Compound 17 Inhibits Lung Cancer Progression via Inducing Cellular Apoptosis and Blocking TNF Signaling Pathway Activation

Abstract

Lung cancer ranks among the most commonly diagnosed malignancies worldwide, with dismal prognosis largely due to its intrinsic drug resistance and high recurrence rate. Herein, we synthesized 30 glycyrrhetinic acid derivatives and evaluated their anti-lung cancer potential both in vitro and in vivo. The biological effects of compound 17 on A549 cells were determined using MTT, colony formation, and Transwell assays. Flow cytometry, transcriptomic profiling, and RT-qPCR were performed to identify differentially expressed genes, followed by GO and KEGG enrichment analyses and molecular docking validation. A mouse xenograft tumor model was employed to assess therapeutic efficacy and systemic toxicity. Compound 17 exhibited dose-dependent inhibition of A549 cell proliferation, migration, and invasion, achieving an IC₅₀ value of 0.6011 ± 0.05 μM. It induced G1-phase cell cycle arrest and apoptosis by inhibiting the TNF signaling pathway and modulating apoptosis-related proteins. In vivo experiments demonstrated that compound 17 exerted a tumor inhibition rate of 80.61% without observable toxic side effects. This study is the first to demonstrate that compound 17 exerts potent anti-lung cancer activity by targeting the TNF signaling pathway and activating the mitochondrial apoptosis pathway, providing a critical experimental foundation for its development as a novel therapeutic agent against lung cancer.

1. Introduction

Lung cancer is among the world’s most prevalent and lethal malignancies [1,2], and it also represents the leading cause of cancer-associated deaths [3]. The latest global statistics indicate that lung cancer accounts for approximately 12.4% of all cancer cases, with nearly 2.5 million newly diagnosed cases and 1.76 million deaths reported annually [4]. At present, the primary therapeutic modalities for lung cancer include surgery, radiotherapy, and chemotherapy [5], among which chemotherapy serves as the cornerstone of treatment for advanced-stage lung cancer [6]. Cisplatin, a highly effective anticancer agent widely used in clinical practice, plays a pivotal role in lung cancer chemotherapy. Impaired apoptotic signaling in response to DNA damage promotes cisplatin resistance in tumor cells, thereby reducing its therapeutic effectiveness [7,8]. Therefore, the development of novel, low-toxicity, and highly effective anti-lung cancer agents holds profound clinical significance.

The tumor microenvironment exerts a critical regulatory role in the initiation and progression of lung cancer, where the pro-inflammatory cytokines interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) act as core modulators [9,10]. TNF-α exerts its biological functions through three major signaling pathways [11]: the caspase family-mediated apoptotic pathway, the ubiquitin ligase TRAF-mediated nuclear factor-κB (NF-κB) pathway [12], and the mitogen-activated protein kinase (MAPK) activation pathway [13]. These pathways are closely associated with tumor cell proliferation, invasion, and metastasis. Apoptosis is a key mechanism by which the body eliminates abnormal cells and suppresses tumor progression [14,15]. As the central regulatory hub of cellular apoptosis [16], Oxidative stress and similar stimuli elicit changes in mitochondrial membrane permeability, resulting in cytochrome c release and sequential activation of the caspase signaling cascade. Caspase-3 serves as a pivotal executioner protease in the apoptotic process [17], its activation is a hallmark event of cellular apoptosis. Thus, targeting the TNF signaling pathway and the mitochondria-mediated apoptotic pathway has emerged as a crucial strategy for anti-tumor drug design.

Natural products represent a vital source for anti-tumor drug discovery and development. Currently, more than 60% of clinically used anti-tumor agents, including vinblastine, etoposide, and paclitaxel, are derived from natural products [18,19]. Licorice (Glycyrrhiza spp.), one of the most extensively used medicinal herbs in traditional Chinese medicine, contains two major bioactive components: glycyrrhizic acid (GL) and glycyrrhetinic acid (GA), demonstrate diverse bioactivities, encompassing anti-inflammatory [20], antiviral [21], and anti-tumor effects [22]. As the triterpenoid aglycone of glycyrrhizic acid, glycyrrhetinic acid has been demonstrated to exert significant anti-proliferative and pro-apoptotic activities against various cancer cell lines, including non-small cell lung cancer, liver cancer, and breast cancer [23,24,25]. Compared with other pentacyclic triterpenoids such as betulinic acid and oleanolic acid, glycyrrhetinic acid boasts abundant sources and low cost. However, its poor water solubility (<0.1 μg/mL) [26] and adverse effects such as pseudoaldosteronism induced by long-term administration [27] have severely limited its clinical application. Therefore, structural modification of glycyrrhetinic acid as a lead compound to develop novel anti-tumor derivatives with enhanced efficacy, reduced toxicity, and improved water solubility has become a research hotspot in this field.

Mitochondria-targeted drug delivery is an innovative strategy to enhance the therapeutic efficacy of anticancer agents [28]. Triphenylphosphonium cation (TPP) [29], characterized by its lipophilicity and positive charge, can penetrate the negatively charged mitochondrial inner membrane, achieving mitochondrial accumulation of drugs, thereby enhancing anti-tumor efficacy [30] and reducing systemic toxicity. Previous studies have demonstrated that conjugation of TPP to the backbone of natural products can significantly improve their mitochondrial targeting ability and anti-tumor activity [31]. Based on these findings, the present study selected glycyrrhetinic acid as the parent nucleus and conducted chemical modifications at the C-30 carboxyl group of its E ring to design and synthesize a series of novel glycyrrhetinic acid derivatives. Through screening using the MTT assay, the highly active compound 17 was identified. Further studies demonstrated that Compound 17 potently inhibits A549 non-small cell lung cancer cell proliferation, migration, and invasion. Transcriptomic analysis indicated that the TNF signaling pathway and the apoptotic pathway are the core targets underlying the anti-tumor effects of compound 17. This study systematically elucidates the anti-lung cancer mechanism of compound 17, providing experimental and theoretical foundations for the development of novel low-toxicity and high-efficiency therapeutic agents for lung cancer treatment.

2. Results

2.1. Chemical Section

Synthesis of Derivatives

All 30 derivatives were structurally characterized using ¹H NMR and ¹³C NMR spectroscopy, with spectral data confirming consistency with their predicted molecular architectures.

Triphenylphosphine (TPP) represents the most extensively utilized lipophilic cation for mitochondrial targeting. Guided by the structural features of the lead compound glycyrrhetinic acid, target derivatives were synthesized through conjugation of TPP moieties with glycyrrhetinic acid, using dibromoalkanes as bifunctional linkers. Specifically, the carboxyl hydrogen at the C-30 position of glycyrrhetinic acid underwent nucleophilic substitution with bromine atoms of dibromoalkanes, generating ester-linked intermediates (1, 7, 13, 19, 25) via covalent ester bond formation. Subsequent nucleophilic substitution between terminal bromine atoms of these intermediates and phosphorus atoms of TPP derivatives afforded the final target compounds (2–6, 8–12, 14–18, 20–24, 26–30). Detailed synthetic protocols are depicted in Figure 1, with full structural characterization data provided in the Supporting Information.

2.2. Cytotoxicity of Compounds

The glycyrrhetinic acid derivatives displayed varying cytotoxicity against five human cancer cell lines (A549, HepG2, PC-3M, MDA-MB-231 and NCI-H1299), with the half-maximal inhibitory concentration (IC₅₀) values summarized in Supplementary Table S61. All derivatives conjugated with the tris(4-methoxyphenyl)phosphine moiety (Compounds 5, 11, 17, 23, 29) exerted more potent cytotoxicity against cancer cells with an IC₅₀ of 0.6011 ± 5.401 μM. Notably, Compound 17 showed an IC₅₀ of 32.26 ± 2.91 μM against primary lung normal cells, indicating its low cytotoxicity toward normal cells and favorable tumor cell selectivity. Based on the overall cytotoxicity profiles, A549 cells were the most sensitive to glycyrrhetinic acid-tris(4-methoxyphenyl)phosphine derivatives.

Interestingly, the cytotoxicity assay of triphenylphosphine derivatives against A549 cells revealed that the biological activity of compounds increased initially and then decreased with the elongation of the dibromoalkyl linker chain. Among all substituent groups, the tris(4-methoxyphenyl)phosphine moiety exerted the most prominent impact on the compound activity, as presented in

Table 1. IC₅₀ Values of Compounds on A549 Cells.

Compound	X	R	IC50
5	(CH2)3		2.496 ± 0.61
11	(CH2)4		2.445 ± 0.28
17	(CH2)5		0.6011 ± 0.05
23	(CH2)6		1.373 ± 0.98
29	(CH2)10		2.793 ± 0.33
14	(CH2)5		0.7728 ± 0.06
15	(CH2)5		0.7721 ± 0.03
16	(CH2)5		0.646 ± 0.11
18	(CH2)5		5.745 ± 0.05
Cisplatin	-	-	18.61 ± 1.95

. The introduction of methoxy groups into the tris(4-methoxyphenyl)phosphine moiety significantly enhanced the cytotoxicity of derivatives, which might be attributed to the following synergistic mechanisms:

The electron-donating conjugative effect of the 4-methoxyphenyl groups enriches the electron density of the phosphorus atom, thereby strengthening the electrostatic binding interactions with tumor-associated molecular targets; the aromatic ring structure optimizes the lipophilic-hydrophilic partition coefficient of the molecules, facilitating transmembrane transport across cell membranes; the spatial configuration of the tris(4-methoxyphenyl)phosphine moiety matches well with the active pocket of the target proteins, and the moderate steric hindrance stabilizes the drug-target complex through hydrophobic interactions; compared with other substituent R groups, the electron-donating property and conjugated rigidity of the 4-methoxyphenyl groups are more compatible with the electronic environment and binding requirements of the molecular targets. These multiple factors synergistically contribute to the enhanced antitumor activity of the derivatives.

The experimental results demonstrated that the conjugation of tris(4-methoxyphenyl)phosphine moieties significantly improved the biological activity of the lead compound glycyrrhetinic acid. A comparative analysis of the antitumor activity of tris(4-methoxyphenyl)phosphine derivatives revealed that the activity increased first and then decreased with the extension of the alkyl chain length attached to the C-30 ester bond. Notably, the majority of derivatives featuring a 5-carbon alkyl chain (C=5) displayed remarkable antitumor activity. Compound 17 with potent cytotoxicity exhibited distinct structural differences from the glycyrrhetinic acid parent nucleus (Figure 2): the C-30 position of the parent nucleus was unsubstituted, while this site in Compound 17 was modified with a composite substituent consisting of a 5-carbon alkyl linker and tris(4-methoxyphenyl)phosphine. This compound incorporated a phosphorus-containing aromatic substituent with strong electron-donating properties, and formed an extended conjugated system through the conjugation between the aromatic rings of the phosphine moiety and the linking chain, thereby optimizing the electronic distribution and spatial conformation of the molecule. Compound 17 exhibited the strongest cytotoxic effects against all five human cancer cell lines, with the lowest IC₅₀ value (0.6011 ± 0.05 μM) observed in A549 cells. Thus, A549 cells were selected as the cellular model for subsequent investigations into the anticancer activity and mechanistic basis of Compound 17.

2.3. Compound 17 Suppresses A549 Cell Growth & Proliferation

To evaluate its antitumor potential, the cytotoxicity of Compound 17 was systematically compared with four clinical first-line chemotherapeutic agents (cisplatin, doxorubicin hydrochloride, gemcitabine, and docetaxel) at 24 h and 48 h. As shown in Figure 3A, after 24 h of treatment, Compound 17 exhibited stronger inhibitory effects on A549 cell proliferation than all four positive control drugs. Following 48 h of incubation (Figure 3B), the antiproliferative activity of Compound 17 was further enhanced. Notably, Compound 17 exerted potent, dose-dependent cytotoxicity against A549 cells: at a low concentration of 0.78125 μM, its cytotoxicity was significantly superior to that of the four positive controls, achieving a 57.72% inhibition rate; even at a high concentration of 100 μM, Compound 17 still displayed a markedly higher inhibition rate against A549 cells than the clinical first-line chemotherapeutic drugs.

2.4. Impact of Compound 17 on A549 Cell Proliferation, Migration, and Invasion

Compound 17’s ability to inhibit A549 cell proliferation, a 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was employed. Data demonstrated that A549 cell proliferation was dose-dependently and time-dependently suppressed by Compound 17. Decreased EdU fluorescence signals indicated concentration-dependent attenuation of A549 cell proliferative capacity following Compound 17 exposure. (* p < 0.05, ** p < 0.01, *** p < 0.001) (Figure 4A–C).

Transwell assay was employed to detect the effects of Compound 17 on the migratory and invasive capacities of A549 cells. Preliminary experiments showed that treatment with Compound 17 at concentrations of 0.125 μM, 0.25 μM and 0.5 μM for 24 h exerted no significant influence on A549 cell proliferation. Conversely, prolonging Compound 17 treatment to 48 h led to marked suppression of A549 cell proliferation at all evaluated concentrations. To isolate Compound 17’s specific effects on migration and invasion from its anti-proliferative activity, A549 cells were exposed to 0.125 μM, 0.25 μM, and 0.5 μM Compound 17 for a 24 h duration. The results of migration and invasion assays revealed (Figure 4D,E) that Compound 17 suppressed the migratory and invasive capacities of A549 cells in a concentration-dependent manner. (* p < 0.05, ** p < 0.01, *** p < 0.001).

The impact of Compound 17 on the clonogenic potential of single A549 cells was evaluated using colony formation assay, with the results presented in Figure 4F,G. Compound 17 concentration-dependently inhibited A549 cell colony formation. (* p < 0.05, ** p < 0.01, *** p < 0.001).

2.5. Effects of Compound 17 on Cell Cycle Distribution and Apoptosis of A549 Cells

The malignant proliferation of tumor cells is often closely associated with the dysregulation of cell cycle progression [32]. A549 were exposed to Compound 17 at 0.5 μM, 1.0 μM, and 2.0 μM. As shown in Figure 5A,B, Compound 17 induced concentration-dependent G1-phase cell cycle arrest, characterized by an elevated G1-phase cell proportion and concurrent reductions in S and G2-phase populations. These data demonstrate that Compound 17 effectively inhibits G1-phase DNA synthesis and cell division, thereby suppressing lung cancer cell proliferation. Collectively, these findings indicate that Compound 17 exerts antitumor activity by blocking DNA synthesis and inducing cell cycle arrest to inhibit cell division, ultimately suppressing lung cancer cell proliferation.

The impact of Compound 17 on A549 cell apoptosis is shown in Figure 5C,D. At low (0.5 μM) and moderate (1.0 μM) concentrations, Compound 17 primarily induced late apoptosis in A549 cells. At the high concentration of 2.0 μM, late apoptosis remained the dominant form of cell death, with a small subset of cells undergoing early apoptosis or necrosis. Notably, treatment with 2.0 μM Compound 17 resulted in a nearly 100% total apoptotic rate in A549 cells. Together with previous cell viability and colony formation assay findings, these data confirm that Compound 17 inhibits A549 cell growth via dual mechanisms: suppressing proliferation and promoting apoptosis.

2.6. Effects of Compound 17 on ROS Levels in A549 Cells

Reactive oxygen species (ROS) serve as core regulatory molecules in cancer cell apoptosis [33], exerting their biological functions through a sophisticated multi-pathway and multi-target network. Their concentration-dependent effects provide crucial targets and strategic foundations for tumor therapy. Accumulating evidence has confirmed that as a key upstream signaling molecule in the mitochondrial intrinsic apoptotic pathway, excessive ROS accumulation triggers apoptosis via a dual mechanism [34]. On one hand, it induces the opening of mitochondrial permeability transition pores (MPTP) and the collapse of mitochondrial membrane potential; on the other hand, it mediates the oxidative modification of Bcl-2 family proteins. Both processes facilitate the release of cytochrome c (Cyt c) from the mitochondrial intermembrane space. Subsequent binding of Cyt c to apoptotic protease activating factor-1 (Apaf-1) activates caspase-9, thereby initiating the caspase cascade reaction and ultimately leading to cell apoptosis.

To clarify the core role of ROS in Compound 17-induced apoptosis of A549 cells, we additionally set up an intervention group with glutathione (GSH), a specific ROS scavenger, and conducted a comparative analysis of experimental results across the blank control group, Compound 17 monotherapy group, GSH monotherapy group, and GSH plus Compound 17 combination group. The results of intracellular ROS level detection (Figure 6A,B) showed that treatment with 2 μM Compound 17 alone led to a significant increase in intracellular ROS levels in A549 cells with distinct red fluorescent signals compared with the blank control group; in contrast, almost no ROS fluorescent signal was detected in the GSH monotherapy group, confirming the efficient scavenging of basal intracellular ROS by GSH. Most importantly, the ROS fluorescence intensity in the group treated with GSH plus 2 μM Compound 17 was markedly restored relative to the GSH monotherapy group but significantly lower than that in the 2 μM Compound 17 monotherapy group. Collectively, our findings suggest that Compound 17 may inhibit the proliferation and tumorigenesis of A549 cells by promoting excessive ROS accumulation to activate the mitochondrial intrinsic apoptotic pathway.

2.7. Analysis of Differentially Expressed Genes Following Compound 17 Treatment

Investigating the molecular mechanisms underlying Compound 17 action, transcriptome sequencing analysis was performed on A549 cells treated with this compound. Hierarchical clustering heatmap analysis revealed that the differentially expressed genes (DEGs) exhibited good intra-group clustering, indicating satisfactory experimental reproducibility (Figure 7A). Compared with the control group, a total of 1344 DEGs were identified in the compound 17 treatment group, including 769 up-regulated genes and 575 down-regulated genes (Figure 7B). Volcano plot analysis demonstrated that the log₂ fold change (log₂FC) values of most down-regulated genes were concentrated in the range of −5.0 to −2.5, with statistically significant differences (p < 0.05).

Further Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis showed that the top 27 significantly enriched pathways (ranked by Q value) were mainly involved in inflammation-related and apoptosis-associated biological processes (Figure 7C). Among these pathways, the Apoptosis pathway and TNF signaling pathway were the most significantly enriched, and thus were selected as the focus of subsequent mechanistic investigations. Gene Ontology (GO) enrichment analysis further indicated (Figure 7D) that at the molecular function level, DEGs were primarily enriched in functions related to the regulation of signal transduction; at the biological process level, DEGs were significantly enriched in terms such as cell proliferation and apoptosis regulation.

2.8. Regulatory Effects of Compound 17 on the Expression of Key Genes

To verify the reliability of the transcriptome data, RT-qPCR was performed to detect the expression profiles of five core genes (TNF, CEBPP, IL6, BCL2 and CASP3) in A549 cells treated with Compound 17 (2.0 μM, 48 h). As illustrated in Figure 8A,B, RT-qPCR results were well-consistent with RNA-seq profiling data: Compound 17 treatment remarkably downregulated the transcriptional levels of TNF, CEBPP, IL6 and BCL2 (* p < 0.05), while significantly upregulating the expression of CASP3 (^# p < 0.05, ^## p < 0.01), thus validating the accuracy of the transcriptome sequencing data.

These five genes play pivotal roles in orchestrating tumor inflammatory responses and apoptotic regulation. TNF, as a master pro-inflammatory cytokine, initiates the inflammatory cascade and modulates the cellular apoptotic program. As a transcription factor, C/EBPβ is involved in the transcriptional regulation of genes linked to inflammation, cell proliferation, and apoptosis. IL-6 exerts pro-tumorigenic effects by activating multiple signaling pathways to promote tumor cell proliferation, invasion and apoptotic resistance. Within the apoptotic signaling network, the Bcl-2 family proteins serve as key regulators of the mitochondrial apoptotic pathway, where the functional balance between the anti-apoptotic protein Bcl-2 and the pro-apoptotic protein BAX dictates cellular fate. Caspase-3, acting as a critical executioner of apoptosis, functions as the terminal effector molecule in the apoptotic cascade.

Collectively, the combined validation by RNA-seq and RT-qPCR demonstrates that Compound 17 potently modulates the expression of these key genes in A549 cells. These findings suggest that Compound 17 may exert its anti-tumor activity through the synergistic inhibition of TNF-mediated inflammatory responses and the activation of the mitochondrial intrinsic apoptotic pathway.

2.9. Compound 17 Inhibits A549 Cell Proliferation by Suppressing the Cascade Reaction of the TNF Signaling Pathway

To investigate the regulatory effect of Compound 17 on the TNF signaling pathway, Western blot assay was conducted to detect the expression alterations of key proteins in this pathway (Figure 9A). The results demonstrated that Compound 17 significantly downregulated TNF-α expression in a concentration-dependent manner, which subsequently led to a reduction in the expression of its cognate receptor TNFR1. The downregulation of TNFR1 impaired the recruitment and activation of the downstream adaptor protein TRADD, thereby inhibiting TRADD-mediated MKK6 activation. Diminished MKK6 activity further suppressed the phosphorylation and activation of the transcription factor CEBPβ. As a key transcriptional regulator in the promoter region of pro-inflammatory cytokine genes including TNF and IL-6, the inhibited activity of CEBPβ ultimately resulted in the downregulation of IL-6 expression.

TNF-α and IL-6 are key effector molecules in this cascade reaction, and their reduced expression may exert a potential inhibitory effect on lung cancer cells. As pivotal pro-inflammatory cytokines, TNF-α and IL-6 are known to promote tumor cell proliferation via relevant signaling pathways and accelerate tumor metastasis by shaping a tumor-promoting inflammatory microenvironment and modulating immune cell functions. In this study, Compound 17 was found to block the TNFR1/TRADD/MKK6/C/EBPβ signaling cascade, thereby synergistically downregulating the expression of TNF-α and IL-6. These findings suggest that Compound 17 may potentially inhibit the proliferation, invasion and metastatic capabilities of A549 cells through multiple pathways, which warrants further functional validation.

2.10. Promotion of A549 Cell Apoptosis via the Apoptosis Pathway

Based on our earlier observation that Compound 17 triggers robust intracellular reactive oxygen species (ROS) accumulation, we sought to determine if its pro-apoptotic activity is mediated through the ROS-dependent mitochondrial intrinsic apoptosis pathway. Western blot assays were performed to evaluate changes in key protein expression within the apoptosis pathway (Figure 9B). The findings revealed that Compound 17 concentration-dependently upregulated the pro-apoptotic protein BAX and downregulated the anti-apoptotic protein BCL-2, resulting in a significant increase in the BAX/BCL-2 ratio.

The imbalance of the BAX/BCL-2 ratio disrupts the integrity of the outer mitochondrial membrane, promoting the release of cytochrome C (Cytc) from the mitochondrial intermembrane space into the cytoplasm. Western blot results confirmed that the level of Cytc was significantly elevated after treatment with compound 17. The released Cytc binds to apoptotic protease-activating factor-1 (Apaf-1) to form an apoptosome, which in turn activates the initiator Caspase-9. The activated Caspase-9 subsequently triggers the activation of the effector Caspase-3, ultimately executing the apoptotic program. Experimental results showed that the expression levels of Cleaved Caspase-9 and Cleaved Caspase-3 were increased in a concentration-dependent manner following compound 17 treatment, further confirming the activation of the mitochondrial intrinsic apoptosis pathway.

In conclusion, compound 17 induces the imbalance of BCL-2 family proteins through ROS accumulation, triggers changes in mitochondrial membrane permeability, initiates the Cytc/Caspase-9/Caspase-3 cascade reaction, and ultimately promotes mitochondrial-dependent apoptosis in A549 cells.

2.11. Synergistic Regulation Between TNF Signaling Pathway Inhibition and Mitochondrial Apoptosis Pathway Activation

To further verify the synergistic regulatory relationship between TNF signaling pathway inhibition and mitochondrial apoptotic pathway activation, an Infliximab (a TNF-α inhibitor) preconditioning group was established. Briefly, A549 cells were preconditioned with Infliximab prior to Compound 17 treatment, and the expression of mitochondrial apoptosis-related proteins (BAX, BCL-2, Cytc, Cleaved Caspase-9/3) was detected by Western blot.

As shown in Figure 9C, compared with the blank control and Infliximab alone groups, the Infliximab preconditioning + Compound 17 group showed significantly increased expression of pro-apoptotic proteins: BAX was upregulated, cytoplasmic Cytc release was increased, and levels of Cleaved Caspase-9 and Cleaved Caspase-3 were elevated. Meanwhile, anti-apoptotic BCL-2 expression was further downregulated relative to the two control groups, leading to a significant increase in the BAX/BCL-2 ratio.

These results indicate that TNF signaling pathway inhibition significantly enhances Compound 17-induced mitochondrial apoptotic pathway activation, confirming a synergistic regulatory relationship between them. TNF signaling pathway inhibition may be a critical synergistic factor for Compound 17-induced mitochondria-dependent apoptosis.

2.12. Molecular Docking of Compound 17 with TNF Protein

Molecular docking analysis between compound 17 and TNF protein was performed using AutoDock Vina 1.2.3 [35]. Molecular docking analysis between compound 17 (IC₅₀ = 0.6011 ± 0.05 μM), compound 13 (IC₅₀ = 41.32 ± 3.72 μM, a compound with moderate IC₅₀ value), and compound 25 (IC₅₀ > 200 μM, a compound with high IC₅₀ value) and tumor necrosis factor (TNF) protein was performed to compare their binding activities and provide a basis for the discussion of structure-activity relationship (SAR). As shown in the docking result table in Figure 10A, the binding affinity of the optimal binding conformation of compound 17 was −7.038 kcal/mol, and the binding affinities of the top 10 conformations ranged from −5.761 to −7.038 kcal/mol. In contrast, the molecular docking results of compound 13 and compound 25 with TNF are presented in Figure S65A–D in the supplementary materials, and the binding affinity of their optimal binding conformations was both −6.8 kcal/mol, which was significantly lower than that of compound 17. The above results suggest that compounds with lower IC₅₀ values (higher biological activity) exhibit stronger binding affinity to TNF protein, showing an obvious correlation between them, which lays a foundation for the in-depth analysis of the structure-activity relationship in subsequent studies. In addition, the root mean square deviation (RMSD) values of each docking conformation of the three compounds relative to their respective optimal conformations were all within the acceptable range, which confirms the conformational convergence and the reliability of the docking results.

Interaction analysis performed using BIOVIA Discovery Studio 2024 Client 24.1 (Figure 10B) showed that compound 17 can occupy the binding pocket of TNF and form a non-covalent interaction network. Hydrophobic surface mapping analysis indicated a high degree of structural complementarity between the ligand and the binding pocket, which is consistent with the negative binding energy results obtained from the experiments. Structural visualization analysis (Figure 10C) confirmed that compound 17 can embed into the TNF binding pocket composed of α-helix, β-sheet, and random coil domains without obvious steric hindrance. The enlarged view showed that the interaction distances between compound 17 and amino acid residues such as lysine 65 (LYS-65) and alanine 22 (ALA-22) are all within the effective range of non-covalent interactions. To further verify the necessity of the above-mentioned key binding residues, site-directed mutagenesis experiments were carried out. The ALA-22 residue of TNF protein was subjected to site-directed mutation, and the binding affinity between compound 17 and the mutant protein was detected. The experimental results (Supplementary Material Figure S65E) showed that the binding affinity of compound 17 to the ALA-22 mutant TNF protein decreased to −6.8 kcal/mol, which was significantly lower than its binding affinity to the wild-type TNF protein. This confirms that residues such as LYS-65 and ALA-22 are key sites for the specific binding of compound 17 to TNF protein, and the disruption of their binding will directly affect the binding activity between the compound and the target. The ligand binding mode and the results of site-directed mutagenesis experiments together indicate that compound 17 can form a stable binding conformation, which depends on the specific binding of key residues.

Given the crucial role of TNF protein in inflammatory responses, immune regulation, and tumorigenesis and progression, the specific binding ability between compound 17 and TNF may support its potential as a therapeutic agent for lung cancer and a lead compound for development. This study provides a molecular docking-based mechanistic basis for the further optimization and functional verification of lung cancer treatment strategies targeting TNF.

2.13. In Vivo Antitumor Activity

Subsequently, the effect of compound 17 on Lewis lung carcinoma (LLC; LL/2; LLC1) tumor-bearing mice was investigated. Figure 11A–C show the tumor growth curves and body weight changes in tumor-bearing mice after administration, and the statistical table of the original tumor volume data of mice in each group is provided in S62. In all groups, the body weight exhibited an increasing trend over time. Meanwhile, the tumor volume and tumor weight data presented in Figure 11D,E indicated that the tumor volume was the largest in the normal saline group, whereas both the compound 17 group and the positive drug group exerted potent inhibitory effects on tumor growth. Among them, the tumor inhibition rate of the high-dose compound 17 group was 80.61%, demonstrating that the high-dose compound 17 group could significantly inhibit tumor growth (Figure 11F). Survival curve analysis was conducted using GraphPad Prism 9.5.1, with results (Figure 11G) demonstrating a median survival time of 44 days in the high-dose Compound 17 group, compared to 24.5 days in the blank control group. These findings confirm that Compound 17 significantly prolonged survival in lung cancer-bearing mice.

Hematoxylin and eosin (H&E) staining was utilized to assess therapeutic efficacy across all treatment groups. As illustrated in Figure 11H, the high-dose Compound 17 group exhibited significantly greater tumor cell necrosis relative to the low-dose, medium-dose, and control groups. These results validate the potent anti-lung cancer activity of Compound 17. Microscopic examination of H&E-stained sections from major mouse organs (Figure 11I) revealed no notable differences between Compound 17-treated groups (low, medium, high doses) and the control group. Collectively, these data indicate that Compound 17 does not induce significant toxic effects on normal cells.

In addition, immunohistochemical (IHC) analysis was performed on tumor tissues to better understand the mechanism by which compound 17 inhibits tumor growth. For the analysis of tumor cell apoptosis, the TUNEL assay was used for quantitative detection of apoptotic cells in tumor tissues. As shown in Figure 12A, the red fluorescent signal was significantly increased in the compound 17 treatment groups, indicating elevated levels of tumor cell apoptosis. These results demonstrated that compound 17 could significantly induce lung cancer cell apoptosis, further confirming its antitumor activity. As presented in Figure 12B, a large number of brownish-yellow Ki67-positive signals were observed in the tumor tissues of the control group, while the intensity of Ki67-positive signals was significantly reduced in the compound 17 treatment groups, indicating that the proliferative activity of tumor cells was significantly inhibited by compound 17 treatment. The results of TNF-α IHC staining are shown in Figure 12C; in the compound 17 treatment groups, the brown staining signal gradually decreased with increasing administration concentration, suggesting that the expression of TNF-α was downregulated in a concentration-dependent manner. This indicated that compound 17 induces lung cancer cell death by inhibiting the expression of the TNF signaling pathway. Therefore, the results of our studies on the in vivo tumor model were consistent with those of the in vitro analyses.

The levels of inflammatory factors and major biochemical indicators in mouse serum were determined. As key pro-inflammatory factors in the TNF signaling pathway, high expression of TNF-α and IL-6 promotes tumor progression by facilitating tumor angiogenesis, accelerating tumor cell proliferation, and mediating immune escape. The compound 17 group achieved tumor growth inhibition by reducing the levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in mouse serum, with the specific values (mean ± standard deviation) of TNF-α and IL-6 in mouse serum for each experimental group provided in Figure S63 of the Supplementary Materials. (Figure 12D,E, * p < 0.05, ** p < 0.01). The serum levels of AST, ALT, CK-MB, BUN, and CRE are shown in Figure 12F–J. No significant effects on liver, heart, and kidney function indicators were observed in any of the administration groups. In summary, these findings confirmed the safety of compound 17.

3. Discussion

Natural compounds and their derivatives represent important sources for the development of new cancer therapeutic drugs [36]. Previous studies on natural compounds and traditional drugs have successfully promoted the development of various anti-cancer therapies, which have been applied in clinical practice and significantly prolonged patient survival [37,38]. In the clinical treatment of lung cancer, the exploration of efficient targeted therapies has always been a research hotspot, as they play a crucial role in controlling tumor progression and improving patient prognosis [39]. Therefore, further exploration of the abundant resources of natural compounds is expected to lay the foundation for the design of new cancer treatment strategies.

Lung cancer is one of the most lethal cancers [40]. Inflammation plays a key role in the pathogenesis and progression of lung cancer (LC) [41,42]. It is thus important to identify potential new methods, targets, and effective therapeutic agents for lung cancer treatment. Glycyrrhetinic acid (GA), a natural product derived from Glycyrrhiza uralensis [43], has been extensively studied in recent years for its anti-tumor, anti-inflammatory, and other biological activities [44,45]. In this study, a comprehensive cytotoxicity screening was first performed on 30 synthesized GA derivatives, followed by an in-depth investigation of their anti-cancer mechanisms. Cytotoxicity assays showed that Compound 17 exhibited the most potent inhibitory effect on A549 lung cancer cells, while animal experiments demonstrated that Compound 17 achieved a tumor inhibition rate of 80.61%. These findings indicate that Compound 17 possesses significant anti-cancer potential, providing a new therapeutic option for lung cancer treatment. Meanwhile, its toxicity profile was superior to that of four broad-spectrum anti-cancer drugs currently used in clinical practice, namely doxorubicin, cisplatin, docetaxel, and gemcitabine, suggesting that Compound 17 holds great development potential.

Proliferative capacity, migratory potential, and invasive ability of tumor cells are key factors underlying cancer-associated mortality [46,47]. In this study, we assessed the effects of Compound 17 on A549 cells using EdU incorporation, colony formation, and Transwell migration and invasion assays. EdU assay results showed that Compound 17 significantly inhibited A549 cell proliferation in both concentration- and time-dependent manners. Colony formation, Transwell migration, and invasion assays confirmed that Compound 17 exerted concentration-dependent inhibitory effects on A549 cell proliferation, migration, and invasion. Additionally, cell cycle and apoptosis analyses revealed that Compound 17 promoted apoptosis in A549 lung cancer cells. Collectively, these findings demonstrate that Compound 17 potently suppresses A549 cell proliferation, migration, and invasion while inducing cancer cell death, exhibiting robust antitumor activity.

In this study, RNA-seq technology and bioinformatics analysis were employed to investigate the regulatory mechanism and therapeutic potential of Compound 17 in A549 cells. Our analysis results showed that Compound 17 could significantly activate the TNF signaling pathway and the mitochondrial intrinsic apoptotic pathway, suggesting its important role in inhibiting lung cancer cell proliferation and inducing apoptosis. KEGG and GO analyses revealed the effects of Compound 17 on key pathways, particularly the TNF pathway. As a receptor of the TNF pathway, TNFR1 can recruit TRADD upon binding to TNF ligand, triggering a signal transduction cascade. This process further amplifies the signal through MKK6 phosphorylation, ultimately leading to the binding of CEBPβ to the IL-6 promoter, thereby regulating IL-6 expression and forming an effective cascade effect. Notably, the secretion levels of TNF-α and IL-6 were significantly reduced, indicating that Compound 17 effectively decreases the expression of pro-inflammatory factors associated with lung cancer by inhibiting the activation of the TNF signaling pathway, thereby reducing the malignant phenotype of tumors.

In terms of inducing cell apoptosis, the study found that Compound 17 could significantly increase the intracellular ROS level in A549 cells and activate the mitochondrial intrinsic apoptotic pathway [48]. Its mechanism relies on the balance between BAX and BCL-2 [49]. The activation of BAX leads to its oligomerization and pore formation, thereby disrupting the permeability of the outer mitochondrial membrane, resulting in mitochondrial membrane potential collapse and cytochrome C (Cytc) release. Free Cytc binds to apoptotic protease activating factor-1 (Apaf-1) to form an apoptosome, which activates caspase-9 and further activates caspase-3, initiating the apoptotic program.

Western blot results confirmed that the expression levels of key molecules such as TNFR1, TRADD, MKK6, and CEBPβ, as well as the secretion of TNF-α and IL-6 in A549 cells, were significantly decreased after treatment with Compound 17 (* p < 0.05, ** p < 0.01). Meanwhile, the increased BAX/BCL-2 ratio, the release of Cytc, and the enhanced expression of caspase-9 and caspase-3 (^# p < 0.05, ^## p < 0.01) further validated the RT-qPCR results. This study indicates that Compound 17 induces apoptosis and inhibits proliferation of A549 cells by regulating the TNF signaling pathway and the mitochondrial intrinsic apoptotic pathway. This finding provides a new theoretical basis for the application of Compound 17 in lung cancer treatment, suggesting that it may serve as a potential anti-tumor drug worthy of further research and development.

To verify the clinical transformation potential of the in vitro study results, a subcutaneous xenograft model in C57BL/6 mice was established. In vivo experimental results confirmed that the anti-tumor activity of Compound 17 was significantly dose-dependent, with a tumor inhibition rate of 80.61% in the high-dose group, which was superior to that of the cisplatin control group and prolonged the survival time of mice. H&E staining showed no obvious pathological damage to the major organs of mice in each dose group of Compound 17, indicating good safety. TUNEL staining showed that it promoted cell apoptosis, while the downregulation of Ki67 expression confirmed its inhibition of tumor cell proliferation. Notably, immunohistochemical results showed that Compound 17 significantly reduced the expression of TNF-α, which was consistent with the transcriptome analysis results, indicating that Compound 17 synergistically downregulates the apoptotic signaling pathway by inhibiting TNF-α expression.

In this study, we characterized a novel glycyrrhetinic acid derivative, Compound 17, that regulates cellular growth through dual modulation of TNF signaling and apoptotic pathways, thereby suppressing A549 cell proliferation, migration, and invasive capacity. These results indicate Compound 17 may serve as a promising therapeutic candidate for targeting tumor growth and progression by promoting apoptosis and modulating the TNF signaling cascade.

4. Materials and Methods

4.1. Synthetic Method of Glycyrrhetinic Acid Derivatives

Glycyrrhetinic acid (GA) powder was dissolved in acetone solution at a solid–liquid ratio of 1:20, and the mixture was subjected to ultrasonication to ensure complete dissolution. Immediately after dissolution, 1,3-dibromopropane, 1,4-dibromobutane, 1,5-dibromopentane, 1,6-dibromohexane, or 1,10-dibromodecane was added at a molar ratio of 5:1 relative to GA. The resultant mixture was further treated with ultrasonic-assisted dissolution, followed by the addition of a certain amount of anhydrous potassium carbonate and molecular sieves.

Silica gel column chromatography was employed to separate and purify the crude product, with dichloromethane/methanol (100:1, v/v) serving as the eluent. Eluent fractions meeting purity requirements were concentrated to dryness, yielding the dried intermediate powder.

The resulting intermediate was dissolved in acetonitrile solution at a 1:20 solid–liquid ratio, after which one of five phosphine reagents—triphenylphosphine, diphenylcyclohexylphosphine, tris(p-tolyl)phosphine, tris(4-methoxyphenyl)phosphine, or tris(4-bromophenyl)phosphine—was added. The resulting glycyrrhetinic acid derivatives were purified using silica gel column chromatography, eluting with dichloromethane/methanol (50:1, v/v). Fractions of qualified purity were evaporated to dryness to obtain the target glycyrrhetinic acid derivative powders. Comprehensive ¹H NMR (300 MHz, Chloroform-d) and ¹³C NMR (75 MHz, cdcl₃) characterization data, along with isolation yields for the 30 synthesized compounds, are summarized below.

Compound 1 Silica gel chromatography (dichloromethane/methanol = 120:1/100:1), with a yield of 63%. ¹H NMR δ 5.63 (s, 1H), 4.24 (t, J = 6.1 Hz, 2H), 3.51–3.41 (m, 2H), 3.28–3.16 (m, 1H), 2.78 (dt, J = 13.4, 3.6 Hz, 1H), 2.33 (s, 1H), 2.26–2.07 (m, 2H), 2.04 (dd, J = 13.0, 4.5 Hz, 1H), 1.96–1.74 (m, 2H), 1.69–1.58 (m, 3H), 1.53–1.31 (m, 2H), 1.36 (s, 3H), 1.34–1.23 (m, 1H), 1.23–1.09 (m, 10H), 1.07–0.89 (m, 2H), 1.00 (s, 3H), 0.80 (d, J = 1.7 Hz, 6H), 0.69 (dd, J = 11.6, 2.1 Hz, 1H). ¹³C NMR δ 200.28, 176.34, 169.18, 128.66, 78.84, 62.27, 61.93, 55.03, 48.47, 45.49, 44.16, 43.32, 41.15, 39.24, 37.86, 37.19, 32.86, 31.95, 31.64, 31.21, 29.45, 28.66, 28.52, 28.21, 27.40, 26.56, 26.50, 23.52, 18.79, 17.59, 16.47, 15.70. Refer to Figures S1 and S2.

Compound 2 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 82%. ¹H NMR δ 7.92–7.65 (m, 20H), 5.47 (s, 1H), 4.44 (t, J = 6.3 Hz, 2H), 3.23 (dd, J = 10.3, 6.0 Hz, 1H), 2.76 (d, J = 13.3 Hz, 1H), 2.31 (s, 1H), 2.23 (d, J = 7.5 Hz, 1H), 2.18 (s, 6H), 1.98 (s, 3H), 1.92 (d, J = 4.5 Hz, 2H), 1.80 (d, J = 13.3 Hz, 2H), 1.61 (d, J = 11.1 Hz, 5H), 1.47–1.34 (m, 4H), 1.33 (s, 4H), 1.30–1.22 (m, 3H), 1.20 (d, J = 9.7 Hz, 3H), 1.16–1.04 (m, 12H), 0.99 (s, 5H), 0.96 (s, 2H), 0.80 (s, 4H), 0.71 (s, 4H). ¹³C NMR δ 199.91, 175.83, 169.00, 135.12, 133.69, 133.55, 130.62, 130.45, 128.36, 118.38, 117.23, 78.49, 77.00, 63.38, 61.72, 54.80, 48.14, 45.25, 43.80, 43.11, 41.08, 39.03, 37.79, 36.97, 32.62, 31.70, 31.05, 28.44, 28.28, 28.02, 27.16, 26.27, 24.99, 24.38, 23.32, 19.66, 18.57, 17.43, 16.28, 15.52. Refer to Figures S3 and S4.

Compound 3 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 83%. ¹H NMR δ 13.89–13.57 (m, 11H), 10.13 (s, 2H), 9.28 (s, 1H), 8.23 (s, 1H), 7.99 (s, 1H), 7.93–7.81 (m, 4H), 7.58–7.46 (m, 6H), 7.23–6.98 (m, 16H), 6.91 (s, 5H), 6.88 (s, 2H), 6.71 (s, 3H), 6.64 (s, 4H). ¹³C NMR (75 MHz, cdcl₃) δ 199.89, 175.84, 169.18, 134.85, 133.92, 130.40, 130.25, 128.26, 115.57, 114.52, 78.54, 77.00, 63.42, 61.77, 54.82, 48.27, 45.30, 43.87, 43.15, 40.99, 39.05, 37.62, 37.00, 34.61, 32.64, 31.75, 30.91, 29.59, 28.44, 28.33, 28.03, 27.19, 26.32, 26.23, 25.56, 25.34, 25.18, 23.35, 21.94, 18.59, 17.39, 16.29, 15.54. Refer to Figures S5 and S6.

Compound 4 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 84%. ¹H NMR δ 12.48 (dd, J = 12.4, 7.9 Hz, 6H), 12.27 (dd, J = 8.1, 3.2 Hz, 6H), 10.30 (s, 1H), 10.09 (d, J = 0.5 Hz, 1H), 9.22 (q, J = 6.1 Hz, 2H), 8.57 (s, 1H), 8.04 (dd, J = 10.4, 5.7 Hz, 1H), 7.63–7.51 (m, 1H), 7.35 (s, 4H), 7.11 (s, 1H), 6.76 (d, J = 11.7 Hz, 4H), 6.61 (d, J = 13.2 Hz, 2H), 6.19 (d, J = 12.5 Hz, 2H), 6.15–6.01 (m, 5H), 6.01–5.85 (m, 10H), 5.84–5.66 (m, 7H), 5.59 (q, J = 2.1 Hz, 4H), 5.51 (s, 3H). ¹³C NMR δ 199.90, 175.92, 169.09, 146.36, 146.32, 133.53, 133.39, 131.30, 131.12, 128.34, 115.25, 114.06, 78.55, 77.02, 63.57, 61.74, 54.83, 48.16, 45.28, 43.85, 43.15, 40.97, 39.06, 37.69, 37.02, 32.64, 31.71, 30.90, 28.42, 28.27, 28.04, 27.17, 26.25, 25.70, 23.35, 22.52, 21.79, 19.71, 18.59, 17.39, 16.28, 15.54. Refer to Figures S7 and S8.

Compound 5 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 80%. ¹H NMR δ 7.77–7.64 (m, 9H), 7.17 (dd, J = 8.9, 2.7 Hz, 9H), 4.41 (s, 2H), 3.90 (d, J = 5.6 Hz, 10H), 3.54 (s, 1H), 2.34–2.24 (m, 9H), 2.01–1.91 (m, 7H), 1.61 (d, J = 6.8 Hz, 6H), 1.33 (s, 6H), 1.20–1.06 (m, 19H), 0.99 (s, 6H), 0.79 (d, J = 1.8 Hz, 5H), 0.71 (s, 5H). ¹³C NMR δ 200.09, 176.01, 164.63, 160.09, 135.57, 135.42, 125.36, 116.33, 116.15, 78.67, 77.01, 63.84, 61.72, 55.89, 54.86, 45.33, 43.91, 43.48, 43.24, 41.01, 39.09, 38.51, 37.70, 37.05, 33.90, 32.73, 31.77, 28.64, 28.06, 27.19, 26.28, 24.44, 23.38, 22.22, 19.72, 18.62, 16.64, 15.57. Refer to Figures S9 and S10.

Compound 6 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 78%. ¹H NMR δ 7.82 (d, J = 16.2 Hz, 20H), 4.42 (s, 2H), 4.12 (s, 1H), 2.41 (s, 9H), 1.94 (s, 4H), 1.44–1.20 (m, 17H), 1.19–1.06 (m, 19H), 1.05–0.88 (m, 14H), 0.83–0.64 (m, 14H). ¹³C NMR δ 199.89, 175.91, 169.39, 135.18, 135.03, 134.27, 134.10, 131.57, 116.63, 115.45, 78.55, 77.01, 61.76, 54.84, 48.36, 45.28, 43.87, 43.18, 41.01, 39.06, 37.60, 37.03, 32.63, 31.75, 30.97, 28.50, 28.31, 28.04, 27.19, 26.30, 23.35, 18.64, 17.40, 16.67, 16.32, 15.65, 15.55. Refer to Figures S11 and S12.

Compound 7 Silica gel chromatography (dichloromethane/methanol = 120:1/100:1), with a yield of 65%. ¹H NMR δ 5.63 (s, 1H), 4.13 (t, J = 6.3 Hz, 2H), 3.51–3.39 (m, 2H), 3.22 (dd, J = 10.3, 6.0 Hz, 1H), 2.78 (dt, J = 13.5, 3.5 Hz, 1H), 2.33 (s, 1H), 2.14–1.73 (m, 10H), 1.71–1.53 (m, 6H), 1.48–1.41 (m, 2H), 1.41–1.27 (m, 7H), 1.27–1.09 (m, 11H), 1.09–1.02 (m, 1H), 1.00 (s, 4H), 0.80 (d, J = 0.9 Hz, 5H), 0.69 (dd, J = 11.6, 2.1 Hz, 1H). ¹³C NMR δ 200.16, 176.36, 169.14, 128.54, 78.73, 77.00, 63.39, 61.79, 54.90, 48.35, 45.36, 44.00, 43.18, 41.02, 39.10, 37.73, 37.05, 32.95, 32.73, 31.82, 31.06, 29.29, 28.53, 28.40, 28.07, 27.40, 27.27, 26.43, 26.37, 23.38, 18.64, 17.45, 16.34, 15.55. Refer to Figures S13 and S14.

Compound 8 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 85%. ¹H NMR δ 13.86–13.56 (m, 15H), 11.44 (s, 1H), 10.07 (dq, J = 11.2, 5.7 Hz, 2H), 9.17 (dd, J = 10.5, 5.7 Hz, 1H), 8.67 (d, J = 13.3 Hz, 1H), 8.57–8.50 (m, 4H), 8.23 (s, 1H), 8.04 (t, J = 7.2 Hz, 2H), 7.89 (s, 1H), 7.68 (d, J = 16.5 Hz, 3H), 7.56 (s, 3H), 7.48–7.28 (m, 4H), 7.21–7.10 (m, 3H), 7.05 (t, J = 8.4 Hz, 7H), 6.93 (d, J = 2.8 Hz, 7H), 6.73 (s, 3H), 6.66 (s, 3H). ¹³C NMR δ 200.06, 176.16, 169.28, 134.98, 133.71, 133.58, 130.53, 130.36, 128.24, 118.61, 117.48, 78.48, 77.03, 62.97, 61.74, 54.82, 48.16, 45.29, 43.84, 43.11, 40.96, 39.03, 37.62, 37.00, 35.95, 35.73, 32.63, 31.69, 30.85, 29.52, 28.48, 28.22, 28.03, 27.15, 26.26, 23.33, 19.25, 18.58, 17.37, 16.26, 15.54. Refer to Figures S15 and S16.

Compound 9 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 88%. ¹H NMR δ 7.98–7.66 (m, 9H), 4.07 (d, J = 10.5 Hz, 2H), 3.43 (s, 1H), 3.00 (s, 3H), 2.10 (s, 1H), 1.91 (dd, J = 24.1, 10.7 Hz, 4H), 1.78–1.37 (m, 12H), 1.31 (d, J = 15.3 Hz, 5H), 1.26–1.07 (m, 8H), 1.06 (s, 1H), 1.03–0.94 (m, 8H), 0.80 (d, J = 6.9 Hz, 3H), 0.78–0.65 (m, 3H). ¹³C NMR δ 200.05, 176.11, 169.39, 134.69, 133.92, 130.31, 130.16, 128.25, 117.12, 115.81, 114.80, 78.49, 77.04, 62.88, 61.80, 54.85, 48.28, 45.32, 43.84, 43.14, 41.00, 39.06, 37.60, 37.04, 34.85, 33.82, 32.65, 31.71, 30.86, 28.50, 28.22, 28.05, 27.18, 26.25, 25.57, 25.41, 25.21, 23.34, 21.83, 19.86, 19.25, 18.60, 17.39, 16.29, 15.55. Refer to Figures S17 and S18.

Compound 10 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 88%. ¹H NMR δ 7.67 (dd, J = 12.4, 7.9 Hz, 7H), 7.61 (s, 1H), 7.46 (dd, J = 8.2, 3.1 Hz, 7H), 5.52 (s, 1H), 4.12 (d, J = 5.0 Hz, 2H), 3.70 (s, 1H), 3.22 (dd, J = 10.2, 5.9 Hz, 1H), 2.75 (d, J = 13.3 Hz, 1H), 2.45 (s, 10H), 2.30 (s, 1H), 2.00 (dd, J = 20.6, 6.3 Hz, 6H), 1.86 (d, J = 12.3 Hz, 4H), 1.62 (s, 3H), 1.61–1.48 (m, 5H), 1.40 (s, 2H), 1.33 (s, 4H), 1.25 (s, 2H), 1.23–1.06 (m, 12H), 0.99 (d, J = 2.8 Hz, 9H), 0.79 (s, 4H), 0.72 (s, 5H). ¹³C NMR δ 200.01, 176.15, 169.35, 146.10, 146.06, 133.55, 133.41, 131.16, 130.99, 128.21, 115.51, 114.33, 78.51, 77.02, 63.07, 61.74, 54.84, 48.13, 45.28, 43.81, 43.11, 40.94, 39.03, 37.63, 36.99, 36.01, 34.54, 32.64, 31.68, 30.86, 29.53, 28.44, 28.13, 28.03, 27.15, 26.32, 23.31, 21.77, 19.24, 18.58, 17.37, 16.26, 15.53. Refer to Figures S19 and S20.

Compound 11 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 85%. ¹H NMR δ 7.70 (dd, J = 12.0, 8.6 Hz, 7H), 7.15 (dd, J = 8.8, 2.6 Hz, 7H), 5.51 (s, 1H), 4.13 (q, J = 6.0 Hz, 2H), 3.89 (s, 10H), 3.58 (s, 1H), 3.22 (dd, J = 10.2, 6.1 Hz, 1H), 2.75 (d, J = 13.6 Hz, 1H), 2.30 (s, 1H), 2.05–2.02 (m, 1H), 2.02 (s, 1H), 2.01–1.91 (m, 3H), 1.84 (dd, J = 21.3, 12.6 Hz, 6H), 1.62 (s, 2H), 1.62–1.45 (m, 6H), 1.41 (s, 2H), 1.33 (s, 4H), 1.30–1.17 (m, 5H), 1.10 (d, J = 6.7 Hz, 7H), 1.04 (s, 1H), 1.00 (d, J = 3.0 Hz, 7H), 0.95 (s, 2H), 0.79 (s, 4H), 0.73 (s, 3H), 0.68 (d, J = 11.5 Hz, 1H). ¹³C NMR δ 200.10, 176.17, 169.21, 164.50, 135.54, 135.39, 134.85, 128.08, 126.93, 116.18, 116.00, 109.47, 108.22, 78.53, 77.02, 63.10, 61.74, 55.87, 54.83, 48.18, 45.28, 43.84, 43.11, 40.97, 39.03, 37.62, 36.99, 32.64, 31.69, 30.87, 29.58, 28.46, 28.21, 28.03, 27.15, 26.25, 25.63, 23.85, 23.30, 19.23, 18.57, 17.37, 16.27, 15.53. Refer to Figures S21 and S22.

Compound 12 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 80%. ¹H NMR δ 7.86–7.76 (m, 8H), 4.16 (s, 1H), 2.89 (s, 3H), 2.12 (s, 1H), 1.97 (s, 1H), 1.63–1.16 (m, 17H), 1.16–1.09 (m, 4H), 1.06 (d, J = 17.9 Hz, 3H), 0.99 (d, J = 2.5 Hz, 3H), 0.92–0.78 (m, 4H), 0.78–0.61 (m, 3H). ¹³C NMR δ 200.15, 176.21, 165.93, 135.12, 134.96, 134.10, 133.93, 131.33, 131.28, 123.62, 116.93, 115.76, 78.58, 77.01, 61.78, 60.64, 54.91, 48.38, 45.33, 44.92, 43.87, 43.78, 42.47, 40.17, 39.07, 37.04, 36.81, 35.44, 33.69, 31.74, 28.52, 28.28, 28.05, 27.16, 26.59, 26.35, 23.39, 20.65, 18.52, 17.38, 15.94, 15.65. Refer to Figures S23 and S24.

Compound 13 Silica gel chromatography (dichloromethane/methanol = 120:1/100:1), with a yield of 75%. ¹H NMR δ 5.63 (s, 1H), 4.17–4.03 (m, 2H), 3.51–3.37 (m, 2H), 3.22 (dd, J = 10.3, 6.0 Hz, 1H), 2.85–2.73 (m, 1H), 2.33 (s, 1H), 2.14–1.93 (m, 4H), 1.93–1.72 (m, 5H), 1.72–1.61 (m, 6H), 1.61–1.49 (m, 7H), 1.48–1.26 (m, 10H), 1.23–1.09 (m, 10H), 1.03 (d, J = 5.8 Hz, 1H), 1.00 (s, 4H), 0.80 (s, 5H), 0.74–0.64 (m, 1H). ¹³C NMR δ 200.16, 176.42, 169.20, 128.52, 78.75, 77.00, 64.05, 61.79, 54.91, 48.37, 45.36, 43.99, 43.18, 41.04, 39.10, 37.73, 37.05, 33.51, 32.73, 32.19, 31.82, 31.08, 28.55, 28.41, 28.07, 27.90, 27.28, 26.45, 26.38, 24.64, 23.37, 18.65, 17.45, 16.34, 15.55. Refer to Figures S25 and S26.

Compound 14 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 87%. ¹H NMR δ 13.74 (dddd, J = 17.0, 9.4, 5.0, 1.7 Hz, 12H), 13.60 (ddd, J = 7.7, 5.7, 3.0 Hz, 8H), 11.43 (s, 1H), 10.05 (dd, J = 11.3, 5.9 Hz, 1H), 9.89 (d, J = 5.9 Hz, 1H), 9.86–9.81 (m, 1H), 9.72 (s, 1H), 9.16 (dd, J = 10.1, 6.1 Hz, 1H), 8.56 (s, 4H), 8.48 (d, J = 13.4 Hz, 2H), 8.20 (s, 1H), 7.89 (q, J = 15.2, 12.6 Hz, 5H), 7.76 (s, 2H), 7.50 (d, J = 13.0 Hz, 6H), 7.32 (s, 2H), 7.17 (d, J = 8.7 Hz, 4H), 7.09 (d, J = 9.4 Hz, 2H), 7.07–6.78 (m, 19H), 6.70 (d, J = 4.7 Hz, 7H), 6.59 (d, J = 11.2 Hz, 2H). ¹³C NMR δ 200.12, 176.20, 169.97, 134.91, 133.77, 133.64, 130.44, 130.27, 127.93, 118.78, 117.64, 78.37, 77.02, 63.87, 61.67, 54.73, 48.77, 45.32, 43.94, 43.16, 41.13, 39.02, 38.96, 37.41, 36.98, 32.58, 31.77, 30.93, 28.52, 28.27, 28.01, 27.10, 26.41, 26.25, 25.65, 23.21, 22.49, 22.18, 18.59, 17.36, 16.27, 15.55. Refer to Figures S27 and S28.

Compound 15 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 87%. ¹H NMR δ 7.94 (dd, J = 11.5, 7.6 Hz, 5H), 7.85–7.75 (m, 3H), 7.71 (dq, J = 8.0, 4.8, 3.9 Hz, 5H), 4.11 (s, 1H), 3.24 (s, 2H), 2.17–2.06 (m, 3H), 2.06–1.78 (m, 12H), 1.75 (s, 5H), 1.61 (d, J = 12.1 Hz, 9H), 1.39 (d, J = 9.2 Hz, 9H), 1.35–1.08 (m, 20H), 1.02 (d, J = 10.5 Hz, 9H), 0.86–0.67 (m, 10H). ¹³C NMR δ 200.32, 176.21, 170.08, 134.58, 134.15, 134.03, 130.12, 128.03, 116.08, 115.00, 78.40, 77.00, 63.93, 61.74, 54.77, 48.82, 45.39, 43.95, 43.21, 41.11, 39.05, 37.41, 37.06, 32.61, 31.79, 30.92, 29.98, 29.58, 28.53, 28.27, 28.02, 27.68, 27.12, 26.44, 26.27, 25.56, 25.26, 23.21, 21.93, 20.25, 19.60, 18.63, 17.38, 16.31, 15.55. Refer to Figures S29 and S30.

Compound 16 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 88%. ¹H NMR δ 7.67 (dd, J = 12.4, 8.0 Hz, 6H), 7.46 (dd, J = 8.2, 3.2 Hz, 6H), 5.53 (s, 1H), 4.10 (s, 1H), 3.97 (dd, J = 10.9, 5.6 Hz, 1H), 3.62 (s, 1H), 3.25 (dd, J = 10.5, 5.8 Hz, 1H), 2.64 (d, J = 12.1 Hz, 2H), 2.58 (s, 4H), 2.47 (s, 9H), 2.30 (s, 1H), 1.95 (d, J = 10.4 Hz, 3H), 1.87–1.73 (m, 4H), 1.66 (s, 4H), 1.35 (s, 4H), 1.23–1.02 (m, 12H), 1.00 (s, 4H), 0.79 (d, J = 7.5 Hz, 6H), 0.69 (d, J = 11.1 Hz, 1H). ¹³C NMR δ 200.08, 176.21, 169.82, 146.10, 146.06, 133.57, 133.44, 131.13, 130.96, 128.05, 115.59, 114.42, 78.41, 77.01, 63.91, 61.70, 54.76, 48.71, 45.33, 43.93, 43.17, 41.13, 39.03, 37.45, 37.01, 32.60, 31.76, 30.93, 28.50, 28.42, 28.27, 28.02, 27.51, 27.29, 27.11, 26.41, 26.27, 23.24, 22.46, 21.78, 18.59, 17.37, 16.24, 15.55. Refer to Figures S31 and S32.

Compound 17 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 90%. ¹H NMR δ 7.69 (dd, J = 11.9, 8.5 Hz, 7H), 7.16 (dd, J = 8.8, 2.6 Hz, 7H), 5.53 (s, 1H), 4.15–4.05 (m, 1H), 4.01–3.91 (m, 3H), 3.90 (s, 9H), 3.48 (s, 1H), 3.28–3.17 (m, 1H), 2.65 (d, J = 13.2 Hz, 1H), 2.30 (s, 1H), 1.95 (d, J = 9.5 Hz, 3H), 1.80 (s, 5H), 1.39 (d, J = 12.8 Hz, 3H), 1.35 (s, 4H), 1.27 (t, J = 9.1 Hz, 3H), 1.16 (d, J = 16.3 Hz, 4H), 1.11–1.01 (m, 10H), 0.99 (s, 4H), 0.78 (d, J = 4.7 Hz, 6H), 0.68 (d, J = 11.3 Hz, 1H). ¹³C NMR δ 200.17, 176.23, 169.86, 164.47, 135.53, 135.37, 128.06, 116.16, 115.97, 109.54, 108.30, 78.40, 77.01, 63.96, 61.72, 55.90, 54.76, 48.74, 45.33, 43.94, 43.18, 41.12, 39.03, 37.46, 37.02, 34.62, 32.61, 31.77, 30.95, 28.51, 28.27, 28.02, 27.58, 27.11, 26.41, 26.27, 24.03, 23.24, 22.40, 18.61, 17.37, 16.27, 15.56. Refer to Figures S33 and S34.

Compound 18 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 82%. ¹H NMR δ 7.81 (d, J = 7.5 Hz, 12H), 5.45 (s, 1H), 4.19 (s, 1H), 4.07 (d, J = 15.9 Hz, 1H), 3.98–3.87 (m, 1H), 3.23 (t, J = 8.0 Hz, 1H), 2.44 (d, J = 13.5 Hz, 1H), 2.30 (d, J = 17.5 Hz, 5H), 1.90 (dt, J = 27.4, 14.7 Hz, 6H), 1.67 (s, 3H), 1.59 (s, 4H), 1.35 (s, 6H), 1.27–1.11 (m, 5H), 1.08 (s, 4H), 1.05–0.92 (m, 8H), 0.89 (s, 1H), 0.83–0.75 (m, 6H), 0.68 (d, J = 11.3 Hz, 1H). ¹³C NMR δ 200.32, 176.16, 170.58, 135.31, 135.16, 133.93, 133.76, 131.17, 127.81, 117.23, 116.06, 78.38, 77.01, 63.90, 61.71, 54.75, 48.99, 45.42, 44.00, 43.23, 41.24, 39.04, 37.39, 37.02, 36.08, 34.95, 34.66, 32.59, 31.82, 30.97, 28.60, 28.31, 28.02, 27.14, 26.27, 24.74, 23.22, 22.58, 18.65, 17.37, 16.27, 15.55. Refer to Figures S35 and S36.

Compound 19 Silica gel chromatography (dichloromethane/methanol = 120:1/100:1), with a yield of 70%. ¹H NMR δ 5.63 (s, 1H), 4.09 (td, J = 6.6, 1.6 Hz, 2H), 3.51–3.36 (m, 2H), 3.28–3.16 (m, 1H), 2.78 (dt, J = 13.4, 3.6 Hz, 1H), 2.33 (s, 1H), 2.15–1.96 (m, 3H), 1.88 (ddt, J = 13.1, 10.6, 4.9 Hz, 4H), 1.73–1.57 (m, 7H), 1.51 (s, 5H), 1.46–1.27 (m, 10H), 1.27–1.09 (m, 10H), 1.00 (s, 5H), 0.80 (s, 5H), 0.75–0.65 (m, 1H). ¹³C NMR δ 200.16, 176.44, 169.24, 128.51, 78.75, 77.00, 64.26, 61.79, 54.91, 48.37, 45.36, 43.98, 43.19, 41.05, 39.10, 38.66, 37.72, 37.06, 33.75, 32.74, 32.56, 31.81, 31.10, 28.55, 28.41, 28.07, 27.72, 27.28, 26.45, 26.39, 25.23, 23.38, 18.65, 17.47, 16.35, 15.55. Refer to Figures S37 and S38.

Compound 20 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 86%. ¹H NMR δ 7.89–7.59 (m, 11H), 4.03 (q, J = 5.9 Hz, 1H), 3.75 (d, J = 7.8 Hz, 1H), 1.97 (s, 1H), 1.82 (d, J = 12.7 Hz, 3H), 1.70 (s, 2H), 1.60 (t, J = 10.2 Hz, 5H), 1.41 (s, 2H), 1.38–1.23 (m, 5H), 1.22–1.00 (m, 8H), 0.99 (s, 2H), 0.77 (d, J = 6.1 Hz, 4H). ¹³C NMR δ 200.18, 176.32, 169.64, 134.95, 133.69, 133.56, 130.50, 130.33, 128.18, 118.81, 117.67, 78.42, 77.03, 64.20, 61.70, 54.76, 48.46, 45.29, 43.90, 43.15, 41.03, 39.02, 37.56, 36.94, 32.61, 31.73, 30.96, 30.31, 30.09, 28.51, 28.43, 28.31, 28.02, 27.10, 26.38, 26.27, 25.86, 23.31, 22.56, 18.60, 17.36, 16.28, 15.56. Refer to Figures S39 and S40.

Compound 21 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 87%. ¹H NMR δ 7.95–7.64 (m, 6H), 4.15–3.89 (m, 2H), 3.27–3.17 (m, 1H), 1.88–1.72 (m, 5H), 1.71–1.49 (m, 7H), 1.41 (d, J = 11.5 Hz, 3H), 1.36 (s, 2H), 1.33–1.21 (m, 3H), 1.11 (d, J = 2.3 Hz, 5H), 1.07 (s, 1H), 1.00 (s, 3H), 0.82–0.65 (m, 4H). ¹³C NMR δ 200.14, 176.30, 169.68, 134.60, 133.99, 133.88, 130.20, 130.04, 128.16, 116.07, 115.02, 78.40, 77.03, 64.15, 61.74, 54.77, 48.47, 45.30, 43.88, 43.16, 40.99, 39.04, 37.54, 36.98, 32.61, 31.73, 31.26, 30.96, 30.22, 30.02, 28.51, 28.41, 28.30, 28.03, 27.11, 26.36, 26.27, 25.77, 25.56, 25.35, 25.19, 23.31, 21.89, 18.61, 17.37, 16.30, 15.55. Refer to Figures S41 and S42.

Compound 22 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 88%. ¹H NMR δ 7.55–7.34 (m, 6H), 7.24 (d, J = 3.2 Hz, 6H), 3.81 (q, J = 6.1 Hz, 2H), 3.33 (s, 1H), 2.25 (s, 7H), 2.23 (d, J = 1.8 Hz, 2H), 1.86–1.70 (m, 3H), 1.61 (d, J = 14.3 Hz, 5H), 1.15 (d, J = 9.6 Hz, 5H), 1.07–0.84 (m, 9H), 0.77 (s, 3H), 0.56 (d, J = 7.2 Hz, 4H). ¹³C NMR δ 200.15, 176.40, 169.60, 146.13, 133.52, 133.38, 131.17, 131.01, 128.32, 115.71, 114.49, 78.50, 77.01, 64.20, 61.72, 54.75, 48.45, 45.31, 43.91, 43.17, 41.05, 39.05, 37.59, 36.98, 34.13, 32.63, 31.75, 30.97, 30.32, 30.11, 28.50, 28.33, 28.04, 27.33, 27.15, 26.39, 25.81, 23.33, 22.55, 21.80, 18.60, 17.38, 16.29, 15.55. Refer to Figures S43 and S44.

Compound 23 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 88%. ¹H NMR δ 11.09–10.96 (m, 7H), 10.66–10.47 (m, 9H), 8.90 (s, 1H), 7.45–7.35 (m, 3H), 7.33–7.27 (m, 4H), 6.78 (s, 1H), 6.57 (dd, J = 10.4, 5.9 Hz, 1H), 6.02 (d, J = 13.2 Hz, 1H), 5.65 (s, 1H), 5.39–5.28 (m, 5H), 5.28–5.20 (m, 6H), 5.00 (s, 7H), 4.70 (s, 6H), 4.68–4.56 (m, 6H), 4.45 (d, J = 9.7 Hz, 12H), 4.34 (s, 5H), 4.13 (d, J = 5.9 Hz, 7H), 4.03 (d, J = 11.2 Hz, 2H). ¹³C NMR δ 200.07, 176.30, 164.47, 135.44, 135.29, 134.00, 128.14, 116.18, 116.00, 109.58, 108.34, 78.42, 77.03, 64.14, 61.71, 55.91, 55.86, 54.77, 48.44, 45.28, 43.88, 43.15, 41.03, 39.02, 37.57, 36.96, 32.61, 31.73, 30.96, 30.31, 30.10, 28.47, 28.28, 28.01, 27.10, 26.36, 26.27, 25.80, 23.30, 22.45, 18.58, 17.36, 16.27, 15.54. Refer to Figures S45 and S46.

Compound 24 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 80%. ¹H NMR δ 7.82 (s, 8H), 4.03 (s, 2H), 3.23 (s, 1H), 2.34 (s, 5H), 2.26 (d, J = 17.8 Hz, 2H), 1.35 (d, J = 5.6 Hz, 6H), 1.31–0.84 (m, 25H), 0.79 (d, J = 3.7 Hz, 6H), 0.67 (d, J = 10.1 Hz, 2H). ¹³C NMR δ 200.30, 176.42, 165.47, 135.34, 134.10, 133.95, 131.19, 123.30, 117.29, 112.58, 78.52, 77.00, 64.35, 61.77, 54.97, 48.64, 46.14, 45.35, 43.90, 42.41, 41.05, 39.06, 37.58, 36.98, 33.73, 32.64, 31.76, 31.05, 28.59, 28.04, 27.17, 26.47, 26.31, 26.11, 25.90, 23.37, 22.73, 20.79, 18.70, 17.38, 16.32, 15.65. Refer to Figures S47 and S48.

Compound 25 Silica gel chromatography (dichloromethane/methanol = 120:1/100:1), with a yield of 60%. ¹H NMR δ 5.64 (s, 1H), 4.08 (td, J = 6.7, 2.5 Hz, 2H), 3.40 (t, J = 6.9 Hz, 2H), 3.22 (dd, J = 10.3, 6.0 Hz, 1H), 2.79 (dt, J = 13.5, 3.6 Hz, 1H), 2.33 (s, 1H), 2.16–1.76 (m, 9H), 1.62 (d, J = 13.6 Hz, 8H), 1.42 (p, J = 5.0 Hz, 5H), 1.39–1.17 (m, 22H), 1.17–1.09 (m, 11H), 1.00 (s, 7H), 0.80 (s, 7H), 0.69 (dd, J = 11.6, 2.2 Hz, 2H). 13C NMR δ 200.15, 176.47, 169.25, 128.52, 78.75, 76.99, 64.51, 61.79, 54.91, 48.32, 45.35, 43.97, 43.18, 41.04, 39.10, 37.73, 37.06, 34.05, 32.80, 32.74, 31.80, 31.12, 29.72, 29.35, 29.30, 29.10, 28.68, 28.54, 28.42, 28.12, 28.07, 27.29, 26.45, 25.94, 23.76, 23.39, 18.65, 17.47, 16.35, 15.55. Refer to Figures S49 and S50.

Compound 26 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 81%. ¹H NMR δ 7.31 (d, J = 7.9 Hz, 7H), 7.17 (td, J = 7.0, 6.4, 3.1 Hz, 9H), 6.73 (s, 1H), 5.08 (s, 1H), 3.57–3.47 (m, 2H), 2.69 (dd, J = 10.0, 6.1 Hz, 1H), 2.21 (d, J = 13.8 Hz, 1H), 1.79 (s, 1H), 1.55 (s, 5H), 1.50–1.30 (m, 3H), 1.14–0.99 (m, 11H), 0.92–0.81 (m, 6H), 0.77–0.69 (m, 7H), 0.68 (s, 5H), 0.58 (d, J = 8.2 Hz, 10H), 0.46 (s, 5H), 0.25 (s, 6H), 0.15 (d, J = 11.3 Hz, 1H). ¹³C NMR δ 200.19, 176.44, 169.37, 134.95, 133.65, 133.52, 130.53, 130.36, 128.34, 118.81, 117.68, 78.50, 77.03, 64.37, 61.71, 54.79, 48.27, 45.29, 43.88, 43.14, 40.98, 39.02, 37.65, 36.96, 32.65, 31.73, 31.00, 30.41, 30.20, 29.23, 28.98, 28.56, 28.47, 28.34, 28.02, 27.16, 26.37, 25.81, 24.34, 23.31, 23.05, 22.57, 20.81, 18.59, 17.38, 16.27, 15.55. Refer to Figures S51 and S52.

Compound 27 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 80%. ¹H NMR δ 7.95–7.85 (m, 2H), 7.85–7.80 (m, 2H), 7.80–7.65 (m, 4H), 7.58–7.42 (m, 2H), 4.10–3.99 (m, 1H), 3.17 (s, 1H), 2.34 (d, J = 10.4 Hz, 3H), 2.12–2.02 (m, 2H), 1.59 (tt, J = 10.9, 5.2 Hz, 5H), 1.41 (s, 2H), 1.38–1.22 (m, 9H), 1.19 (s, 2H), 1.18–1.07 (m, 9H), 0.99 (s, 5H), 0.78 (d, J = 3.3 Hz, 4H). ¹³C NMR δ 200.11, 176.40, 169.29, 134.57, 133.90, 133.79, 131.45, 131.04, 130.93, 130.21, 130.05, 128.38, 116.00, 114.94, 78.49, 76.98, 64.33, 61.69, 54.78, 48.24, 45.26, 43.85, 43.11, 40.95, 39.00, 37.62, 37.46, 36.94, 32.63, 31.70, 31.55, 30.97, 30.36, 30.16, 29.14, 28.98, 28.91, 28.85, 28.52, 28.44, 28.30, 28.00, 27.15, 26.29, 26.11, 25.76, 25.58, 25.29, 25.22, 25.10, 24.65, 23.28, 22.00, 18.56, 17.36, 16.25, 15.51. Refer to Figures S53 and S54.

Compound 28 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 79%. ¹H NMR δ 7.61 (d, J = 12.1 Hz, 5H), 7.47 (d, J = 6.7 Hz, 6H), 4.05 (t, J = 6.5 Hz, 2H), 3.22 (t, J = 8.1 Hz, 1H), 2.47 (s, 9H), 2.03–1.84 (m, 5H), 1.58 (q, J = 6.1, 5.4 Hz, 12H), 1.35 (s, 5H), 1.33–1.21 (m, 11H), 1.21–1.12 (m, 8H), 1.10 (d, J = 1.8 Hz, 6H), 0.99 (s, 5H), 0.78 (s, 6H), 0.69 (t, J = 6.1 Hz, 2H). ¹³C NMR δ 200.14, 176.44, 169.34, 146.16, 146.12, 133.50, 133.37, 131.20, 131.03, 128.33, 115.68, 114.50, 78.56, 76.99, 64.38, 61.72, 54.81, 48.29, 45.30, 43.89, 43.16, 41.00, 40.33, 39.03, 37.66, 36.98, 35.44, 32.67, 31.74, 31.02, 30.51, 30.30, 29.92, 29.25, 29.04, 28.58, 28.47, 28.34, 28.02, 27.15, 26.38, 25.84, 23.32, 22.56, 21.78, 18.60, 17.39, 16.26, 15.52. Refer to Figures S55 and S56.

Compound 29 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 80%. ¹H NMR δ 7.67 (td, J = 12.6, 12.0, 8.5 Hz, 5H), 7.17 (dt, J = 9.2, 2.5 Hz, 5H), 4.05 (td, J = 6.7, 2.0 Hz, 2H), 3.91 (s, 7H), 3.35 (s, 1H), 1.95 (s, 4H), 1.42 (s, 3H), 1.36 (d, J = 7.0 Hz, 5H), 1.33–1.19 (m, 12H), 1.17–1.05 (m, 10H), 0.99 (s, 4H), 0.78 (s, 5H). ¹³C NMR δ 200.24, 176.54, 164.48, 150.21, 146.32, 135.41, 135.26, 128.34, 116.21, 116.03, 109.58, 108.33, 78.51, 77.01, 64.31, 61.71, 55.90, 54.79, 48.29, 45.29, 43.89, 43.14, 40.97, 39.03, 37.65, 36.96, 32.65, 31.74, 31.00, 30.30, 29.26, 29.06, 28.99, 28.58, 28.48, 28.34, 28.01, 27.17, 26.46, 26.30, 25.85, 25.75, 25.55, 23.32, 22.53, 18.59, 17.38, 16.27, 15.53. Refer to Figures S57 and S58.

Compound 30 Silica gel chromatography (dichloromethane/methanol = 60:1/40:1), with a yield of 70%. ¹H NMRδ 7.81 (d, J = 16.5 Hz, 16H), 5.37 (s, 1H), 4.41 (s, 1H), 3.29–3.18 (m, 2H), 2.74 (d, J = 12.4 Hz, 1H), 2.32 (d, J = 9.3 Hz, 9H), 1.44–1.21 (m, 17H), 1.15 (p, J = 4.9, 4.2 Hz, 8H), 1.10 (d, J = 6.9 Hz, 10H), 1.05–0.88 (m, 13H), 0.77 (d, J = 18.7 Hz, 11H), 0.69 (d, J = 11.1 Hz, 2H), 0.06 (s, 2H). ¹³C NMR δ 199.90, 175.86, 169.49, 135.12, 134.98, 134.24, 134.07, 131.57, 116.65, 115.48, 78.58, 77.00, 61.77, 54.85, 48.38, 45.29, 43.88, 43.19, 39.07, 37.57, 37.04, 32.65, 31.75, 30.97, 28.49, 28.04, 27.20, 26.32, 23.35, 18.65, 17.40, 16.32, 15.55. Refer to Figures S59 and S60.

4.2. Cell Lines and Materials

Human non-small cell lung cancer A549 cells, human hepatocellular carcinoma HepG2 cells, human prostate cancer PC-3M cells, human breast cancer MDA-MB-231 cells, and murine lung cancer LLC1 (LL/2) cells, NCI-H1299 human non-small cell lung cancer (NSCLC) adenocarcinoma cells were purchased from Wuhan Procell Life Science & Technology Co., Ltd. (Wuhan, China). Primary mouse lung cells were isolated from neonatal mice: briefly, neonatal mice were sacrificed under sterile conditions, lung tissues were dissected, minced into small pieces, digested with trypsin, and then filtered through a cell sieve to obtain single-cell suspension, which was further purified and cultured for subsequent experiments. All cell lines underwent short tandem repeat (STR) profiling for authentication and mycoplasma contamination testing upon receipt. Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), penicillin, and streptomycin were obtained from Gibco BRL (Thermo Fisher Scientific, Waltham, MA, USA). The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay kit was purchased from Sigma-Aldrich. Hoechst 33342/propidium iodide (PI) dual-staining apoptosis detection kit, phosphate-buffered saline (PBS), reactive oxygen species (ROS) assay kit, trypsin, TRIzol reagent, and radioimmunoprecipitation assay (RIPA) lysis buffer were all acquired from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). Enhanced chemiluminescence (ECL) reagent, EdU-594 cell proliferation assay kit, and 1% crystal violet staining solution were supplied by Beyotime Institute of Biotechnology (Shanghai, China). Positive control agents including cisplatin, doxorubicin, gemcitabine, and docetaxel were purchased from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Triphenylphosphine, diphenylcyclohexylphosphine, tris(p-tolyl)phosphine, tris(4-methoxyphenyl)phosphine, and tris(4-bromophenyl)phosphine were obtained from Shanghai Macklin Biochemical Co., Ltd. (Shanghai, China). The EVOS M5000 fluorescence microscope was purchased from Thermo Fisher Scientific (Waltham, MA, USA).

A549, HepG2, and MDA-MB-231 cells were cultured in DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in a 5% CO₂ humidified incubator. PC-3M, NCI-H1299 cells were maintained in RPMI-1640 medium under identical culture conditions with the same supplements. All test compounds were dissolved in dimethyl sulfoxide (DMSO) to prepare 20 mM stock solutions.

4.3. Determination of Cytotoxic Activity

Briefly, cells were seeded into 96-well plates at a density of 5 × 10³ cells per well. When cells adhered to the plate and reached 60–70% confluence, drug treatment was performed. Different concentrations of test drugs were added to each well to achieve the preset final concentrations, and the 96-well plates were then incubated in a 37 °C, 5% CO₂ incubator. After incubation, 10 μL of MTT solution was added to each well, followed by further incubation.

4.4. Cell Colony Formation Assay

Cells were treated with different concentrations of test drugs. At the end of culture, cells were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet for 30 min. After washing with PBS, colony formation was observed and counted under a microscope.

4.5. EdU Cell Proliferation Assay

A549 cells were treated with test compounds, labeled with EdU594, fixed, permeabilized, and processed for Click reaction followed by Hoechst 33342 staining. Cell proliferation was assessed via microscopy.

4.6. Cell Migration Assay

A549 cells were resuspended in serum-free DMEM at 1 × 10⁵ cells/mL, and 100 μL cell suspension was seeded into the upper Transwell chamber. The lower chamber contained 600 μL DMEM supplemented with 30% FBS as a chemoattractant. After 24 h incubation, migrated cells on the lower membrane surface were rinsed with PBS, fixed in methanol for 30 min, and stained with 0.1% crystal violet for 20 min.

4.7. Cell Invasion Assay

The cell invasion assay was performed as described in Section 4.6, with the exception that the upper Transwell membrane was pre-coated with diluted Matrigel, which was polymerized at 37 °C for 30 min before cell seeding.

4.8. Cell Cycle Assay

A549 cells were treated with test compounds, fixed in ethanol, stained with PI/RNase buffer, and subjected to cell cycle analysis using flow cytometry.

4.9. Apoptosis Assay Using Hoechst 33342/PI Staining Kit

Cells were treated with different concentrations of test drugs and incubated for 48 h. After incubation, the apoptotic morphological changes in cells were evaluated using the Hoechst 33342/propidium iodide (PI) double-staining kit (Solarbio) according to the manufacturer’s instructions. Apoptotic cells characterized by chromatin condensation, nuclear fragmentation, and nuclear pyknosis were identified and counted under a fluorescence microscope. Necrotic cells exhibited strong red and blue fluorescence.

4.10. Analysis of Intracellular ROS Level

Cells were treated with different concentrations of test drugs, and an additional group was pretreated with 2.0 μM GSH (a specific ROS scavenger) for 1 h prior to drug treatment. All groups were then incubated for 24 h. Subsequently, following the instructions of the ROS Assay Kit (Solarbio, Beijing, China, Cat. No. CA1420), cells were incubated with dihydroethidium (DHE) at 37 °C in the dark for 30 min. After incubation, cells were stained with Hoechst 33342 solution for 10 min to label cell nuclei, followed by observation under a fluorescence microscope.

4.11. Transcriptome Analysis

Total RNA was extracted via TRIzol, with subsequent purification, reverse transcription, library construction, and sequencing performed by Shanghai Miaolue Biotechnology Co., Ltd. (Shanghai, China). Gene abundance was quantified using RSEM, and differential expression analysis was conducted with DESeq2 and DEGseq packages. Differentially expressed genes (DEGs) were defined as |log₂(fold change)| ≥ 1 with FDR ≤ 0.05 (DESeq2) or FDR ≤ 0.001 (DEGseq). KEGG and GO enrichment analyses of DEGs were performed using Metascape and other bioinformatics tools.

4.12. Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR) Analysis

Total RNA was extracted from cells of each group using TRIzol reagent. Reverse transcription and polymerase chain reaction (PCR) were performed using HiScript II Reverse Transcription Kit (Vazyme, Nanjing, China) to detect the expression levels of target genes. The primer sequences used in this experiment are listed in

Table 2. Sequences of the primers for real-time RT-PCR.

Gene	Forward Primer (5′–3′)	Reverse Primer (5′–3′)
TNF	CACAGTGAAGTGCTGGCAAC	AGGAAGGCCTAAGGTCCACT
CEBPP	AGCGACGAGTACAAGATCCG	CAGGACCTTATGCTGCGTCT
IL6	ATGCTGGGACCTGGACCTGAAT	ATTGGCCTGACCTGGGACCTG
BCL2	CGAGTGGGATACTGGAGATG	AGGCTGGAAGGAGAAGATGC
CASP3	GAGCTTGGAACGCGAAGAAA	TTGCGAGCTGACATTCCAGT
ACTB	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT

.

4.13. Western Blot Analysis of Related Proteins

Total proteins were extracted using RIPA lysis buffer from two groups of A549 cells: one group preconditioned with Infliximab followed by Compound 17 treatment, and the other group treated with Compound 17 alone. Proteins were separated by 10% SDS-PAGE, transferred onto PVDF membranes, and blocked with 5% non-fat milk. Membranes were rinsed with TBST, incubated with primary antibodies overnight at 4 °C, then with HRP-conjugated secondary antibodies for 2 h at room temperature. Protein bands were visualized via ECL reagents and quantified using ImageJ 2.3.0 software.

4.14. Molecular Docking

Molecular docking simulations were performed using AutoDock Vina 1.2.3 software. The three-dimensional (3D) structure of compound 17 was constructed with ChemDraw 20.0, while the 3D crystal structure of the TNF protein was retrieved from the Protein Data Bank (PDB). Prior to docking, the protein structure was subjected to preprocessing procedures including water molecule removal and hydrogen atom addition. Post-docking results were visualized using Discovery Studio 2020 software.

4.15. Experimental Animals

Forty specific pathogen-free (SPF) C57BL/6 mice (male, 6–8 weeks old) were purchased from Liaoning Changsheng Biotechnology Co., Ltd. Shenyang, Liaoning, China. (SCXK (Liao) 2025-0001). All mice were housed in an SPF-grade animal facility. After a 7-day acclimatization period, a xenograft tumor model was established. All animal experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of Jilin Agricultural University.

4.16. Tumor-Bearing Mouse Experiment

Mice were randomly assigned to different groups using a random number table method. First, all mice were anesthetized with 3–4% isoflurane in 100% oxygen (flow rate: 1.5 L/min) via a nose cone; after successful induction, the isoflurane concentration was adjusted to 1.5–2% for anaesthetic maintenance. Subsequently, 0.2 mL of LLC (LL/2; LLC1) cell suspension (1 × 10⁷ cells/mL) was subcutaneously injected into the left anterior axillary fossa of each anaesthetized mouse. When the tumor volume reached approximately 100 mm³, the mice were randomly divided into 5 groups (n = 8 per group). The dose range of Compound 17 for in vivo experiments was rationally selected based on its in vitro cytotoxicity results against A549 cells and the preliminary acute toxicity test data of mice, with the low, medium and high doses set as 5 mg/kg, 10 mg/kg and 20 mg/kg, respectively. The positive drug group was intraperitoneally injected with cisplatin (5 mg/kg, a clinically recommended dose for anti-lung cancer studies in mice); the low-dose Compound 17 group, medium-dose Compound 17 group and high-dose Compound 17 group were intraperitoneally injected with Compound 17 at the above corresponding doses; the model group was intraperitoneally injected with an equal volume of normal saline. Throughout the experiment, the tumor volume of each mouse was recorded daily. The maximum diameter (a, unit: mm) and minimum diameter (b, unit: mm) of each mouse’s tumor were measured using a vernier caliper, and the tumor volume (V, unit: mm³) was calculated by the formula: V = 1/2 × a × b². Administration was performed once every 3 days for 11 consecutive days. On the 15th day, all mice were euthanized by cervical dislocation, and the organ and tumor tissues were harvested separately. This study was conducted in accordance with the ARRIVE guidelines [50]. All experiments were carried out following relevant guidelines and regulations, complying with the International Guiding Principles for Biomedical Research Involving Animals [51].

4.17. Histopathological Analysis

The relevant organs and tumor tissues were fixed in 4% paraformaldehyde solution for 72 h, followed by dewaxing, dehydration, and paraffin embedding procedures. The embedded samples were sectioned into tissue slices, which were immersed in hematoxylin staining solution for 2 min and immediately rinsed in eosin solution for 1 min for counterstaining. After staining, the morphological and structural changes in cells in tumor and organ tissues were observed under a microscope to evaluate tumor growth status, apoptosis and necrosis levels, as well as the effects of drugs on tissues. By comparative observation of tissue sections from different groups, the efficacy of compound 17 in lung cancer treatment and its potential toxic and side effects on normal organs were analyzed.

4.18. Immunohistochemical (IHC) Staining

Following dewaxing and hydration, paraffin sections underwent heat-induced antigen retrieval in citrate buffer (pH 6.0). Endogenous peroxidase was quenched with 3% H₂O₂, and sections were blocked with 10% normal goat serum. Primary antibodies against Ki-67, TUNEL, and TNF-α were applied overnight at 4 °C. After washing, HRP-conjugated secondary antibodies were incubated at 37 °C for 30 min. Immunoreactivity was visualized with DAB, counterstained with hematoxylin, dehydrated, cleared, and mounted. Images were captured and analyzed via digital slide scanner.

4.19. Survival Analysis

Sixty mice were randomly divided into five groups: model group, positive drug group, low-dose group, medium-dose group, and high-dose group. Mice in each group were administered the corresponding doses consistent with the protocol described in 4.16. The number of dead mice was recorded daily, and the experiment was terminated 75 days after drug administration. Statistical analysis of the experimental survival data was then performed.

4.20. Detection of Related Biochemical Indicators

The levels of superoxide dismutase (SOD), malondialdehyde (MDA), glutathione (GSH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), creatinine (CRE), creatine kinase isoenzyme MB (CK-MB), as well as the concentrations of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in mouse serum, were detected using assay kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The specific batch numbers of each kit are as follows: SOD (Batch No.: A001-1-1), MDA (Batch No.: A003-1-1), GSH (Batch No.: A006-1-1), ALT (Batch No.: C009-1-1), AST (Batch No.: C010-1-1), BUN (Batch No.: C013-1-1), CRE (Batch No.: C011-1-1), CK-MB (Batch No.: A032-1-1), IL-6 (Batch No.: H007-1-1), and TNF-α (Batch No.: H052-1-1). All detection operations were strictly performed in accordance with the instructions provided with each kit, and the specific standardized procedures are as follows: 1. Preparation of mouse serum samples. 2. Reagent preparation: Prepare working solutions at the volume ratio specified in the instructions. 3. Sample loading: Sequentially add 50 μL of processed serum samples and 150 μL of prepared working solutions into the corresponding wells of a 96-well microplate. 4. Incubation: Incubate the 96-well microplate in a constant temperature incubator at 37 °C. 5. Color development and detection: After incubation, add stop solution (if required by the kit) to terminate the reaction, and then measure the absorbance (OD value) of each well at the specific wavelength specified in the instructions using a microplate reader. 6. Result calculation: Draw a standard curve with the standard substances provided in the kit to calculate the concentration or activity of each indicator in the serum samples, and the results are expressed as mean ± standard deviation (Mean ± SD).

4.21. Statistical Analysis

All statistical analyses were conducted using GraphPad Prism 8.0, with data presented as mean ± standard error of the mean (SEM). One-way analysis of variance (ANOVA) was used to compare differences among three or more groups. Student’s t-test was applied for two-group comparisons, except for RNA sequencing data, which was analyzed using Fisher’s exact test. Statistical significance was defined as p < 0.05.

5. Conclusions

Compound 17 effectively modulates apoptotic signaling pathways and promotes apoptosis by inhibiting TNF pathway activation, thereby suppressing lung cancer initiation and progression. These findings identify potential molecular targets and lead compounds for developing novel lung cancer therapeutic strategies, with significant clinical implications. Future studies will further explore Compound 17’s pharmacological properties, dose–response relationships, and therapeutic potential in lung cancer treatment.