Next Article in Journal
Diatom Diversity from Watercourses of North-Eastern Kamchatka with Description of One New Species
Next Article in Special Issue
Reconstructing Historical Changes in the Macroalgal Vegetation of a Central Mediterranean Coastal Area Based on Herbarium Collections
Previous Article in Journal
Burrowing Owls Require Mutualist Species and Ample Interior Habitat Space
Previous Article in Special Issue
The Marine Macroalgae Collection from Herbarium João de Carvalho e Vasconcellos (LISI)—140 Years of History
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 16
Issue 9
10.3390/d16090591
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Extinct or Not? Confirming the “Extinct” Status of Hieracium tolstoii (Asteraceae) with Integrated Taxonomic Investigation

by
Federico Fainelli
1,*,
Giacomo Baldesi
1,
Mattia Pallanza
1,2 and
Simone Orsenigo
1,2
1
Department of Earth and Environmental Sciences, University of Pavia, Via Sant’ Epifanio 14, 27100 Pavia, Italy
2
NBFC: National Biodiversity Future Centre, Piazza Marina 61, 90133 Palermo, Italy
*
Author to whom correspondence should be addressed.
Diversity 2024, 16(9), 591; https://doi.org/10.3390/d16090591
Submission received: 31 August 2024 / Revised: 13 September 2024 / Accepted: 14 September 2024 / Published: 20 September 2024
(This article belongs to the Special Issue Herbaria: A Key Resource for Plant Diversity Exploration)
Browse Figures
Versions Notes

Abstract

:
Hieracium is one of the largest flowering plant genera that has recently experienced a rapid evolutionary radiation. Due to the massive morphological variation among species, frequent hybridization, and polyploidization events, combined with apomictic reproduction in polyploids, the concept of species in Hieracium is widely debated, and species identification is incredibly challenging. Taxonomic investigation can lead to changes in conservation status or, in some cases, to de-extinctions of species. Taxa with doubtful classification are particularly sensitive to this kind of problem. Hieracium tolstoii was a narrow Italian endemic species that is nowadays considered extinct. Described as a morphological intermediate form between two other species, no further investigations were conducted after its first description. To clarify H. tolstoii’s origin and ensure the validity of its current conservation status, we conducted a taxonomic investigation on herbaria specimens of the early XX century. Specimens were studied using a morphometric analysis that compared H. tolstoii with other closely related taxa. Moreover, we performed phylogenetic investigations using three plastid intergenic spacers to evaluate the relationship between species. Plastid markers revealed the presence of indels and SNPs in H. tolstoii sequences that differ from sequences of the supposed parental species. Morphometry revealed differences among species that led us to confirm the validity of H. tolstoii as an independent apomictic species and, therefore, unfortunately, its extinction.

1. Introduction

Recent studies have highlighted significant conservation concerns for an increasing number of plant species [1] and have clearly shown that the ongoing rate of plant extinctions is up to 500 times the pre-Anthropocene background extinction rate for plants [2]. Although extinction is an irreversible process (although see IUCN 2016: International Union for Conservation of Nature Annual Report 2016 [3]; Seddon & King [4] for a technical and ethical discussion on de-extinctions), sometimes, rediscovery and reclassification can contribute to “resurrect” taxa from extinction [5,6]. This kind of “resurrection” is particularly common for species belonging to critical taxa, characterized by unclear taxonomy and difficult identification.
Hieracium L. (Asteraceae) represents a typical case of a taxonomically critical genus. Species in this genus show incredibly high morphological variability, which, in combination with apomictic reproduction in polyploid lineages [7], has led authors to describe more than 10,000 name combinations [8]. The most complete taxonomic treatment of the genus Hieracium was published by Karl Hermann Zahn, in the 1920s of the 20th century [9]. Zahn distinguished two distinct kinds of species: (i) the “basic” species or “Hauptarten” having a unique set of morphological characters; and (ii) the “intermediate” species or “Zwischenarten”, which combines the morphological characters of two or more “basic” species [10] making their identification challenging. Thus, Hieracium species lend themselves to misleading identification and are particularly subject to changes in their taxonomic treatment. However, the origin of both principal and intermediate species remained largely unexplained. Recent genetic studies on this genus revealed intricate phylogenetic history, suggesting multiple independent hybridization events occurred in the past [11]. However, only in a few cases the hybrid origin and genetic introgression were demonstrated for some polyploid taxa [12].
There are still contentious issues in Hieracium taxonomy, but as frequently occurs in modern treatments of species-rich and apomictic genera, taxonomic units are organized in informal aggregates (sections) according to their morphology [13]. Moreover, because of the apomictic reproduction, some authors consider every morphologically distinct taxon as a unique taxonomic unit defined as a microspecies. This kind of treatment is commonly used outside Central Europe [10]. On the other hand, the current taxonomic treatment in Italy [14,15] is still strongly based on Zahn’s scheme and adopts a broader definition of species. The latest checklist of the native Italian flora [14] reports 278 species and 1080 subspecies (1198 microspecies if we adopt the narrower species concept) belonging to Hieracium, with 173 endemic species and 336 endemic subspecies. However, the number of taxa described for Italy constantly increases as new taxa are described every year [16,17,18].
Due to the high morphological variability, the alternative reproduction system related to the ploidy, and the supposed hybrid origin of most of the taxa, their distribution and number of individuals are almost unknown. Consequently, most of the Hieracium taxa in Italy are assessed as DD in the National Red List, including endemic ones [19].
Among the Italian endemic Hieracium taxa, the species Hieracium tolstoii Fen. & Zahn is currently assessed as extinct (EX) at a global level [20,21]. This species was described in 1927 by Fenaroli and Zahn [22] on specimens collected by Fenaroli on the walls of Sforza Castle in Milan (Italy) and distributed through the Flora Italica Exsiccata series [23]. About a century earlier, in 1848, the species was supposedly collected (but no specimens exist and only a generic reference to a glaucous form occurring in the area is given) on the walls of Milan by the Italian botanist Giuseppe De Notaris, together with another species described under the name Hieracium australe Fr. by the Swedish mycologist and botanist Elias Magnus Fries [24]. Only later, Fenaroli and Zahn considered these two plants as two different species, describing the new species as H. tolstoii. H. australe was considered by these two authors as an intermediate species between H. racemosum Waldst. & Kit. ex Willd. and H. laevigatum Willd., and H. tolstoii as an intermediate (supposed of hybrid origin) between a species of sect. Italica (Fr.) Arv.-Touv. (like H. australe or H. racemosum) and H. pospichalii Zahn (sect. Dragicola Gottschl.) or H. porrifolium L. (sect. Drepanoidea Monnier) [15,22]. H. tolstoii differs from H. australe in a series of characters, among which it is possible to quote the narrow bluish-green leaves with numerous sharp teeth and the involucral bracts with dense stellate hairs. The most recent treatment places H. tolstoii in the recently defined sect. Dragicola Gottschl., together with other morphologically similar species like H. pospichalii and H. dragicola (Nägeli & Peter) Zahn, which was formerly placed in sect. Drepanoidea. H. australe is placed in sect. Italica (Fr.) Arv-Touv. [15].
Today, a small population of H. australe still survives on the ancient walls of Sforza castle in Milan [25]. On the contrary, all the attempts that we carried out in the last years to find individuals of H. tolstoii have failed, and this taxon is known only from a few herbarium specimens.
In this work, in order to disentangle the taxonomic uncertainty in H. tolstoii and clarify its conservation status, we compared herbarium specimens of H. tolstoii with H. australe and other Hieracium species by morphometric and molecular analysis, also aiming to better understand the position of H. tolstoii among other supposedly closely related species.

2. Materials and Methods

2.1. Morphometric Analysis

The aim of these analyses is mainly to test the morphological distinctiveness of the species in question. Therefore, a broad concept of species has been applied, and subspecies are not considered in the present analysis; instead, they are merged together, considering only sensu lato species.
Measurements were taken on herbarium specimens (FI, PAV) or on scanned specimens, notably for H. tolstoii (G, TR, HAL Herbaria, acronyms follow Thiers 2024 [26]). Only complete, well preserved, and typical (not evidently altered by pathogens or extreme climatic conditions) plants were selected. Microscopic characters were observed with an assembled Wild Heerbrugg stereomicroscope. The scanned material was measured with ImageJ software (version 1.54i). Microscopic characters, such as the indumentum hair that could not be observed from the scanned material, were generalized by extension from other seen specimens belonging to the same taxon.
Following previous studies on other Hieracium sections [27,28,29], forty-nine characters (Table 1) of presumably taxonomic importance were selected based on the literature [9,15] and coded for the 77 specimens included in the analysis (see Supplementary Materials, Table S1). A wide set of characters was employed to test their importance and correlations, considering that no previous morphometric studies on late flowering species of Hieracium were published. The selection of characters was carried out to get a complete overview of the different parts of the plant: 23 refer to the leaves, 6 to the stem, and 20 to synflorescence and floral parts; 19 regard the shape of leaves and phyllaries, 20 the indumentum, and 10 the general habit and growth form (Table 1).
Taxa included in the analysis were chosen for their morphological similarity to members of sect. Dragicola (particularly to H. tolstoii), for being characterized by an aphyllopodous habit with the presence of more than 10–15 cauline leaves, and for their distributional range, including lowlands habitats in Northern Italy and adjacent regions. Considering the amount of available material differs significantly among species, and this study is focused on H. tolstoii, the number of available specimens of this taxon determined how many specimens of the other taxa were included (to have a more uniform dataset).
The selected taxa include both “basic” species (or “Hauptarten”) and “intermediate” species (or “Zwischenarten”) sensu Zahn. These belong to sect. Dragicola. (H. dragicola, H. leiocephalum Bartl. ex Griseb., H. pospichalii, and H. tolstoii), sect. Italica (H. australe), sect. Tridentata (Fr.) Arv.-Touv. (H. laevigatum Willd.), sect. Sabauda (Fr.) Arv.-Touv. (H. sabaudum L.) and sect. Hieracioides Dumort. (H. vasconicum Jord. ex Martrin-Donos, H. brevifolium Tausch).
Despite the fact that it was supposed to contribute to the origin of H. tolstoii [15,22], H. racemosum s.l was not included in the morphometric analysis as it is generally readily recognizable by the pseudophyllopodous habit, the green leaf color (never glaucous), the scarcely imbricate involucre with the inner series of phyllaries considerably longer than the outer ones usually with the floccose hairs not restricted to (or denser on) margins. The same applies to H. umbellatum L., possibly the most distinctive and easily recognized hawkweed, rather unique in the genus for its clearly umbellate synflorescence and the reflexed tips of phyllaries which are mostly devoid of any indumentum or almost so. Plants in the sect. Drepanoidea were excluded due to their phyllopodous habit and the presence of lanceolate or lanceolate-linear leaves.

2.2. Statistical Analysis

Before proceeding with any multivariate statistical analysis, the normality of distribution for characters was tested with the Shapiro–Wilk test at the taxon level. Significantly correlated characters (>0.95) were then individuated via Spearman’s correlation coefficient and excluded from the dataset to ensure that no distortion would affect the results of the analyses. A principal coordinates analysis (PCoA) performed on a distance matrix calculated with Gower 1971 [30] was preferred for exploring the morphology of the different taxa, due to the presence of both quantitative and qualitative characters. We then tested the hypothesis via discriminant analyses [31] based on the results of the exploratory analysis. A canonical discriminant analysis (CDA) was chosen to visualize the morphological variation within groups, and a jackknifed linear discriminant analysis (LDA) was used to test how robust the groupings are. The aforementioned analyses were all computed using R Studio version 4.2.764 [32]. All functions were performed using the package MorphoTools2 [33], which conveniently wraps different functions scattered in different packages for the analysis of morphological data.

2.3. DNA Extraction

Since, for some specimens, it was not possible to extract DNA (i.e., plants consulted virtually), or we faced difficulties in obtaining good quality DNA from old herbaria specimens, in a few cases, recent herbaria specimens or fresh material were used for DNA extraction. A total of 50 specimens belonging to 16 species (using a narrow species concept) were selected for molecular investigations (Supplementary Materials Table S2). We also included species of sect. Drepanoidea (H. willdenowii Monnier, H. porrifolium), and other species of sect. Sabauda (H. scaboisum Sudre, and H. sabaudiforme (Zahn) Prain), sect. Italica (H. racemosum, H. virgaurea Coss., H. spinidentatum [=Hieracium racemosum subsp. spinidentatum Gottschl. & M.Villa]), and sect. Dragicola (H. racemosiforme Zahn). Pilosella officinarum F.W.Schultz & Sch.Bip. and Pilosella piloselloides (Vill.) Soják were used as an outgroup.
DNA was extracted using a modified CTAB protocol [34]. For each specimen, ca. 20 mg of plant tissue was ground in a sterile 1.5 mL reaction tube using a pestle and liquid nitrogen, then, 1 mL of CTAB extraction buffer (CTAB buffer (Promega) and 0.3% v/v β-mercaptoethanol) was added and incubated for an hour at 65 °C. After cooling them down at room temperature, they were centrifuged at 10,000× g for 2 min, and the aqueous phase was transferred in a sterile 2 mL tube, then 1 mL chloroform was added and mixed thoroughly. Samples with chloroform were centrifuged at 15,000× g for 2 min. The upper phase was transferred in a new 2 mL tube, and it was mixed with 400 µL of 2-Propanol. Samples were centrifuged again at 15,000× g for another 5 min, and the supernatant was removed. The pellet was washed with 500 µL of 70% ethanol. After a final centrifuge at 15,000× g for 2 min, it was dried at room temperature. Finally, it was eluted in 15–30 µL of distilled sterile water.

2.4. Markers Amplification

Three different plastid intergenic spacers were selected for molecular studies: trnH-psbA, trnL-trnT, and trnV-ndhC. Details about primers and annealing temperatures used for amplification are reported in Table 2. Due to the length of trnV-ndhC (800–1200 bp) and the difficulties in amplifying it due to ancient DNA degradation, we designed new primers to amplify portions of this region. A similar approach was conducted for the trnL-trnT region when it was not possible to obtain an entire sequence. In that case, we amplified using the primers a+ and b+ developed by Fehrer et al. (2007) [35].
PCRs were performed in 25 mL reactions containing 12.5 µL of VWR ® Red Taq DNA polimerasi 2X MasterMix 1.5 mM MgCl2 (VWR International, Haasrode, Belgium), 1 µL of each primer, 8.5 µL of water and 2 µL of genomic DNA. After the first denaturation step at 95 °C for 5 min, 40 cycles of denaturation (95 °C for 30 s), annealing (annealing temperature Ta for 30 s), extension (72 °C for 1 min), and a final extension at 72 °C for 7 min. PCR products were purified using the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolab, Ipswich, MA, USA). Amplicons were finally analyzed with Sanger sequencing by the Ez-Seq service at Macrogen Europe (Amsterdam, The Netherlands) using the same primer for amplification.

2.5. Phylogenetic Analysis

Only specimens from which we were able to obtain all the sequences were included in the phylogenetic analysis. Trimming, alignment, and editing were performed with Geneious Prime® software (Dotmatics, build 2024.0.5). Sequences were trimmed, removing regions with more than 0,1% of error per base. Partial sequences of trnV-ndhC were concatenated manually to reconstruct the entire sequence and then combined with sequences of other markers. Missing data were annotated as “N”. Ambiguous bases were represented following the IUPAC ambiguity code. Alignment was performed with Clustal W and then corrected manually. The combined dataset was used for phylogenetic analysis. As described in previous works [11,35], indels were considered to be single characters and the length variation in poly-A regions in trnV-ndhC and in trnH-psbA were omitted. Alignments are presented in the Supplementary Materials (Files S4 and S5).
Phylogenetic analyses were conducted with maximum parsimony (MP) using PAUP 4.0a (build 169) [38] and Bayesian inference using MrBayes [39]. Parameters were set following the same method reported in Krak et al. (2013) [11]. We performed MP analysis by heuristic searches with 10 random sequence addition replicates; for branch swapping the TBR method was used, saving no more than 100 trees with length ≥ 1. The same settings were used for calculating bootstrap values on 1000 replicates. Nodes with a percentage < 50% were retained. For Bayesian analysis, the most fitting model of molecular evolution was determined with MrModeltest V2.4 [40] for each marker using hierarchical Likelihood Ratio Tests. For TrnH-psbA and trnT-trnL, the best-fitting model was the F81 model. For the trnV-ndhC, it was GTR + I. Four Markov chains were run simultaneously for 5 million generations, using the default prior settings (one substitution rate and gamma distribution) and sampling every 1000th tree. The final average standard deviation of split frequencies reached values <0.01 (0.003244). The first 1250 trees per run were discarded as burn-in, and the remaining 7502 trees were summarized.

3. Results

3.1. Morphometric Analysis

The normality of distribution has been tested via Shapiro–Wilk for each quantitative character at the taxon level, with most characters normally distributed for most taxa. An attempt at correcting the few exceptions to the normality of distribution could be made, but since the analyses we chose have been shown to be quite robust to violation of this assumption [41], we decided to use the data without transforming them. To further support this choice, it is to be noted that, to better fit a normal distribution, all the values had to be transformed independently from the taxon, leading to an attenuation of the actual variability between taxa. Spearman’s correlation coefficient was also calculated for the characters. The only significantly correlated characters (=0.972) were the leaf width (L_W) and the leaf width at the largest teeth (Th_L_W). We decided to remove Th_L_W from the analysis due to it being a more elaborated character compared to L_W and being almost the measurement of the same feature.
The main two axes of the PCoA account for 42.89% of the variance (Figure 1a). Specimens result separated into three morphologically distinct groups: H. tolstoii, H1 (comprehensive of H. australe, H. brevifolium, H. laevigatum, and H. sabaudum) and H2 (consisting of H. dragicola, H. leiocephalum, and H. pospichalii). The CDA fully supports the three groups individuated in the exploratory PCoA (Figure 1b), with the most significant characters distinguishing H. tolstoii from other taxa being the number of cauline leaves (L_n), the dentation on the petiole (Pe_Th), the type of leaf margin (L_M) and the color of phyllaries margin (Phy_Ma) (Figure 1c). LDA performed maintaining these three morphological groups and confirms the hypothesis that H. tolstoii is a morphologically well-defined taxon from the other Hieracium considered in this study (Figure 1b), with a 100% correct classification for H. tolstoii and an overall 93.3% correct classification for the groups (Table 3). It is to be noted that only a subset of 18 characters was used for the CDA and LDA, compared to the 49 of the PCoA, as it is a fundamental requirement of these analyses that no character is invariant in any group.

3.2. Molecular Analysis

We successfully obtained all three marker sequences for a total of 21 Hieracium individuals belonging to 11 different species, 10 of them for the first time in literature (See Supplementary Materials, Table S3). The most informative regions were trnL-trnT and trnV-ndhC sequences. Within Hieracium, the length of amplified sequences varied from 643–657 bp for trnL-trnT and 827–1212 bp for trnV-ndhC region due to the presence of multiple gaps as observed also in previous studies [11,35,42]. The trnH-psbA region was the smaller (366), and only one SNP was observed. Considering indels as single traits, our combined dataset had 1737 characters: 69 of them were variable and 53 parsimony-informative. Both MP and Bayesian inference produced trees topologically similar (Figure 2).
The phylogenetic tree revealed Hieracium as a monophyletic clade. Four main clades were observed in the tree (Figure 2). One well-supported clade (Clade A) occurred in a basal position and is characterized by species belonging to the sect. Hieracioides (H. umbellatum, H. brevifolioides Zahn) and H. insuetum Boreau. (sect. Italica)
Species belonging to sect. Italica occurred in different clades. H. insuetum is inserted in the same clade of species of the sect. Hieracioides (Clade A). H. australe was the only species that presented the smaller variant of trnV-ndhC because of a large deletion of 355 bp, and clustered in a distinct clade with strong statistical support (Clade B). Other two main haplogroups (C and D) were observed. However, our tree was not able to definitively resolve relationships between them (Figure 2). In clade C, H. virgaurea and H. spinidentatum are included (sect. Italica). Plants of sect. Dragicola and H. willdenowii (sect. Drepanoidea) cluster in the same monophyletic clade (clade D) because they present a peculiar insertion 14 bp long in trnT-trnL region. Two haplotypes were observed in Clade D (D1 and D2), which differed for only one SNP in trnV-ndhC. H. pospichalii presents the same haplotype of H. dragicola and H. leiocephalum. H. tolstoii has the same haplotype of H. racemosiforme and H. willdenowii.

4. Discussion

Molecular studies on Hieracium phylogeny are extremely rare [7,11,12,42], and in only one case, morphological and molecular data were combined to verify hybridization patterns between apomictic species [12]. This is the first time that morphological and molecular approaches were conducted on an extinct Hieracium species to assess its taxonomic treatment. Due to the absence of fresh material of H. tolstoii, it was not possible to apply ploidy estimation methods (chromosome counts, genome size estimation) commonly used for these plants [7,12,43]. Despite this, we can assume that H. tolstoii could be a triploid taxon, as resulting for many other apomictic Hieracium microspecies in Northern Italy, like H. australe and H. spinidentatum.
Herbaria are an invaluable source of biodiversity data and results that are particularly useful in conservation actions [44].
Unfortunately, several limitations prevent the inclusion of a larger number of species in this study. Since Hieracium is a quite neglected genus, a reduced number of herbarium specimens were available. Most of them were collected at the beginning of the 20th century, and some taxa were no longer recorded in Italian flora [14] since their first description. Some species are known only for a few or single specimens or from a few or single localities [45]. Hieracium specimens, like other Asterales, are also frequently attacked by insects that eat flowers and leaves, causing severe damage or complete loss of specimens [46]. Having well-preserved material is crucial for morphometric analysis because microscopic details are used for species identification in Hieracium.
Herbarium specimens also provide DNA that finds important applications in phylogenetics and evolutionary studies [47,48]. Being associated with an accurately identified individual, sequences obtained from herbarium material can have a crucial role in modern taxonomy, allowing the creation of an accurate dataset for genetic references [49]. This could be particularly useful for taxonomically challenging taxa. Despite their importance, molecular techniques are destructive methods that necessarily cause damage to specimens [48,50]. Not all the specimens are suitable for this kind of study due to insufficient material for DNA extraction and herbaria policies [44].
Moreover, DNA is known to undergo a degradation process over time. The more a specimen is old, the less are the chances to obtain good sequences [47,48,50]. Also, the probability of obtaining markers is strictly related to their length, so longer sequences are more difficult to obtain from herbarium specimens.
To avoid a reduced number of individuals per taxa, a broad species concept was used for morphometric analysis. This permitted the inclusion of more individuals in the analysis, obtaining more statistically robust results. Particular attention was reserved to consider plants belonging to sect. Dragicola, the section including H. tolstoii. According to the most recent treatment of the Italian flora [15], the sect. Dragicola is composed of eight species and it has the center of diversity in the Central-Eastern Italian Alps, where almost all the species occur in rock crevices and calcareous screes. The only exception is H. tolstoii, that was reportedly growing on ancient brick walls. Unfortunately, some of the species included in this section had to be excluded because of the insufficient number of individuals suitable for solid morphometric analysis, in some cases due to their poor conditions (H. racemosiforme) or because the species was known only from a few specimens (e.g., H. atrocalyx Gottschl.; [51]). However, leaf fragments were used for DNA extraction (i.e., H. racemosiforme) when possible. Nevertheless, morphometric analysis allowed to distinguish three main clusters: H1, including members of the sect. Dragicola (H. dragicola, H. leiocephalum, and H. pospichalii) except H. tolstoii, H2 including members of the other sections (H. australe, H. brevifolium, H. laevigatum, H. sabaudum, and H. vasconicum, despite the latter shows a slight separation from the other species) and an isolated cluster made by individuals of H. tolstoii. Although not all the species of the section are included, both PCoA and LDA clearly show that H. tolstoii differs from all the other taxa in this study.
Members of the sect. Dragicola clustered together (H1) due to several morphological traits like aphyllopodous habit, glaucous leaves, the number of cauline leaves, and the presence of abundant stellate hairs on the indumentum of the capitula (Figure 1c) [15]. These traits are also common in H. tolstoii, which however, presents also some unique traits like the decurrent dentation on petiole (pseudopetiole) and the revolute leaf margin that are somewhat typical of species belonging to sect. Italica or Hieracioides respectively (Figure 1b,c).
Phylogenetic studies on Hieracium are still at an early stage because molecular diversity in this genus was only recently investigated [11,12,42]. Because of this, most of Hieracium species and entire sections still lack molecular data. In this study, for the first time, sequences from an extinct Hieracium species (H. tolstoii) and from historical Hieracium accessions were obtained and used in a phylogenetic analysis, including species belonging to sect. Dragicola (H. dragicola, H. leiocephalum, H. pospichalii, H. tolstoii), sect. Italica (H. australe, H. insuetum, H. virgaurea, H. spinidentatum), sect. Hieracioides (H. brevifolioides), and sect. Drepanoidea (H. willdenowii) for which no molecular data exist. In fact, Hieracium sect. Dragicola taxa were never studied from a genetic point of view, and no sequences were available in online databases. Also sect. Drepanoidea, which includes species from the Central-Eastern Alps and has typical glaucous leaves, is underrepresented, and molecular data from only a few species (H. bupleuroides C.C. Gmel., H. glaucum All., and H. porrifolium) are available [42]. Moreover, Hieracium sequences stored in NCBI rarely originated from plants collected from Italian regions. Since the main goal of the analysis was to assess possible parental relationships with other Italian species, the few sequences stored online were not included in the analysis.
Plastid markers are often used to resolve phylogenetic relationships among plants and identify species due to their versatility [52,53]. Two regions (trnT-trnL and trnV-ndhC) were selected because they had already been used in previous studies [11,42]. The trnH-psbA marker was selected because it is a short region commonly used as a barcode. A first trial revealed the presence of an indel among Hieracium specimens. Due to its smaller dimension (around 360 bp), trnH-psbA had a higher probability of amplification, especially from ancient herbarium DNA samples. To improve the probability of amplification, trnT-trnL and trnV-ndhC markers were amplified and sequenced in parts and reconstructed successively. Unfortunately, the indel observed in the trnH-psbA region was in between the extremity of the sequence and a poli-A region, which affected the sequencing of the following part of the sequence. Because of that, this portion was always discarded after trimming, and the remaining part was almost identical to all Hieracium species. Nevertheless, the polymorphisms observed for trnT-trnL and trnV-ndhC revealed that plastid sequences of H. tolstoii are more closely related to species in the sect. Dragicola differs significantly from sequences obtained from H. australe, the other species that previously shared the same habitat and growing site with H. tolstoii.
Interestingly, H. tolstoii has the same haplotype observed for H. racemosiforme and H. willdenowii, which were not included in morphometric analysis. Despite that now it is considered a distinct taxon [15], H. racemosiforme was originally classified as a subspecies of H. pospichalii, which tends more toward H. porrifolium (H. porrifolium ≤ H. racemosiforme) [9]. H. willdenowii is currently considered a subspecies of H. glaucum [8] and possesses phyllopodous habit, lanceolate, and lanceolate-linear leaves typical of plants of the sect. Drepanoidea. The high genetic similarity between species with different morphology is not particularly surprising since the sections are higher taxa defined by merely drawing arbitrary borderlines through a continuous space of variation [28], and in this specific case, all the species included in sect. Dragicola are somehow morphologically related to plants of the sect. Drepanoidea [15] since both present glaucous leaves. All the species in this section presumably originated through past hybridization and polyploidization processes that involved H. porrifolium, the only known diploid species in this group [42]. H. porrifolium is restricted to the Southeastern Alps, a well-known glacial refuge area. It reaches its westernmost range limit in the Alps in Grigna massif, around 50 km from Milan. Moreover, species of the sect. Dragicola and Drepanoidea occur mostly in rock crevices and scree on limestone and have a very similar ecology.
Since its first description, H. tolstoii was described as an intermediate between H. australe and H. porrifolium, or H. australe and H. pospichalii (H. porrifolium–H. racemosum) [22]. Our data suggest that it is possible that some species of sect. Italica and especially sect. Dragicola-Drepanoieda are somehow involved in its origin, despite plastid sequences of H. tolstoii, H. australe, and H. pospichalii. having distinct maternal lineages. However, plastid sequences alone cannot take trace of hybridization events and are not efficient in resolving the reticulated phylogenetic history of such a complicated genus. In Hieracium, cpDNA is usually combined with data forming a nuclear marker like squalene synthase (sqs) and external transcribed spacers (ETS) [11,12,42]. Unfortunately, the probability of obtaining sequences of low-copy genes like sqs from ancient material is quite low, so they are not particularly suitable for this kind of study. ETS sequences, on the other hand, are already used for genetic studies of herbaria [54]. All attempts to obtain ETS sequences from our samples failed, and we decided to focus only on cpDNA due to the limited availability of plant material. However, future studies involving more performing technologies, like NGS sequencing, could facilitate obtaining nuclear DNA and provide a more complex view of the genetic relationships between the species.
About H. insuetum., this taxon is considered a subspecies of H. australe in the Italian flora [14,15]. However, our data highlighted that H. insuetum, treated as H. australe in the morphometric analysis, is morphologically and genetically different from other H. australe specimens. H. insuetum presents morphological traits more related to H. sabaudum and H. brevifolium than other conspecifics (Figure 1a) and the same haplotype of species ascribed to sect. Hieracioides (Figure 2). Moreover, H. australe individuals create a monophyletic clade since they all have a large deletion in trnV-ndhC region, which was observed for some species with phyllopod habit [11]. This could also be interpreted as evidence of hybrid origin for this species, but more investigations are required to confirm this hypothesis.
In this preliminary study, our results proved that, despite several limitations, genetic data can be obtained from ancient Hieracium specimens. These data can provide precious insights into this genus’s complex taxonomy and phylogenetic history and should be considered in future Hieracium studies.

5. Conclusions

All our results concur in highlighting that the current taxonomic hypothesis that considers H. tolstoii an independent species seems to be supported, especially by morphometric analysis. Moreover, the idea that H. tolstoii represents a taxon somehow intermediate between a member of the sect. Italica and a species related to sect. Drepanoidea or sect. Dragicola is supported by molecular data. Nevertheless, it also should be noted that the plastid sequences alone do not allow to completely reconstruct H. tolstoii phylogeny and identify which species contributed to its genetics with absolute certainty. Nuclear or genomic data should be considered to provide a more complete picture of the phylogeny of these plants. The data collected so far allows us to confirm the validity of H. tosltoii as a valid independent species, and unfortunately, confirm its extinction since the last collection of this species is dated back to 1938 (specimen preserved in the HAL herbarium), and all attempts to find living plants in its only growing site were unsuccessful.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d16090591/s1, Table S1: Dataset for morphometric analysis. Table S2: species included for molecular investigation, Table S3: Species included in phylogenetic analysis. File S4: Alignment of sequences with indels. File S5: Alignment of sequences after indel substituted by single numeric variables to represent presence, absence, or variants.

Author Contributions

F.F., G.B. and S.O. conceived and designed the research; G.B. collected morphometric data; F.F. performed molecular experiments; M.P. and F.F. analyzed the data; F.F., G.B., M.P. and S.O. wrote the first draft of the manuscript. All authors provided edits and comments and participated in the revision of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was co-financed by “PON Research and Innovation 2014–2020” program of the European Union and supported by “Progetto di Ricerca di Rilevante Interesse Nazionale” (PRIN) of the Italian Ministry of University and Research funded by the European Union—Next Generation EU “HIERACIUM IT‘S A MESS: HIERACIUM ITalian’ Species, Apomictic Mechanisms, Evolutionary SystematicS” lead by the University of Pavia, CUP Master F53D23004090001. The authors M.P. and S.O. were funded by the “National Biodiversity Future Center—NBFC”—National Recovery and Resilience Plan (NRRP), Mission 4 Component 2 Investment 1.4—Call for tender No. 3138 of 16 December 2021, rectified by Decree n.3175 of 18 December 2021 of Italian Ministry of University and Research funded by the European Union—Next Generation EU, Project code CN_00000033.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The original sequences presented in the study are openly available in GenBank [accession numbers from PQ328538 to PQ328615]. Raw data are available if requested from the corresponding author.

Acknowledgments

We are grateful to staff members of the Italian Central Herbarium (FI), Herbarium of Turin University (TO), and Herbarium of Milan University (MI) who allowed us to consult and collect precious material for genetic analysis. Special acknowledgments are also reserved to Carla Lambertini from the University of Milan for her support and precious advice.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Nic Lughadha, E.; Bachman, S.P.; Leão, T.C.C.; Forest, F.; Halley, J.M.; Moat, J.; Acedo, C.; Bacon, K.L.; Brewer, R.F.A.; Gâteblé, G.; et al. Extinction risk and threats to plants and fungi. Plant People Planet 2020, 2, 389–408. [Google Scholar] [CrossRef]
  2. De Vos, J.M.; Joppa, L.N.; Gittleman, J.L.; Stephens, P.R.; Pimm, S.L. Estimating the normal background rate of species extinction. Conserv. Biol. 2015, 29, 452–462. [Google Scholar] [CrossRef] [PubMed]
  3. IUCN. IUCN 2016: International Union for Conservation of Nature Annual Report 2016; IUCN: Gland, Switzerland, 2017. [Google Scholar]
  4. Seddon, P.J.; King, M. Creating proxies of extinct species: The bioethics of de-extinction. Emerg. Top. Life Sci. 2019, 3, 731–735. [Google Scholar] [CrossRef] [PubMed]
  5. Abeli, T.; Rocchetti, G.A.; Barina, Z.; Bazos, I.; Draper, D.; Grillas, P.; Iriondo, J.M.; Laguna, E.; Moreno-Saiz, J.C.; Bartolucci, F. Seventeen ‘extinct’ plant species back to conservation attention in Europe. Nat. Plants 2021, 7, 282–286. [Google Scholar] [CrossRef] [PubMed]
  6. Humphreys, A.M.; Govaerts, R.; Ficinski, S.Z.; Nic Lughadha, E.; Vorontsova, M.S. Global dataset shows geography and life form predict modern plant extinction and rediscovery. Nat. Ecol. Evol. 2019, 3, 1043–1047. [Google Scholar] [CrossRef]
  7. Mráz, P.; Zdvořák, P. Reproductive pathways in Hieracium s.s. (Asteraceae): Strict sexuality in diploids and apomixis in polyploids. Ann. Bot. 2019, 123, 391–403. [Google Scholar] [CrossRef]
  8. IPNI—International Plant Names Index. The Royal Botanic Gardens, Kew, Harvard University Herbaria & Libraries and Australian National Herbarium. Available online: http://www.ipni.org (accessed on 2 July 2024).
  9. Zahn, K.H. Compositae-Hieracium. In Das Pflanzenreich IV; Engler, A., Ed.; W. Engelmann: Leipzig, Germany, 1921; pp. 1965–1966. [Google Scholar]
  10. Schuhwerk, F. Some thoughts on the taxonomy of Hieracium. Ber. Bayer. Bot. Ges. 2002, 72, 193–198. [Google Scholar]
  11. Krak, K.; Caklová, P.; Chrtek, J.; Fehrer, J. Reconstruction of phylogenetic relationships in a highly reticulate group with deep coalescence and recent speciation (Hieracium, Asteraceae). Heredity 2013, 110, 138–151. [Google Scholar] [CrossRef]
  12. Chrtek, J.; Mráz, P.; Belyayev, A.; Paštová, L.; Mrázová, V.; Caklová, P.; Josefiová, J.; Zagorski, D.; Hartmann, M.; Pinc, J.; et al. Evolutionary history and genetic diversity of apomictic allopolyploids in Hieracium s.str: Morphological versus genomic features. Am. J. Bot. 2020, 107, 66–90. [Google Scholar] [CrossRef]
  13. Stace, C.A. Species recognition in agamosperms—The need for a pragmatic approach. Folia Geobot. 1998, 33, 319–326. [Google Scholar] [CrossRef]
  14. Bartolucci, F.; Peruzzi, L.; Galasso, G.; Alessandrini, A.; Ardenghi, N.M.G.; Bacchetta, G.; Banfi, E.; Barberis, G.; Bernardo, L.; Bouvet, D.; et al. A second update to the checklist of the vascular flora native to Italy. Plant Biosyst. 2024, 158, 219–296. [Google Scholar] [CrossRef]
  15. Gottschlich, G. Hieracium. In Flora d’Italia, 2nd ed.; Pignatti, S., Guarino, R., La Rosa, M., Eds.; Edagricole: Milano, Italia, 2018; Volume 3, pp. 1138–1195. [Google Scholar]
  16. Di Gristina, E.; Domina, G.; Gottschlich, G.; Maturo, F.; Scafidi, F. Hieracium racemosum subsp. lucanum (Asteraceae), a new hawkweed from southern Italy. Phytotaxa 2019, 425, 297–300. [Google Scholar]
  17. Gottschlich, G.; Villa, M. Hieracium racemosum subsp. spinidentatum (Asteraceae), a new hawkweed from Lombardy, Italy. Phytotaxa 2022, 531, 78–82. [Google Scholar] [CrossRef]
  18. Gottschlich, G.; Orsenigo, S. New taxa of Hieracium (Asteraceae) from Mount Lesima and adjacent regions (Northern Apennine, Italy). Phytotaxa 2021, 505, 39–55. [Google Scholar] [CrossRef]
  19. Orsenigo, S.; Montagnani, C.; Fenu, G.; Gargano, D.; Peruzzi, L.; Abeli, T.; Alessandrini, A.; Bacchetta, G.; Bartolucci, F.; Bovio, M.; et al. Red Listing plants under full national responsibility: Extinction risk and threats in the vascular flora endemic to Italy. Biol. Conserv. 2018, 224, 213–222. [Google Scholar] [CrossRef]
  20. Bartolucci, F.; Domina, G.; Alessandrini, A.; Angiolini, C.; Ardenghi, N.M.; Bacchetta, G.; Banfi, E.; Bolpagni, R.; Bonari, G.; Bräuchler, C.; et al. Notulae to the Italian native vascular flora: 7. Ital. Bot. 2019, 7, 125–148. [Google Scholar] [CrossRef]
  21. Orsenigo, S.; Fenu, G.; Gargano, D.; Montagnani, C.; Abeli, T.; Alessandrini, A.; Bacchetta, G.; Bartolucci, F.; Carta, A.; Castello, M.; et al. Red list of threatened vascular plants in Italy. Plant Biosyst. 2021, 155, 310–335. [Google Scholar] [CrossRef]
  22. Fenaroli, L.; Zahn, K.H. Hieracia nova Italiae borealis (avec remarques sur H. australe Fr.). Bot. Jahrbücher Fur Syst. 1927, 61, 22–30. [Google Scholar]
  23. Fiori, A.; Béguinot, A. Flora Italica Exsiccata Series II. Centuriae XI–XII (continuatio). Nuovo G. Bot. Ital. Nuova Ser. 1910, 17, 62–120. [Google Scholar]
  24. Orsenigo, S.; Gottschlich, G.; Galasso, G. The typification and identity of Hieracium australe Fr. (Asteraceae). Phytotaxa 2019, 388, 207–211. [Google Scholar] [CrossRef]
  25. Fenu, G.; Bacchetta, G.; Bernardo, L.; Calvia, G.; Citterio, S.; Foggi, B.; Fois, M.; Gangale, C.; Galasso, G.; Gargano, D.; et al. Global and Regional IUCN Red List Assessments: 2. Ital. Bot. 2016, 2, 93–115. [Google Scholar] [CrossRef]
  26. Thiers, B.M. Index Herbariorum, A Global Directory of Public Herbaria and Associated Staff; New York Botanical Garden: Bronx, NY, USA, 2021. [Google Scholar]
  27. Tyler, T. Reevaluation of the species of Hieracium sect. Hieracium that were described by Hylander from introduced populations in Scandinavian parks. Ann. Bot. Fenn. 2004, 41, 103–131. Available online: https://www.jstor.org/stable/23726952 (accessed on 25 June 2024).
  28. Tyler, T. Patterns of morphometric variation and a new supraspecific classification of apomictic taxa of Hieracium (Asteraceae) from Denmark and southern Sweden. Plant Syst. Evol. 2006, 261, 39–88. [Google Scholar] [CrossRef]
  29. Tyler, T. Hieracium sect. Oreadea (Asteraceae) in Sweden–from a complete mess to a preliminary taxonomic classification. Nord. J. Bot. 2011, 29, 538–589. [Google Scholar] [CrossRef]
  30. Gower, J.C. A general coefficient of similarity and some of its properties. Biometrics 1971, 27, 857–871. [Google Scholar] [CrossRef]
  31. Fisher, R.A. The use of multiple measurements in taxonomic problems. Ann. Eugen. 1936, 7, 179–188. [Google Scholar] [CrossRef]
  32. Posit Team. RStudio: Integrated Development Environment for R; Posit Software, PBC: Boston, MA, USA, 2024. [Google Scholar]
  33. Šlenker, M.; Koutecký, P.; Marhold, K. MorphoTools2: An R package for multivariate morphometric analysis. Bioinformatics 2022, 38, 2954–2955. [Google Scholar] [CrossRef]
  34. Rogers, S.O.; Bendich, A.J. Extraction of DNA from milligram amounts of fresh, herbarium, and mummified plant tissues. Plant Mol. Biol. 1985, 5, 69–76. [Google Scholar] [CrossRef]
  35. Fehrer, J.; Gemeinholzer, B.; Chrtek, J.; Bräutigam, S. Incongruent plastid and nuclear DNA phylogenies reveal ancient intergeneric hybridization in Pilosella hawkweeds (Hieracium, Cichorieae, Asteraceae). Mol. Phylogenet. Evol. 2007, 42, 347–361. [Google Scholar] [CrossRef]
  36. Sang, T.; Crawford, D.J.; Stuessy, T.F. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 1997, 84, 1120–1136. [Google Scholar] [CrossRef]
  37. Taberlet, P.; Gielly, L.; Pautou, G.; Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef] [PubMed]
  38. Swofford, D.L. PAUP. Phylogenetic Analysis Using Parsimony (and Other Methods), Version 4; Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
  39. Ronquist, F.; Huelsenbeck, J.P. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [PubMed]
  40. Nylander, J.A.; Ronquist, F.; Huelsenbeck, J.P.; Nieves-Aldrey, J. Bayesian phylogenetic analysis of combined data. Syst. Biol. 2004, 53, 47–67. [Google Scholar] [CrossRef] [PubMed]
  41. Klecka, W.R. Discriminant Analysis; Sage Publications: Thousand Oaks, CA, USA, 1980. [Google Scholar]
  42. Fehrer, J.; Krak, K.; Chrtek, J. Intra-individual polymorphism in diploid and apomictic polyploid hawkweeds (Hieracium, Lactuceae, Asteraceae): Disentangling phylogenetic signal, reticulation, and noise. BMC Evol. Biol. 2009, 9, 1–23. [Google Scholar] [CrossRef] [PubMed]
  43. Chrtek, J.; Zahradníček, J.; Krak, K.; Fehrer, J. Genome size in Hieracium subgenus Hieracium (Asteraceae) is strongly correlated with major phylogenetic groups. Ann. Bot. 2009, 104, 161–178. [Google Scholar] [CrossRef]
  44. Albani Rocchetti, G.; Davis, C.; Caneva, G.; Bacchetta, G.; Fabrini, G.; Fenu, G.; Foggi, B.; Galasso, G.; Gargano, D.; Giusso del Galdo, G.; et al. A pragmatic and prudent consensus on the resurrection of extinct plant species using herbarium specimens. Taxon 2021, 71, 168–177. [Google Scholar] [CrossRef]
  45. Fainelli, F.; Gottschlich, G.; Orsenigo, S. Nomenclatural notes on some names in the Hieracium tenuiflorum group (Asteraceae) of the Alps. Phytotaxa 2024, 645, 131–148. [Google Scholar] [CrossRef]
  46. Guarino, S.; Basile, S.; Caimi, M.; Carratello, A.; Manachini, B.; Peri, E. Insect pests of the Herbarium of the Palermo botanical garden and evaluation of semiochemicals for the control of the key pest Lasioderma serricorne F. (Coleoptera: Anobiidae). J. Cult. Herit. 2020, 43, 37–44. [Google Scholar] [CrossRef]
  47. Pääbo, S.; Poinar, H.; Serre, D.; Jaenicke-Després, V.; Hebler, J.; Rohland, N.; Kuch, M.; Krause, J.; Vigilant, L.; Hofreiter, M. Genetic Analyses from Ancient DNA. Annu. Rev. Genet. 2004, 38, 645–679. [Google Scholar] [CrossRef]
  48. Yeates, D.K.; Mikheyev, A.S. Museums are biobanks: Unlocking the genetic potential of the three billion specimens in the world’s biological collections. Curr. Opin. Insect. Sci. 2016, 18, 83–88. [Google Scholar] [CrossRef]
  49. Puillandre, N.; Lambert, A.; Brouillet, S.; Achaz, G.J.M.E. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 2012, 21, 1864–1877. [Google Scholar] [CrossRef] [PubMed]
  50. Verkley, G.J.; Rossman, A.; Crouch, J.A. 8 The Role of Herbaria and Culture Collections. In Systematics and Evolution; The Mycota, vol 7B; McLaughlin, D., Spatafora, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 205–225. [Google Scholar]
  51. Gottschlich, G. Hieracia nova alpinum V. Stapfia 2011, 95, 33–45. [Google Scholar]
  52. Palmer, J.D.; Jansen, R.K.; Michaels, H.J.; Chase, M.W.; Manhart, J.R. Chloroplast DNA Variation and Plant Phylogeny. Ann. Mo. Bot. Gard. 1988, 75, 1180–1206. [Google Scholar] [CrossRef]
  53. Kress, W.J.; Wurdack, K.J.; Zimmer, E.A.; Weigt, L.A.; Janzen, D.H. Use of DNA Barcodes to Identify Flowering Plants. Proc. Natl. Acad. Sci. USA 2005, 102, 8369–8374. [Google Scholar] [CrossRef]
  54. Logacheva, M.D.; Valiejo-Roman, C.M.; Degtjareva, G.V.; Stratton, J.M.; Downie, S.R.; Samigullin, T.H.; Pimenov, M.G. A comparison of nrDNA ITS and ETS loci for phylogenetic inference in the Umbelliferae: An example from tribe Tordylieae. Mol. Phylogenet. Evol. 2010, 57, 471–476. [Google Scholar] [CrossRef]
Diversity 16 00591 g001
Figure 1. Results of morphometric investigation that show three main groups H. tolstoii (in orange); H1 (in blue) and H2 (in purple). Both plots obtained from PCoA (a) and from CDA (b) H. tolstoii create a distinct group that is isolated from other taxa included in the analysis. (c) Plot obtained by the LDA presenting the most discriminant traits.
Figure 1. Results of morphometric investigation that show three main groups H. tolstoii (in orange); H1 (in blue) and H2 (in purple). Both plots obtained from PCoA (a) and from CDA (b) H. tolstoii create a distinct group that is isolated from other taxa included in the analysis. (c) Plot obtained by the LDA presenting the most discriminant traits.
Diversity 16 00591 g001
Diversity 16 00591 g002
Figure 2. Phylogenetic tree of combined plastid markers (trnH-psbA, trnLtrnT, trnV-ndhC). MP and Bayesian analyses present similar topology. Bootstrap values on the MP analysis are presented above the branches. Posterior probability values from Bayesian analysis are presented. Six different haplotypes are presented. Both analyses did not resolve with a high statistical support relationship among clade C and clade D, where H. tolstoii is inserted.
Figure 2. Phylogenetic tree of combined plastid markers (trnH-psbA, trnLtrnT, trnV-ndhC). MP and Bayesian analyses present similar topology. Bootstrap values on the MP analysis are presented above the branches. Posterior probability values from Bayesian analysis are presented. Six different haplotypes are presented. Both analyses did not resolve with a high statistical support relationship among clade C and clade D, where H. tolstoii is inserted.
Diversity 16 00591 g002
Table 1. List of characters selected for morphometric analysis. QD = quantitative discrete, QC = quantitative continuous, BI = binary, CO = ordinal.
Table 1. List of characters selected for morphometric analysis. QD = quantitative discrete, QC = quantitative continuous, BI = binary, CO = ordinal.
Description of the CharacterCharacter NameType
Number of cauline leavesL_nQD
Leaves distribution along stemL_DisCO
Stem indumentum low simpleSt_Low_SiCO
Stem inumentum mid stellateSt_Mid_StCO
Stem indumentum mid glandularSt_MidCO
Base of leavesL_BCO
Leaf colourL_CCO
Leaf color (upper/lower side)L_CcBI
Shape of lowermost cauline leavesL_ShCO
Leaf indumentum lower sideL_In_LowCO
Upper leaf surfaceL_In_UpCO
Leaves 1/3 upL_1/3_UpCO
Leaf margins upper leavesL_In_Mar_UpCO
Glandular hairs on leaf marginsG_LCO
Hairs on leaves/lower stemH_LCO
Leaf length (lowermost well-developed)L_LQC
Leaf width (lowermost well-developed)L_WQC
Leaf length/Leaf widthL/WQC
Position of the largest teethL_ThCO
Shape/direction of teethTh_ShCO
Largest teeth (cm)ThQC
Width of leaf (at largest teeth, excluding teeth)Th_L_WQC
Width of leaf/largest teethL_W/ThQC
Pattern of leaf dentationTh_PaCO
Dentation along stem leavesTh_StCO
Internode length (mean of lowermost three nodes)In_LQC
Dentation on petiole (pseudopetiole)Pe_ThCO
Leaf marginL_MCO
Phyllaries dispositionPhy_DisCO
Phyllaries marginPhy_MaCO
Involucre length (from the base of the secondary capitulum to the apex of the longest)Inv_LQC
Phyllaries width maxPhy_WQC
Apex of phyllariesPhy_ApCO
Simple hairs on phyllariesS_HCO
Simple hair lengthS_H_LCO
Glandular hairs on phyllariesG_HCO
Glandular hairs lengthG_H_LCO
Stellate hairs on phyllaries and distributionSt_H_DCO
Abundance of stellate hairsSt_HCO
Peduncle indumentumPed_InCO
Bracts below capitulumB_CapCO
Bracts on peduncleB_PedCO
Style pigmentation (in exsiccata)Sty_PigCO
Orders of branchingOrd_BraCO
Number of branchesN_BraQD
Number of well-developed capitulaN_CapQD
Acladium lengthAclQC
Presence of aborted capitulaCap_AbCO
Table 2. Regions and primers used in this study. Ta is referred to as annealing temperature.
Table 2. Regions and primers used in this study. Ta is referred to as annealing temperature.
Region5′ Sequences 3′ Ta (°C) Source
trnH-psbApbAF: GTTATGCATGAACGTAATGCTC
trnHR: CGCGCATGGTGGATTCACAAATC		56Sang et al., 1997 [36]
trnT-trnLa: ATTACAAATGCGATGCTCT
b: TCTACCGATTTCGCCATATC		46Taberlet et al., 1991 [37]
trnT-trnL
portion1		a: ATTACAAATGCGATGCTCT
b+: TATACATCTGTCTCTCTTCC		46Taberlet et al., 1991 [37]
Fehrer et al., 2007 [35]
trnT-trnL
portion2		a+: AAGAGAGACAGATGTATAGC
b: TCTACCGATTTCGCCATATC		46Fehrer et al., 2007 [35]
Taberlet et al., 1991 [37]
trnV-ndhCtrnV-a: GAAGGTCTACGGTTCGAGTC
ndhC-a: AGAAATGCCCAAAAAATATCATATTC		52Krak et al., 2013 [11]
trnV-ndhC
portion 1		trnV-a: GAAGGTCTACGGTTCGAGTC
V.C-R1: CCTCCATCGGGATTGGATTC		57Krak et al., 2013 [11]
New design
trnV-ndhC
portion 2		V.C-F2: CGCAGGAAAATTTATATGGA
V.C-R2: CCAAATTCTCTTGTTTTCAT		50New design
trnV-ndhC
portion 3		V.C-F3: CTCGGTAAGATTGAGATGAAAACA
ndhC-a: AGAAATGCCCAAAAAATATCATATTC		55New design
Krak et al., 2013 [11]
Table 3. A confusion matrix based on the LDA was performed on the subset of 18 characters, using the morphological groups found in the exploratory PCoA as priori groups. Each row shows the a priori group, the number of samples analyzed for that group, and how they have been classified according to the LDA model.
Table 3. A confusion matrix based on the LDA was performed on the subset of 18 characters, using the morphological groups found in the exploratory PCoA as priori groups. Each row shows the a priori group, the number of samples analyzed for that group, and how they have been classified according to the LDA model.
GroupN. SamplesAs H. tolstoiiAs H1As H2CorrectCorrect (%)
H. tolstoii11110011100
H13402952985.29
H23011282893.33
Total751230336890.67
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Fainelli, F.; Baldesi, G.; Pallanza, M.; Orsenigo, S. Extinct or Not? Confirming the “Extinct” Status of Hieracium tolstoii (Asteraceae) with Integrated Taxonomic Investigation. Diversity 2024, 16, 591. https://doi.org/10.3390/d16090591

AMA Style

Fainelli F, Baldesi G, Pallanza M, Orsenigo S. Extinct or Not? Confirming the “Extinct” Status of Hieracium tolstoii (Asteraceae) with Integrated Taxonomic Investigation. Diversity. 2024; 16(9):591. https://doi.org/10.3390/d16090591

Chicago/Turabian Style

Fainelli, Federico, Giacomo Baldesi, Mattia Pallanza, and Simone Orsenigo. 2024. "Extinct or Not? Confirming the “Extinct” Status of Hieracium tolstoii (Asteraceae) with Integrated Taxonomic Investigation" Diversity 16, no. 9: 591. https://doi.org/10.3390/d16090591

APA Style

Fainelli, F., Baldesi, G., Pallanza, M., & Orsenigo, S. (2024). Extinct or Not? Confirming the “Extinct” Status of Hieracium tolstoii (Asteraceae) with Integrated Taxonomic Investigation. Diversity, 16(9), 591. https://doi.org/10.3390/d16090591

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop