simpsonaias ambigua using 72 spent shells. Age (years) was estimated counting internal annuli from thin shell sections. All individuals younger than 1 year (i.e., no annuli) were assigned to be 0.5 years of age to denote that they are younger than 1 year, but not zero. To be mathematically consistent, 0.5 was added to all ages.
Diversity 17 00133 g004
Figure 5. Signs of Simpsonaias ambigua glochidia encystment in Necturus maculosus gills (a,b) and gill filament gill clippings containing glochidia (c,d). Black arrows in panel (b) point at glochidia-like structures on N. maculosus gills.
Figure 5. Signs of Simpsonaias ambigua glochidia encystment in Necturus maculosus gills (a,b) and gill filament gill clippings containing glochidia (c,d). Black arrows in panel (b) point at glochidia-like structures on N. maculosus gills.
Diversity 17 00133 g005
Table 1. Simpsonaias ambigua sites were surveyed between 2018 and 2020 using the rock-flipping survey method in southwestern Ontario. Sites per waterbody arranged from upstream to downstream. Sites in bold are where S. ambigua were found (live or spent shells) for the first time. Site abbreviations follow Lower Great Lakes Unionid Database (LGLUD) nomenclature.
Table 1. Simpsonaias ambigua sites were surveyed between 2018 and 2020 using the rock-flipping survey method in southwestern Ontario. Sites per waterbody arranged from upstream to downstream. Sites in bold are where S. ambigua were found (live or spent shells) for the first time. Site abbreviations follow Lower Great Lakes Unionid Database (LGLUD) nomenclature.
WaterbodySiteLatitudeLongitudeYearTotal Live *Spent ShellsSampling Effort (Person-Hours)
East Sydenham RiverSR-0142.86063−81.788520180012
LSC-SYR-3042.84824−81.81112019000.8
LSC-SYR-3142.84598−81.84972019001
LSC-SYR-3242.82852−81.85292019010.8
LSC-SYR-3342.82113−81.85762019103
LSC-SYR-3442.71749−81.95272019000.8
LSC-SYR-2942.70531−81.98062018103912.2
LSC-SYR-3542.70445−81.98082019863
SR-0742.69836−81.98820185510
LSC-SYR-3642.69843−82.00332019203.2
SR-0542.65139−82.009120181810520.7
LSC-SYR-3742.64832−82.01222019001.5
LSC-SYR-3842.63157−82.02332019001.6
SR-1942.62756−82.022920181214
LSC-SYR-3942.6151−82.03672019633
LSC-SYR-4042.60373−82.06342019000.7
SR-0642.60424−82.075420180713.6
LSC-SYR-4142.60573−82.07912019002.1
SR-1242.58891−82.12912019000.8
Bear CreekLSC-BRC-1542.99417−81.94752020001.5
LSC-BRC-0942.97479−81.97172020001.5
LSC-BRC-3942.98043−81.96482020001.5
Thames RiverTR-1442.96074−81.32692020001.5
Grand RiverLER-GRR-0443.07389−79.95762020001.5
* Total across surveys. SR-05 was surveyed four times. SR-01, SR-19, SR-06, and LSC-SYR-29 were surveyed two times. The rest of locations were surveyed one time.
Table 2. Simpsonaias ambigua gonad fluid and marsupial gill samples. N, total number of samples. Eggs and sperm under the Gonad Fluid column are the number of samples with gametes. The Empty column indicates number of samples where gametes were not observed. Eggs and glochidia under the Marsupial Gills are the number of samples with eggs or glochidia. NA, no sample was taken.
Table 2. Simpsonaias ambigua gonad fluid and marsupial gill samples. N, total number of samples. Eggs and sperm under the Gonad Fluid column are the number of samples with gametes. The Empty column indicates number of samples where gametes were not observed. Eggs and glochidia under the Marsupial Gills are the number of samples with eggs or glochidia. NA, no sample was taken.
DateNGonad FluidMarsupial Gills
EggSpermEmptyEggsGlochidia
10-JUL-20187412NANA
24-JUL-20185230NANA
8-AUG-2021861142 *0
6-SEP-2018400411
24-SEP-201850 **0301
18-OCT-2018200101
29-JUL-20196105NANA
24-SEPT-20191NANANA11
18-OCT-20193NANANA22
* Possibly some fertilized eggs. ** Underdeveloped or old eggs?
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Porto-Hannes, I.; McNichols-O’Rourke, K.A.; Gibson, M.P.; Morris, T.J. Status and Life History Traits of Simpsonaias ambigua (Salamander Mussel) in Ontario, Canada. Diversity 2025, 17, 133. https://doi.org/10.3390/d17020133

AMA Style

Porto-Hannes I, McNichols-O’Rourke KA, Gibson MP, Morris TJ. Status and Life History Traits of Simpsonaias ambigua (Salamander Mussel) in Ontario, Canada. Diversity. 2025; 17(2):133. https://doi.org/10.3390/d17020133

Chicago/Turabian Style

Porto-Hannes, Isabel, Kelly A. McNichols-O’Rourke, Mandy P. Gibson, and Todd J. Morris. 2025. "Status and Life History Traits of Simpsonaias ambigua (Salamander Mussel) in Ontario, Canada" Diversity 17, no. 2: 133. https://doi.org/10.3390/d17020133

APA Style

Porto-Hannes, I., McNichols-O’Rourke, K. A., Gibson, M. P., & Morris, T. J. (2025). Status and Life History Traits of Simpsonaias ambigua (Salamander Mussel) in Ontario, Canada. Diversity, 17(2), 133. https://doi.org/10.3390/d17020133

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop