Next Article in Journal
α-Klotho Supplementation Mitigates Cumulative Exercise-Induced Fatigue via Coordinated NRF2-Mediated Antioxidant Defense and AKT/GS-Driven Hepatic Glycogen Supercompensation in Mice
Next Article in Special Issue
Vitamin D and Metabolic Dysfunction-Associated Steatotic Liver Disease: Molecular Mechanisms and Clinical Implications—A Narrative Review
Previous Article in Journal
Structure–Function Interplay in Piezoelectric PCL/BaTiO3 Scaffolds Fabricated by Phase Separation: Correlation of Morphology, Mechanics, and Cytocompatibility
Previous Article in Special Issue
Pathophysiological Role of Vitamin D Deficiency in Down Syndrome: Insights into Metabolic Dysfunction and Sarcopenia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 27
Issue 1
10.3390/ijms27010409
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Search for Potential VDR/Partner Composite Elements in Regulatory DNA of Genes Associated with Respiratory Infections and Atopic Diseases

by
Alexey V. Popov
1,*,
Dmitry Yu. Oshchepkov
2,
Vladislav V. Kononchuk
1,
Tatiana S. Kalinina
1,
Ilya S. Valembakhov
1,
Alexander D. Lukin
1,3,
Elena G. Kondyurina
4,
Vera V. Zelenskaya
4 and
Valentin Vavilin
1
1
Institute of Molecular Biology and Biophysics, Federal Research Center of Fundamental and Translational Medicine, Novosibirsk 630060, Russia
2
Institute of Cytology and Genetics, Novosibirsk 630090, Russia
3
Department of Natural Sciences, Novosibirsk State University, Novosibirsk 630090, Russia
4
Department of Pediatrics, Faculty of Advanced Training and Professional Retraining, Novosibirsk State Medical University, Novosibirsk 630091, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2026, 27(1), 409; https://doi.org/10.3390/ijms27010409
Submission received: 12 November 2025 / Revised: 20 December 2025 / Accepted: 21 December 2025 / Published: 30 December 2025
(This article belongs to the Special Issue Vitamin D Signaling in Human Health and Diseases)
Browse Figures
Versions Notes

Abstract

Vitamin D deficiency is associated with the risk of atopic diseases and respiratory infections. The activated vitamin D receptor (VDR) forms a dimer with the retinoid X receptor alpha (RXRA) and binds to VDR/RXRA composite elements (CEs) in enhancers of target genes. However, VDR/RXRA CEs are identified in only 11.5% of cases in ChIP-Seq peaks. Our hypothesis was that VDR could form a VDR-Partner complex with transcription factor for which CEs have not yet been identified. We utilized Web-MCOT to search for novel VDR/Partner CEs in regulatory DNA. The potential formation of the VDR-Partner protein complex was assessed using the AlphaFold machine learning model. Through real-time RT-PCR, we measured the expression of immune system genes in a culture of U937 macrophage-like cells incubated with the active metabolite of vitamin D, calcitriol. We have predicted novel VDR/NR2C2 and VDR/PPARG CEs in the regulatory regions of immune system genes. We found potential synergism of VDR/NR2C2 and VDR/RXRA CEs in relation to the IRF5 gene, as well as potential synergism of VDR/PPARG and VDR/RXRA CEs for MAPK13. Predicting new regulatory relationships through the identification of new potential VDR/Partner CEs may provide insight into the deep mechanisms of vitamin D involvement in the pathogenesis of atopic dermatitis, bronchial asthma, allergic rhinitis, and pulmonary infections.

1. Introduction

Vitamin D deficiency is associated with the risk of atopic diseases and respiratory infections [1,2,3]. Vitamin D deficiency is also associated with the severity of COVID-19 [4]. Increasing evidence suggests a link between inadequate vitamin D levels in children and the frequency of respiratory infections, as well as their long-term consequences (such as wheeze) [5]. A compelling link has also been established between vitamin D deficiency and the severity of respiratory infections in infants and children [1,6,7]. Vitamin D levels at birth are associated with the development of respiratory syncytial virus bronchiolitis later in life. Newborns with cord blood 25OHD levels less than 20 ng/mL had an increased risk of developing lower respiratory tract infection in the first year of life compared to those with levels greater than 30 ng/mL [8]. Moreover, in a cohort of newborns hospitalized due to acute lower respiratory tract infections, 25OHD levels were significantly lower at 9 ng/mL compared to the control group at 16 ng/mL [9]. Research indicates that vitamin D supplementation can offer preventive benefits against influenza [3] and COVID-19 [10]. Furthermore, it has been observed that vitamin D can ameliorate symptoms in patients with COVID-19 [11]. Notably, vitamin D deficiency has been associated with asthma severity [1], and vitamin D supplementation may help reduce the severity of asthma and atopic dermatitis [12,13]. The active forms of vitamin D, calcitriol and 1,25-dehydroxyergocalciferol, are produced from cholecalciferol or ergocalciferol, respectively, through a series of hydroxylations at the 25- and 1ɑ-positions. 25-hydroxyvitamin D is synthesized in the liver by the enzyme vitamin D-25-hydroxylase. The subsequent 1ɑ-position hydroxylation occurs in immune system cells through CYP27B1 [14,15]. Cholecalciferol is obtained through dietary sources (primarily fatty fish) or synthesized in the skin from 7-dehydrocholesterol. Conversely, ergocalciferol is only available through food sources (mostly mushrooms) [16]. VDR is expressed in nearly all immune cells, including macrophages [8,17].
Macrophages play a crucial role in the etiopathogenesis of respiratory infections and atopy [18,19]. These immune response cells are involved not only in innate but also adaptive immunity. The immunomodulatory effects of vitamin D on macrophages are best explained by the binding of VDR to vitamin D response element (VDRE), as well as the interaction of VDR with inflammasome and IκB kinase β proteins [20,21]. Vitamin D increases the expression of mitogen-activated protein kinase phosphatase-1 (MKP-1) in monocytes and macrophages [22], leading to reduced TNFa and IL6 production and inhibition of p38 phosphorylation [23]. VDREs have been identified in the MKP-1 promoter region in mice and humans. MKP-1 deficiency results in overproduction of numerous factors, including proinflammatory cytokines TNFa, IL6, IL1B [24,25,26] anti-inflammatory cytokine IL10 [27,28,29], MIP-1α, MIP-1β, MCP-1 and CXCL2 [28,30], iNOS [31,32] and cyclooxygenase 2 [33]. Vitamin D can enhance TNFa expression by activating VDR, which binds to the VDRE in the TNFa promoter [34]. 1,25-Dihydroxyvitamin D bound to VDR directly induces transcription of cathelicidin, human beta-defensin 2, and IL1B via the VDRE present in the proximal promoters of the corresponding genes [35,36,37].
In our work, we examined the putative genomic interaction of VDR with novel potential cis-regulatory elements. Activated VDR forms a heterodimeric complex with RXRA and binds to hexameric A/GGG/TTC/GA motifs separated by a 3-nucleotide spacer, which are called DR3-responsive elements [38] or CEs. In ChIP-Seq peaks, CEs to the VDR-RXRA heterodimer are identified in only 11.5% of cases [39]. This may be due to the fact that studies on the possibility of forming overlapping VDR/RXRA motifs have not been previously conducted. Also, no analysis has been performed for the presence of other VDR/Partner CEs. The only tool for searching for overlapping motifs and motifs with spacers in a single ChIP-Seq is the Motifs Co-Occurrence Tool (MCOT). For a given “Anchor” motif and a set of input peaks, Web-MCOT checks the significance of CEs with various partner motifs from libraries obtained from the entire genome [40]. Also, relatively recently, the ability to model protein–protein interactions based on the AlphaFold machine learning model [41] has become possible, which provides additional arguments in favor of the functional activity of VDR complexes with unknown partners. The aim of this work was to test our hypothesis that VDR can form complexes with transcription factors for which CEs have not yet been found and to identify potential partners for VDR and their CEs that may be involved in the regulation of genes associated with atopy and pulmonary infections.

2. Results

2.1. Bioinformatics Analysis Results

According to MCOT computations, the Top 10 motifs that have the potential to create CEs with VDR encompass the already established RXRA, alongside PPARG, PPARA, and NR2C2 (refer to Table 1).
The BioGRID database, which compiles information on protein–protein interactions, contains data on the interaction of VDR transcription factor (TF) with RXRA and PPARG. A protein complex formation was demonstrated for VDR-PPARG in only one study to our knowledge [42]. It was observed that NR2C2 and PPARG recognize similar DNA sequences [43], hence NR2C2 TF could also be considered a partner of VDR. The consensus sequence for PPARG conforms to the classic version: vWbbRGGbSARAGGKSR (with a p-value of 2.61 × 10−10, E-value of 5.40 × 10−07, and q-value of 1.07 × 10−06), similar to PPARA (p-value = 4.26 × 10−09, E-value = 8.83 × 10−06, q-value = 8.74 × 10−06). The CEs for VDR-PPARA and VDR-PPARG in the target genes we identified showed substantial overlap in almost all cases. Therefore, the presence of PPARA in the MCOT output may be an artifact. Additionally, the top 10 motifs in the MCOT output included TFs like ATF2, MITF, TFE3, SPI1, USF1, and REL. However, none of these were listed as VDR partners in the BioGRID database. Consequently, the most probable VDR partners are the well-known TF RXRA (p-value = 6.0 × 10−30), as well as PPARG (p-value = 2.1 × 10−22) and NR2C2 (p-value = 9.1 × 10−34). The logos of potential VDR/Partner CEs are depicted in Figure 1.
To validate this prediction further, we built the VDR-NR2C2 protein complex using the AlphaFold program (Supplementary Figure S1).
Next, we counted all genes (98) whose regulatory DNA contained predicted CEs for the VDR-RXRA, VDR-PPARG, and VDR-NR2C2 complexes, according to the results of MCOT calculations on the VDR ChIP-Seq data for the THP-1 monocytic cell line culture (Table S1). 72 genes contained CEs in the VDR/RXRA regulatory regions: 15 genes contained VDR/PPARG; 16 genes contained VDR/NR2C2; 27 genes contained all three CEs variants; and 14 genes included neither VDR/NR2C2 nor VDR/PPARG. We also identified 26 genes that did not have VDR/RXRA in their enhancers but did contain VDR/NR2C2 and/or VDR/PPARG.
Note: Table S1 consists of information about occurrence or absence of potential CEs in enhancers of all 98 genes.
Among the ChEA 2022 genes we identified, the analysis revealed that, in addition to VDR, PPARG was among the top 10 regulators (see Table 2).
The genes with the highest search score in the aspect of bronchopulmonary infections and atopy from Table S1 in the Malacards search results (Table 3) were: NOD2, LGALS9, MAPK13, PDCD1LG2, NFKBIA, CD14, IRF5.
The NOD2 receptor (Nucleotide Binding Oligomerization Domain Containing 2) is a cytosolic protein involved in inflammatory processes associated with NFkB activation. NOD2 enhances NFkB transactivation in transfected cells [44]. The LGALS9 gene encodes galectin-9, a 36 kDa beta-galactoside lectin protein. Galectin-9 is an activator of NFkB, as Galectin-9 deficiency in dengue virus-infected dendritic cells suppressed this transcription factor [45]. MAPK13, a mitogen-activated protein kinase, is involved in the synthesis of IL6 [46]. PDCD1LG2 (PD-L2) (Programmed Cell Death 1 Ligand 2) is a transmembrane protein and a ligand for PD1. It prevents T-lymphocyte activation. PDCD1LG2 has an immunomodulatory effect on IL-10 [47,48]. It increases IFNg production. NFKBIA (NFkB Inhibitor Alpha) interacts with the p65, p50, and p52 subunits of NFkB [49,50,51]. CD14 is a receptor involved in regulating the production of IL10, IL6, IL8, and TNFa [52,53,54,55]. IRF5 is a TF involved in the regulation of IFNa, INFb, and IL12 [56].

2.2. Experimental Study Results on the Impact of Vitamin D on the Expression of Target Genes in U937 Cell Culture. Comparison of Experimental Findings in U937 Cells with Bioinformatics Analysis in THP-1 Cells

The next step was to confirm vitamin D-mediated regulation of the genes for which new CEs were identified in this study.
In U937 cells, 10 nM and 100 nM calcitriol increased the expression levels of PDCD1LG2, NFKBIA, IRF5, and LGALS9. MAPK13 expression increased only at a calcitriol concentration of 100 nM. NOD2 and CD14 did not respond to calcitriol (Figure 2).
Among the genes that exhibited increased expression in response to calcitriol, the most pronounced change was observed for IRF5 (refer to Figure 2). A potential VDR/NR2C2 CE was detected in the enhancer region of the gene about ~−2.3 kb from the transcription start site (TSS), along with another potential VDR/RXRA CE at about ~−25.1 kb from the TSS (see Table 4). The impact of 100 nM calcitriol on MAPK13 expression approximated that of IRF5. In the gene’s promoter region, we predicted two VDR/RXRA CEs about ~−0.3 kb from the TSS, together with another VDR/PPARG CE roughly ~+168.5 kb from the TSS.
We also noted an increase in LGALS9 expression. A potential VDR/Partner CE (with the partner being either RXRA or PPARG) was identified in the gene’s promoter about ~+1.2 kb from the TSS, and another potential VDR/NR2C2 CE approximately ~−297.2 kb from the TSS.
IRF5 and MAPK13 showed the most pronounced expression changes compared to PDCD1LG2 and NFKBIA. Regarding the PDCD1LG2 gene, we cannot consider the synergy of CEs since we only spotted one potential VDR/Partner CE (where the partner can be RXRA or PPARG), situated at a distance of ~−73 kb from the TSS. Thus, in this case, we only consider the competitive binding of the respective TFs. Concerning NFKBIA, we also discovered only one potential VDR/Partner CE (with the partner possibly being RXRA, PPARG, or NR2C2) around ~−1.3 kb from the TSS, leading us to consider only competitive binding here as well.

3. Discussion

3.1. Physiological Role of Vitamin D

Vitamin D plays a crucial role in human physiology and pathology. Apart from regulating calcium/phosphate metabolism, vitamin D is implicated in safeguarding against cancer chemoprevention, enhancing the cardiovascular system, detoxifying xenobiotics, shielding against neurodegenerative diseases, immunoregulation, and providing antimicrobial protection [57,58].

3.2. The Role of Vitamin D in the Differentiation of Macrophages and Macrophage-like Cells

Macrophages are among the most critical cells in the immune system. Vitamin D increases Tim-3 expression, leading to M2 polarization [59]. It has also been demonstrated that Vitamin D enhances IRF5 expression in THP-1 cells, indicating the formation of M1 quasi-macrophages [39]. Therefore, Vitamin D may play a role at all stages of the inflammatory process, helping to maintain homeostasis and regulate the number of macrophages with the desired phenotype.

3.3. Role of the Studied Vitamin D Target Genes in the Immune Response

Galectin-9 has an immunomodulatory effect on IL17 expression [60,61,62]. In a polymicrobial sepsis model, galectin-9 improved animal survival [61]. It reduced levels of IL6, IL10, HMGB1, and increased levels of IL15 and IL17 in plasma and spleen. Galectin-9 increased the count of natural killer T cells (NKT cells) and PDCA-1+ CD11c+ macrophages. Galectin-9 has demonstrated efficacy in a Dermatophagoides farinae allergen-induced asthma model by suppressing the expression of IL5, IL13, CCL11, CCL17, reducing eosinophilia, and pulmonary hyperresponsiveness [63]. Incubation of peripheral blood mononuclear cells with galectin-9 resulted in increased production of IL6 and IL10 [64]. Galectin-9 induced the secretion of TNFa, IL1B, IFNg, IL10, IL4, IL13 from peripheral blood mononuclear cells [65]. Galectin-9-induced dendritic cells stimulated the secretion of IFNg, IL10, TNFa, and IL2 from CD4+ T cells [66]. Furthermore, galectin-9 was found to suppress IFNg expression, indicating its immunomodulatory effects on this cytokine [67]. Galectin-9 also inhibited the formation of IgE-antigen complexes, thus preventing mast cell degranulation [68]. In an RSV infection model, galectin-9 increased the number of T regulatory cells, IL10 expression, and suppressed the Th17 response [69]. Galectin-9 binds to ACE2, inhibiting SARS-CoV-2 entry, reducing cell infection in vitro, and improving animal survival [70].
Polymorphic variants of CD14 are linked to the risk of complications in atopy and respiratory viral infections [53,71,72].
Polymorphic variants of NOD2 are associated with bronchial asthma [73].
MAPK13 demonstrates pro-inflammatory effects in a model of post-viral lung disease [74] but has not been thoroughly studied in asthma models.
IRF5 activates macrophages in response to the virus and promotes the M1 phenotype [75,76]. Overactivation of IRF5 can trigger a cytokine storm in COVID-19 [77]. In an atopic asthma model, IRF5 reduces lung hyperresponsiveness, mucus production, and IL13 [78].
Polymorphic variants of PDCD1LG2 are associated with allergic rhinitis [79].
NFKBIA is one of the most critical genes in the etiopathogenesis of bronchopulmonary diseases. Polymorphic variants in the NFKBIA promoter are linked to an increased risk of hospitalization in severe RSV bronchiolitis and pulmonary hyperresponsiveness among children with respiratory viral infections identified within the first 12 months of life [80,81]. Polymorphic variants of NFKBIA are also associated with the risk of COVID-19 infection [82].

3.4. Putative Synergism and Predicted Competing Effects of New Potential CEs on Immune Response Genes: Involvement of NR2C2 and PPARG in Inflammation

In our study, we observed that the combined presence of predicted VDR/RXRA CEs with VDR/NR2C2 or VDR/PPARG could potentially have an additive impact on IRF5 and MAPK13, respectively, in U937 culture. It was noted that the alteration in LGALS9 expression was not as striking as observed for IRF5 and MAPK13. This discrepancy might be attributed to the likely differences in chromosomal landscapes between U937 and THP-1 cells (these lines have different origin), potentially influenced by deletions, point mutations, and heterochromatin distribution. Moreover, it is worth considering that one of the dimers could potentially bind to the negative VDRE, or not bind at all, in the case of competing binding by other transcription factors that might impair enhanced expression. Within the regulatory regions of the PDCD1LG2 and NFKBIA genes, we predicted the presence of a CE supposing competing binding among VDR partners. Consequently, the anticipated effect might not be as robust as noted for IRF5 and MAPK13. Bioinformatics analysis illustrated equal possibilities of VDR-RXRA, VDR-PPARG, and VDR-NR2C2 complex formations. Nevertheless, given the notably higher expression of RXRA in comparison to PPARG and NR2C2 in cell cultures, it seems plausible to suggest that, in scenarios involving potential competing binding, RXRA would likely displace PPARG and NR2C2 from the complexes. We theorize that in instances of RXRA deficiency, VDR could potentially form a dimer with PPARG or NR2C2, thereby ensuring the functioning of VDR both in cases where potential competing influence of TF is present and in scenarios where potential synergism was detected. PPARG is known to have an immunomodulatory effect [83,84]. Our study indicated that PPARG potentially stimulates the increased expression of MAPK13, hinting at its immunostimulatory influence. Strategic regulation of PPARG expression might enable a response to pathogens and help prevent respiratory syncytial virus infections, which are often associated with atopy [85]. On the other hand, NR2C2 is recognized for its proinflammatory effects during bacterial infections as it augments NFkB expression, thereby fostering the production of IL1B and IL6 in macrophages [86]. We predicted that NR2C2 could potentially bind to the IRF5 promoter, possibly leading to the formation of M1 quasi-macrophages. It is important to note that M1 macrophages in a bronchial asthma model exhibit an anti-inflammatory effect, while showing a proinflammatory effect during bacterial or viral infections, suggesting possible immunomodulatory effects of IRF5 and NR2C2. In our study, the expression levels of NOD2 and CD14 remained unchanged. The ChIP-Seq of VDR conducted on THP-1 cell culture could likely not be directly applicable for the study of NOD2 and CD14 expression in U937 cells due to the aforementioned limitations. Although CD14 did not respond to calcitriol in our experiment, in THP-1 culture this gene is one of the leaders in terms of increased expression [39]. Consequently, we posit that VDR-NR2C2 complexes may potentially contribute to an increased production of this receptor in THP-1 cells.

4. Materials and Methods

4.1. Bioinformatics Analysis Methods

To search for composite elements in the regulatory regions of genes, we utilized the MCOT program (https://webmcot.sysbio.cytogen.ru/, Novosibirsk, Russia) [40] and ChIP-Seq VDR data from the THP-1 monocytic cell line culture [39,87] obtained from the CistromeDB database (http://cistrome.org/db/, accessed on 11 November 2025, Shanghai, China, Boston, MA, USA) [88]. The VDR weight matrix derived de novo from this data, along with the ChIP-Seq peak sequences, were input into the MCOT following the program’s user manual. The resulting list of potential VDR partners was cross-referenced with the THP-1 RNA-Seq data [39] to identify expressed TFs in THP-1. In instances where the binding of a potential VDR partner to VDRE lacked literature evidence, the Enrichr database (ChEA 2022, New York, NY, USA) [89,90,91] was consulted to investigate the impact of such TFs on the expression of genes directly controlled by vitamin D. VDR-partner protein complex was built using AlphaFold 3 (London, UK) and visualized in the ChimeraX 1.5 (San Francisco, CA, USA) software package [92]. Genes harboring predicted VDR/Partner CEs in their regulatory DNA, and related to the regulation of cytokine production or linked to atopic or viral diseases (such as asthma, atopic dermatitis, allergic rhinitis, and viral lung infections), were selected for further analysis. Subsequently, an experimental investigation into the influence of vitamin D on the expression of vitamin D target genes was conducted (refer to Section 3.2). The potential effectiveness of the new putative CEs was evaluated based on the Haussler model [57], which posits that changes in expression levels are directly correlated to the number of VDR/Partner CEs in the gene’s regulatory regions.

4.2. Materials and Methods of the Experimental Study

4.2.1. Cell Culturing

The U937 lymphoma cell line was procured from the Russian Collection of Cell Cultures (St. Petersburg, Russia). The U937 cell line, in contrast to THP-1, originates from tissues (more differentiated) and is derived from pleural effusion, making it a suitable choice for studying atopic asthma and respiratory infections [93]. When choosing a cell culture, we also made sure that VDR, RXRA, PPARG and NR2C2 are actually expressed in U937 [94]. U937 cells were cultured in RPMI-1640 medium supplemented with 10% fetal calf serum and 2 mM L-alanyl-L-glutamine. The cells were maintained in a 5% CO2 incubator at 37 °C.
To induce the macrophage phenotype, cells were treated with 12.5 nM phorbol 12-myristate 13-acetate (PMA, Cayman Chemical, Ann Arbor, MI, USA) for 48 h. Subsequently, the medium was aspirated, and cells were washed with phosphate-buffered saline before being incubated in PMA-free medium for an additional 18 h. The resulting macrophage cells were exposed to a 10 and 100 nM solution of the active form of vitamin D3-calcitriol in DMSO, along with a 0.1% (v/v) DMSO control, for 24 h. Due to 77.5% of genes in THP-1 cells respond only 24 h after stimulation, we selected this time point for U937 [39]. All experimental conditions were performed in triplicate (three independent biological replicates).

4.2.2. Total RNA Isolation

Total RNA was extracted from the cell culture to quantify the mRNA levels using TRIzol Reagent (Thermo FS, Waltham, MA, USA) following the manufacturer’s instructions. The quality of isolated RNA was evaluated through horizontal electrophoresis, and the RNA concentration was measured using a Nano Photometer P-360 spectrophotometer (IMPLEN, Munich, Germany) at 230, 260, and 280 nm wavelengths. A 260/280 ratio of 1.8–2.0 and a 260/230 ratio of 1.8 were deemed satisfactory.

4.2.3. Reverse Transcription

To generate cDNA from the RNA template, the RT M-MuLV–RH kit (BioLabMix, Novosibirsk, Russia) was employed as per the manufacturer’s guidelines.

4.2.4. Quantitative PCR with Real-Time Detection

To assess gene expression levels, real-time RT-PCR was conducted utilizing the BioMaster HS-qPCR SYBR Blue (2×) kit on a CFX96Touch thermal cycler (BioRad, Hercules, CA, USA). GAPDH and 18S were used as reference genes, as they are widely employed and have been previously demonstrated to be suitable stable normalization genes for U937 cells [95,96]. The primer sequences employed in the study are detailed in Table 5. The concentration of all primer pairs in the reaction mix was 300 nM. Each PCR reaction was performed in a 20 μL volume, using 0.3 μL of cDNA. Each sample was analyzed in triplicate (technical replicates).
The reaction protocol involved an initial preheating at 95 °C for 5 min, followed by 40 cycles comprising denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and elongation with fluorescence data collection at 72 °C for 30 s. Melting curves were generated to confirm PCR specificity. The relative gene expression levels were determined using the threshold cycle values Ct following the 2−∆∆Ct method. Prior to ΔCt calculation, the geometric mean of Ct values for reference genes was determined. Additionally, electrophoresis on a 3% agarose gel was conducted to verify the quality of the PCR products.

4.2.5. Statistical Data Processing

Data analysis was carried out using MS Office. The results are presented as the mean values. Student’s t-test was applied to each gene to perform pairwise comparisons and assess variations in gene expression levels between experimental group and control group. Results with p < 0.05 were deemed statistically significant.

5. Conclusions

In our study, we investigated the scientific hypothesis regarding the regulation of immune system genes by vitamin D through novel potentially CEs. While the list of genes regulated by VDR has notably expanded over the past decade, it appears to be still incomplete. Investigating the impact of novel potential CEs on gene expression can provide insights into the underlying mechanisms of vitamin D in the pathogenesis of diseases like atopic dermatitis, bronchial asthma, allergic rhinitis and pulmonary infections.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms27010409/s1.

Author Contributions

Conceptualization: A.V.P., D.Y.O. and V.V. Supervision: V.V. Investigation: A.V.P., V.V.K., T.S.K., I.S.V. and A.D.L. Software, Methodology, Validation: A.V.P. and D.Y.O. Writing—Original Draft Preparation: A.V.P. Reviewing and Editing: E.G.K., V.V.Z. and V.V. All authors have read and agreed to the published version of the manuscript.

Funding

The study was supported by Russian-government funding for basic research at the Federal Research Center of Fundamental and Translational Medicine (No. 125031203556-7). The work was performed using the equipment of the Center for Collective Use “Proteomic Analysis”.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are unavailable due to privacy.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kaur, N.; Kumar, V.; Singh, J.; Jain, H.; Paras, P.; Kaur, N.; Sareen, A.K. Assessment of the Relation Between Asthma Severity and Serum Vitamin D Levels: A Cross-Sectional Study. Cureus 2023, 15, e46826. [Google Scholar] [CrossRef] [PubMed]
  2. Kim, M.J.; Kim, S.-N.; Lee, Y.W.; Choe, Y.B.; Ahn, K.J. Vitamin D Status and Efficacy of Vitamin D Supplementation in Atopic Dermatitis: A Systematic Review and Meta-Analysis. Nutrients 2016, 8, 789. [Google Scholar] [CrossRef] [PubMed]
  3. Zhu, Z.; Zhu, X.; Gu, L.; Zhan, Y.; Chen, L.; Li, X. Association Between Vitamin D and Influenza: Meta-Analysis and Systematic Review of Randomized Controlled Trials. Front. Nutr. 2021, 8, 799709. [Google Scholar] [CrossRef]
  4. Kalichuran, S.; van Blydenstein, S.A.; Venter, M.; Omar, S. Vitamin D Status and COVID-19 Severity. S. Afr. J. Infect. Dis. 2022, 37, 359. [Google Scholar] [CrossRef] [PubMed]
  5. Camargo, C.A.; Ingham, T.; Wickens, K.; Thadhani, R.; Silvers, K.M.; Epton, M.J.; Town, G.I.; Pattemore, P.K.; Espinola, J.A.; Crane, J. New Zealand Asthma and Allergy Cohort Study Group. Cord-Blood 25-Hydroxyvitamin D Levels and Risk of Respiratory Infection, Wheezing, and Asthma. Pediatrics 2011, 127, e180–e187. [Google Scholar] [CrossRef]
  6. Ferolla, F.M.; Yfran, E.W.; Ballerini, M.G.; Caratozzolo, A.; Toledano, A.; Giordano, A.C.; Acosta, P.L.; Cassinelli, H.; Bergada, I.; Ropelato, M.G.; et al. GUTI Respiratory Infections Network. Serum Vitamin D Levels and Life-Threatening Respiratory Syncytial Virus Infection in Previously Healthy Infants. J. Infect. Dis. 2022, 226, 958–966. [Google Scholar] [CrossRef]
  7. Mittal, J.; Rajvanshi, N.; Suvarna, K.; Kumar, P.; Goyal, J.P. Association of Vitamin D with Disease Severity in Infants with Bronchiolitis. Eur. J. Pediatr. 2024, 183, 2717–2723. [Google Scholar] [CrossRef]
  8. Belderbos, M.E.; Houben, M.L.; Wilbrink, B.; Lentjes, E.; Bloemen, E.M.; Kimpen, J.L.L.; Rovers, M.; Bont, L. Cord Blood Vitamin D Deficiency Is Associated with Respiratory Syncytial Virus Bronchiolitis. Pediatrics 2011, 127, e1513–e1520. [Google Scholar] [CrossRef]
  9. Karatekin, G.; Kaya, A.; Salihoğlu, O.; Balci, H.; Nuhoğlu, A. Association of Subclinical Vitamin D Deficiency in Newborns with Acute Lower Respiratory Infection and Their Mothers. Eur. J. Clin. Nutr. 2009, 63, 473–477. [Google Scholar] [CrossRef]
  10. Rastogi, A.; Bhansali, A.; Khare, N.; Suri, V.; Yaddanapudi, N.; Sachdeva, N.; Puri, G.D.; Malhotra, P. Short Term, High-Dose Vitamin D Supplementation for COVID-19 Disease: A Randomised, Placebo-Controlled, Study (SHADE Study). Postgrad. Med. J. 2022, 98, 87–90. [Google Scholar] [CrossRef]
  11. Entrenas Castillo, M.; Entrenas Costa, L.M.; Vaquero Barrios, J.M.; Alcalá Díaz, J.F.; López Miranda, J.; Bouillon, R.; Quesada Gomez, J.M. Effect of Calcifediol Treatment and Best Available Therapy versus Best Available Therapy on Intensive Care Unit Admission and Mortality among Patients Hospitalized for COVID-19: A Pilot Randomized Clinical Study. J. Steroid Biochem. Mol. Biol. 2020, 203, 105751. [Google Scholar] [CrossRef] [PubMed]
  12. Jolliffe, D.A.; Greenberg, L.; Hooper, R.L.; Griffiths, C.J.; Camargo, C.A.; Kerley, C.P.; Jensen, M.E.; Mauger, D.; Stelmach, I.; Urashima, M.; et al. Vitamin D Supplementation to Prevent Asthma Exacerbations: A Systematic Review and Meta-Analysis of Individual Participant Data. Lancet Respir. Med. 2017, 5, 881–890, Erratum in Lancet Respir. Med. 2018, 6, e27.. [Google Scholar] [CrossRef] [PubMed]
  13. Hidayati, A.N.; Sawitri, S.; Sari, D.W.; Prakoeswa, C.R.S.; Indramaya, D.M.; Damayanti, D.; Zulkarnain, I.; Citrashanty, I.; Widia, Y.; Anggraeni, S. Efficacy of Vitamin D Supplementation on the Severity of Atopic Dermatitis in Children: A Systematic Review and Meta-Analysis. F1000Research 2022, 11, 274. [Google Scholar] [CrossRef] [PubMed]
  14. Overbergh, L.; Decallonne, B.; Valckx, D.; Verstuyf, A.; Depovere, J.; Laureys, J.; Rutgeerts, O.; Saint-Arnaud, R.; Bouillon, R.; Mathieu, C. Identification and Immune Regulation of 25-Hydroxyvitamin D-1-Alpha-Hydroxylase in Murine Macrophages. Clin. Exp. Immunol. 2000, 120, 139–146. [Google Scholar] [CrossRef]
  15. Hewison, M.; Freeman, L.; Hughes, S.V.; Evans, K.N.; Bland, R.; Eliopoulos, A.G.; Kilby, M.D.; Moss, P.A.H.; Chakraverty, R. Differential Regulation of Vitamin D Receptor and Its Ligand in Human Monocyte-Derived Dendritic Cells. J. Immunol. 2003, 170, 5382–5390. [Google Scholar] [CrossRef]
  16. Bikle, D.D. Vitamin D Metabolism, Mechanism of Action, and Clinical Applications. Chem. Biol. 2014, 21, 319–329. [Google Scholar] [CrossRef]
  17. Saggese, G.; Vierucci, F.; Prodam, F.; Cardinale, F.; Cetin, I.; Chiappini, E.; De’ Angelis, G.L.; Massari, M.; Miraglia Del Giudice, E.; Miraglia Del Giudice, M.; et al. Vitamin D in Pediatric Age: Consensus of the Italian Pediatric Society and the Italian Society of Preventive and Social Pediatrics, Jointly with the Italian Federation of Pediatricians. Ital. J. Pediatr. 2018, 44, 51. [Google Scholar] [CrossRef]
  18. Van der Veen, T.A.; de Groot, L.E.S.; Melgert, B.N. The Different Faces of the Macrophage in Asthma. Curr. Opin. Pulm. Med. 2020, 26, 62–68. [Google Scholar] [CrossRef]
  19. Li, J.; Shan, R.; Miller, H.; Filatov, A.; Byazrova, M.G.; Yang, L.; Liu, C. The Roles of Macrophages and Monocytes in COVID-19 Severe Respiratory Syndrome. Cell Insight 2025, 4, 100250. [Google Scholar] [CrossRef]
  20. Cao, R.; Ma, Y.; Li, S.; Shen, D.; Yang, S.; Wang, X.; Cao, Y.; Wang, Z.; Wei, Y.; Li, S.; et al. 1,25(OH)2 D3 Alleviates DSS-Induced Ulcerative Colitis via Inhibiting NLRP3 Inflammasome Activation. J. Leukoc. Biol. 2020, 108, 283–295. [Google Scholar] [CrossRef]
  21. Chen, Y.; Zhang, J.; Ge, X.; Du, J.; Deb, D.K.; Li, Y.C. Vitamin D Receptor Inhibits Nuclear Factor κB Activation by Interacting with IκB Kinase β Protein. J. Biol. Chem. 2013, 288, 19450–19458. [Google Scholar] [CrossRef] [PubMed]
  22. Zhang, Y.; Leung, D.Y.M.; Richers, B.N.; Liu, Y.; Remigio, L.K.; Riches, D.W.; Goleva, E. Vitamin D Inhibits Monocyte/Macrophage Proinflammatory Cytokine Production by Targeting MAPK Phosphatase-1. J. Immunol. 2012, 188, 2127–2135. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, Y.; Leung, D.Y.M.; Goleva, E. Anti-Inflammatory and Corticosteroid-Enhancing Actions of Vitamin D in Monocytes of Patients with Steroid-Resistant and Those with Steroid-Sensitive Asthma. J. Allergy Clin. Immunol. 2014, 133, 1744–1752.e1. [Google Scholar] [CrossRef] [PubMed]
  24. Chen, P.; Li, J.; Barnes, J.; Kokkonen, G.C.; Lee, J.C.; Liu, Y. Restraint of Proinflammatory Cytokine Biosynthesis by Mitogen-Activated Protein Kinase Phosphatase-1 in Lipopolysaccharide-Stimulated Macrophages. J. Immunol. 2002, 169, 6408–6416. [Google Scholar] [CrossRef]
  25. Shepherd, E.G.; Zhao, Q.; Welty, S.E.; Hansen, T.N.; Smith, C.V.; Liu, Y. The Function of Mitogen-Activated Protein Kinase Phosphatase-1 in Peptidoglycan-Stimulated Macrophages. J. Biol. Chem. 2004, 279, 54023–54031. [Google Scholar] [CrossRef]
  26. Zhao, Q.; Shepherd, E.G.; Manson, M.E.; Nelin, L.D.; Sorokin, A.; Liu, Y. The Role of Mitogen-Activated Protein Kinase Phosphatase-1 in the Response of Alveolar Macrophages to Lipopolysaccharide: Attenuation of Proinflammatory Cytokine Biosynthesis via Feedback Control of P38. J. Biol. Chem. 2005, 280, 8101–8108. [Google Scholar] [CrossRef]
  27. Chi, H.; Barry, S.P.; Roth, R.J.; Wu, J.J.; Jones, E.A.; Bennett, A.M.; Flavell, R.A. Dynamic Regulation of Pro- and Anti-Inflammatory Cytokines by MAPK Phosphatase 1 (MKP-1) in Innate Immune Responses. Proc. Natl. Acad. Sci. USA 2006, 103, 2274–2279. [Google Scholar] [CrossRef]
  28. Salojin, K.V.; Owusu, I.B.; Millerchip, K.A.; Potter, M.; Platt, K.A.; Oravecz, T. Essential Role of MAPK Phosphatase-1 in the Negative Control of Innate Immune Responses. J. Immunol. 2006, 176, 1899–1907. [Google Scholar] [CrossRef]
  29. Zhao, Q.; Wang, X.; Nelin, L.D.; Yao, Y.; Matta, R.; Manson, M.E.; Baliga, R.S.; Meng, X.; Smith, C.V.; Bauer, J.A.; et al. MAP Kinase Phosphatase 1 Controls Innate Immune Responses and Suppresses Endotoxic Shock. J. Exp. Med. 2006, 203, 131–140. [Google Scholar] [CrossRef]
  30. Hammer, M.; Mages, J.; Dietrich, H.; Servatius, A.; Howells, N.; Cato, A.C.B.; Lang, R. Dual Specificity Phosphatase 1 (DUSP1) Regulates a Subset of LPS-Induced Genes and Protects Mice from Lethal Endotoxin Shock. J. Exp. Med. 2006, 203, 15–20. [Google Scholar] [CrossRef]
  31. Calvert, T.J.; Chicoine, L.G.; Liu, Y.; Nelin, L.D. Deficiency of Mitogen-Activated Protein Kinase Phosphatase-1 Results in iNOS-Mediated Hypotension in Response to Low-Dose Endotoxin. Am. J. Physiol. Heart Circ. Physiol. 2008, 294, H1621–H1629. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, X.; Zhao, Q.; Matta, R.; Meng, X.; Liu, X.; Liu, C.-G.; Nelin, L.D.; Liu, Y. Inducible Nitric-Oxide Synthase Expression Is Regulated by Mitogen-Activated Protein Kinase Phosphatase-1. J. Biol. Chem. 2009, 284, 27123–27134. [Google Scholar] [CrossRef] [PubMed]
  33. Lasa, M.; Abraham, S.M.; Boucheron, C.; Saklatvala, J.; Clark, A.R. Dexamethasone Causes Sustained Expression of Mitogen-Activated Protein Kinase (MAPK) Phosphatase 1 and Phosphatase-Mediated Inhibition of MAPK P38. Mol. Cell. Biol. 2002, 22, 7802–7811. [Google Scholar] [CrossRef] [PubMed]
  34. Hakim, I.; Bar-Shavit, Z. Modulation of TNF-Alpha Expression in Bone Marrow Macrophages: Involvement of Vitamin D Response Element. J. Cell. Biochem. 2003, 88, 986–998. [Google Scholar] [CrossRef]
  35. Gombart, A.F.; Borregaard, N.; Koeffler, H.P. Human Cathelicidin Antimicrobial Peptide (CAMP) Gene Is a Direct Target of the Vitamin D Receptor and Is Strongly up-Regulated in Myeloid Cells by 1,25-Dihydroxyvitamin D3. FASEB J. 2005, 19, 1067–1077. [Google Scholar] [CrossRef]
  36. Wang, T.-T.; Nestel, F.P.; Bourdeau, V.; Nagai, Y.; Wang, Q.; Liao, J.; Tavera-Mendoza, L.; Lin, R.; Hanrahan, J.W.; Mader, S.; et al. Cutting Edge: 1,25-Dihydroxyvitamin D3 Is a Direct Inducer of Antimicrobial Peptide Gene Expression. J. Immunol. 2004, 173, 2909–2912. [Google Scholar] [CrossRef]
  37. Verway, M.; Bouttier, M.; Wang, T.-T.; Carrier, M.; Calderon, M.; An, B.-S.; Devemy, E.; McIntosh, F.; Divangahi, M.; Behr, M.A.; et al. Vitamin D Induces Interleukin-1β Expression: Paracrine Macrophage Epithelial Signaling Controls M. tuberculosis Infection. PLoS Pathog. 2013, 9, e1003407. [Google Scholar] [CrossRef]
  38. Carlberg, C.; Bendik, I.; Wyss, A.; Meier, E.; Sturzenbecker, L.J.; Grippo, J.F.; Hunziker, W. Two Nuclear Signalling Pathways for Vitamin D. Nature 1993, 361, 657–660. [Google Scholar] [CrossRef]
  39. Seuter, S.; Neme, A.; Carlberg, C. Epigenome-Wide Effects of Vitamin D and Their Impact on the Transcriptome of Human Monocytes Involve CTCF. Nucleic Acids Res. 2016, 44, 4090–4104. [Google Scholar] [CrossRef]
  40. Levitsky, V.; Zemlyanskaya, E.; Oshchepkov, D.; Podkolodnaya, O.; Ignatieva, E.; Grosse, I.; Mironova, V.; Merkulova, T. A Single ChIP-Seq Dataset Is Sufficient for Comprehensive Analysis of Motifs Co-Occurrence with MCOT Package. Nucleic Acids Res. 2019, 47, e139. [Google Scholar] [CrossRef]
  41. Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate Structure Prediction of Biomolecular Interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef] [PubMed]
  42. Alimirah, F.; Peng, X.; Yuan, L.; Mehta, R.R.; von Knethen, A.; Choubey, D.; Mehta, R.G. Crosstalk between the Peroxisome Proliferator-Activated Receptor γ (PPARγ) and the Vitamin D Receptor (VDR) in Human Breast Cancer Cells: PPARγ Binds to VDR and Inhibits 1α,25-Dihydroxyvitamin D3 Mediated Transactivation. Exp. Cell Res. 2012, 318, 2490–2497. [Google Scholar] [CrossRef] [PubMed]
  43. Liu, S.; Lin, S.-J.; Li, G.; Kim, E.; Chen, Y.-T.; Yang, D.-R.; Tan, M.H.E.; Yong, E.L.; Chang, C. Differential Roles of PPARγ vs TR4 in Prostate Cancer and Metabolic Diseases. Endocr.-Relat. Cancer 2014, 21, R279–R300. [Google Scholar] [CrossRef] [PubMed]
  44. Rosenstiel, P.; Hellmig, S.; Hampe, J.; Ott, S.; Till, A.; Fischbach, W.; Sahly, H.; Lucius, R.; Fölsch, U.R.; Philpott, D.; et al. Influence of Polymorphisms in the NOD1/CARD4 and NOD2/CARD15 Genes on the Clinical Outcome of Helicobacter Pylori Infection. Cell. Microbiol. 2006, 8, 1188–1198. [Google Scholar] [CrossRef]
  45. Hsu, Y.-L.; Wang, M.-Y.; Ho, L.-J.; Huang, C.-Y.; Lai, J.-H. Up-Regulation of Galectin-9 Induces Cell Migration in Human Dendritic Cells Infected with Dengue Virus. J. Cell. Mol. Med. 2015, 19, 1065–1076. [Google Scholar] [CrossRef]
  46. Kitatani, K.; Sheldon, K.; Anelli, V.; Jenkins, R.W.; Sun, Y.; Grabowski, G.A.; Obeid, L.M.; Hannun, Y.A. Acid Beta-Glucosidase 1 Counteracts P38delta-Dependent Induction of Interleukin-6: Possible Role for Ceramide as an Anti-Inflammatory Lipid. J. Biol. Chem. 2009, 284, 12979–12988. [Google Scholar] [CrossRef]
  47. Stempin, C.C.; Motrán, C.C.; Aoki, M.P.; Falcón, C.R.; Cerbán, F.M.; Cervi, L. PD-L2 Negatively Regulates Th1-Mediated Immunopathology during Fasciola Hepatica Infection. Oncotarget 2016, 7, 77721–77731. [Google Scholar] [CrossRef]
  48. Brown, J.A.; Dorfman, D.M.; Ma, F.-R.; Sullivan, E.L.; Munoz, O.; Wood, C.R.; Greenfield, E.A.; Freeman, G.J. Blockade of Programmed Death-1 Ligands on Dendritic Cells Enhances T Cell Activation and Cytokine Production. J. Immunol. 2003, 170, 1257–1266. [Google Scholar] [CrossRef]
  49. Wu, B.Y.; Woffendin, C.; Duckett, C.S.; Ohno, T.; Nabel, G.J. Regulation of Human Retroviral Latency by the NF-Kappa B/I Kappa B Family: Inhibition of Human Immunodeficiency Virus Replication by I Kappa B through a Rev-Dependent Mechanism. Proc. Natl. Acad. Sci. USA 1995, 92, 1480–1484. [Google Scholar] [CrossRef]
  50. Jaffray, E.; Wood, K.M.; Hay, R.T. Domain Organization of I Kappa B Alpha and Sites of Interaction with NF-Kappa B P65. Mol. Cell. Biol. 1995, 15, 2166–2172. [Google Scholar] [CrossRef]
  51. Hein, M.Y.; Hubner, N.C.; Poser, I.; Cox, J.; Nagaraj, N.; Toyoda, Y.; Gak, I.A.; Weisswange, I.; Mansfeld, J.; Buchholz, F.; et al. A Human Interactome in Three Quantitative Dimensions Organized by Stoichiometries and Abundances. Cell 2015, 163, 712–723. [Google Scholar] [CrossRef] [PubMed]
  52. Schaaf, B.; Luitjens, K.; Goldmann, T.; van Bremen, T.; Sayk, F.; Dodt, C.; Dalhoff, K.; Droemann, D. Mortality in Human Sepsis Is Associated with Downregulation of Toll-like Receptor 2 and CD14 Expression on Blood Monocytes. Diagn. Pathol. 2009, 4, 12. [Google Scholar] [CrossRef] [PubMed]
  53. Besteman, S.B.; Phung, E.; Raeven, H.H.M.; Amatngalim, G.D.; Rumpret, M.; Crabtree, J.; Schepp, R.M.; Rodenburg, L.W.; Siemonsma, S.G.; Verleur, N.; et al. Recurrent Respiratory Syncytial Virus Infection in a CD14-Deficient Patient. J. Infect. Dis. 2022, 226, 258–269. [Google Scholar] [CrossRef] [PubMed]
  54. Granato, D.; Bergonzelli, G.E.; Pridmore, R.D.; Marvin, L.; Rouvet, M.; Corthésy-Theulaz, I.E. Cell Surface-Associated Elongation Factor Tu Mediates the Attachment of Lactobacillus Johnsonii NCC533 (La1) to Human Intestinal Cells and Mucins. Infect. Immun. 2004, 72, 2160–2169. [Google Scholar] [CrossRef]
  55. Haziot, A.; Ferrero, E.; Köntgen, F.; Hijiya, N.; Yamamoto, S.; Silver, J.; Stewart, C.L.; Goyert, S.M. Resistance to Endotoxin Shock and Reduced Dissemination of Gram-Negative Bacteria in CD14-Deficient Mice. Immunity 1996, 4, 407–414. [Google Scholar] [CrossRef]
  56. Chang Foreman, H.-C.; Van Scoy, S.; Cheng, T.-F.; Reich, N.C. Activation of Interferon Regulatory Factor 5 by Site Specific Phosphorylation. PLoS ONE 2012, 7, e33098. [Google Scholar] [CrossRef]
  57. Haussler, M.R.; Whitfield, G.K.; Kaneko, I.; Haussler, C.A.; Hsieh, D.; Hsieh, J.-C.; Jurutka, P.W. Molecular Mechanisms of Vitamin D Action. Calcif. Tissue Int. 2013, 92, 77–98. [Google Scholar] [CrossRef]
  58. Wang, W.; Li, Y.; Meng, X. Vitamin D and Neurodegenerative Diseases. Heliyon 2023, 9, e12877. [Google Scholar] [CrossRef]
  59. Liang, S.; Cai, J.; Li, Y.; Yang, R. 1,25-Dihydroxy-Vitamin D3 Induces Macrophage Polarization to M2 by Upregulating T-cell Ig-mucin-3 Expression. Mol. Med. Rep. 2019, 19, 3707–3713. [Google Scholar] [CrossRef]
  60. Zhu, C.; Anderson, A.C.; Schubart, A.; Xiong, H.; Imitola, J.; Khoury, S.J.; Zheng, X.X.; Strom, T.B.; Kuchroo, V.K. The Tim-3 Ligand Galectin-9 Negatively Regulates T Helper Type 1 Immunity. Nat. Immunol. 2005, 6, 1245–1252. [Google Scholar] [CrossRef]
  61. Kadowaki, T.; Morishita, A.; Niki, T.; Hara, J.; Sato, M.; Tani, J.; Miyoshi, H.; Yoneyama, H.; Masaki, T.; Hattori, T.; et al. Galectin-9 Prolongs the Survival of Septic Mice by Expanding Tim-3-Expressing Natural Killer T Cells and PDCA-1+ CD11c+ Macrophages. Crit. Care 2013, 17, R284. [Google Scholar] [CrossRef] [PubMed]
  62. Seki, M.; Oomizu, S.; Sakata, K.-M.; Sakata, A.; Arikawa, T.; Watanabe, K.; Ito, K.; Takeshita, K.; Niki, T.; Saita, N.; et al. Galectin-9 Suppresses the Generation of Th17, Promotes the Induction of Regulatory T Cells, and Regulates Experimental Autoimmune Arthritis. Clin. Immunol. 2008, 127, 78–88. [Google Scholar] [CrossRef] [PubMed]
  63. Katoh, S.; Ishii, N.; Nobumoto, A.; Takeshita, K.; Dai, S.-Y.; Shinonaga, R.; Niki, T.; Nishi, N.; Tominaga, A.; Yamauchi, A.; et al. Galectin-9 Inhibits CD44-Hyaluronan Interaction and Suppresses a Murine Model of Allergic Asthma. Am. J. Respir. Crit. Care Med. 2007, 176, 27–35. [Google Scholar] [CrossRef] [PubMed]
  64. Enninga, E.A.L.; Nevala, W.K.; Holtan, S.G.; Leontovich, A.A.; Markovic, S.N. Galectin-9 Modulates Immunity by Promoting Th2/M2 Differentiation and Impacts Survival in Patients with Metastatic Melanoma. Melanoma Res. 2016, 26, 429–441. [Google Scholar] [CrossRef]
  65. Mengshol, J.A.; Golden-Mason, L.; Arikawa, T.; Smith, M.; Niki, T.; McWilliams, R.; Randall, J.A.; McMahan, R.; Zimmerman, M.A.; Rangachari, M.; et al. A Crucial Role for Kupffer Cell-Derived Galectin-9 in Regulation of T Cell Immunity in Hepatitis C Infection. PLoS ONE 2010, 5, e9504, Erratum in PLoS ONE 2010, 5.. [Google Scholar] [CrossRef]
  66. Dai, S.-Y.; Nakagawa, R.; Itoh, A.; Murakami, H.; Kashio, Y.; Abe, H.; Katoh, S.; Kontani, K.; Kihara, M.; Zhang, S.-L.; et al. Galectin-9 Induces Maturation of Human Monocyte-Derived Dendritic Cells. J. Immunol. 2005, 175, 2974–2981. [Google Scholar] [CrossRef]
  67. Golden-Mason, L.; McMahan, R.H.; Strong, M.; Reisdorph, R.; Mahaffey, S.; Palmer, B.E.; Cheng, L.; Kulesza, C.; Hirashima, M.; Niki, T.; et al. Galectin-9 Functionally Impairs Natural Killer Cells in Humans and Mice. J. Virol. 2013, 87, 4835–4845. [Google Scholar] [CrossRef]
  68. Niki, T.; Tsutsui, S.; Hirose, S.; Aradono, S.; Sugimoto, Y.; Takeshita, K.; Nishi, N.; Hirashima, M. Galectin-9 Is a High Affinity IgE-Binding Lectin with Anti-Allergic Effect by Blocking IgE-Antigen Complex Formation. J. Biol. Chem. 2009, 284, 32344–32352. [Google Scholar] [CrossRef]
  69. Lu, X.; McCoy, K.S.; Xu, J.; Hu, W.; Chen, H.; Jiang, K.; Han, F.; Chen, P.; Wang, Y. Galectin-9 Ameliorates Respiratory Syncytial Virus-Induced Pulmonary Immunopathology through Regulating the Balance between Th17 and Regulatory T Cells. Virus Res. 2015, 195, 162–171. [Google Scholar] [CrossRef]
  70. Yeung, S.T.; Premeaux, T.A.; Du, L.; Niki, T.; Pillai, S.K.; Khanna, K.M.; Ndhlovu, L.C. Galectin-9 Protects Humanized-ACE2 Immunocompetent Mice from SARS-CoV-2 Infection. Front. Immunol. 2022, 13, 1011185. [Google Scholar] [CrossRef]
  71. Penders, J.; Thijs, C.; Mommers, M.; Stobberingh, E.E.; Dompeling, E.; Reijmerink, N.E.; van den Brandt, P.A.; Kerkhof, M.; Koppelman, G.H.; Postma, D.S. Host-Microbial Interactions in Childhood Atopy: Toll-like Receptor 4 (TLR4), CD14, and Fecal Escherichia Coli. J. Allergy Clin. Immunol. 2010, 125, 231–236.e5. [Google Scholar] [CrossRef]
  72. Hussein, Y.M.; Shalaby, S.M.; Zidan, H.E.; Sabbah, N.A.; Karam, N.A.; Alzahrani, S.S. CD14 Tobacco Gene-Environment Interaction in Atopic Children. Cell. Immunol. 2013, 285, 31–37. [Google Scholar] [CrossRef] [PubMed]
  73. Cai, X.; Xu, Q.; Zhou, C.; Zhou, L.; Dai, W.; Ji, G. The Association of Nucleotide-Binding Oligomerization Domain 2 Gene Polymorphisms with the Risk of Asthma in the Chinese Han Population. Mol. Genet. Genomic Med. 2019, 7, e00675. [Google Scholar] [CrossRef] [PubMed]
  74. Wu, K.; Zhang, Y.; Mao, D.; Iberg, C.A.; Yin-Declue, H.; Sun, K.; Keeler, S.P.; Wikfors, H.A.; Young, D.; Yantis, J.; et al. MAPK13 Controls Structural Remodeling and Disease after Epithelial Injury. bioRxiv 2024. [Google Scholar] [CrossRef] [PubMed]
  75. Krausgruber, T.; Blazek, K.; Smallie, T.; Alzabin, S.; Lockstone, H.; Sahgal, N.; Hussell, T.; Feldmann, M.; Udalova, I.A. IRF5 Promotes Inflammatory Macrophage Polarization and TH1-TH17 Responses. Nat. Immunol. 2011, 12, 231–238. [Google Scholar] [CrossRef]
  76. Chen, X.; Zhou, L.; Peng, N.; Yu, H.; Li, M.; Cao, Z.; Lin, Y.; Wang, X.; Li, Q.; Wang, J.; et al. MicroRNA-302a Suppresses Influenza A Virus-Stimulated Interferon Regulatory Factor-5 Expression and Cytokine Storm Induction. J. Biol. Chem. 2017, 292, 21291–21303. [Google Scholar] [CrossRef]
  77. Stoy, N. Involvement of Interleukin-1 Receptor-Associated Kinase 4 and Interferon Regulatory Factor 5 in the Immunopathogenesis of SARS-CoV-2 Infection: Implications for the Treatment of COVID-19. Front. Immunol. 2021, 12, 638446. [Google Scholar] [CrossRef]
  78. Byrne, A.J.; Weiss, M.; Mathie, S.A.; Walker, S.A.; Eames, H.L.; Saliba, D.; Lloyd, C.M.; Udalova, I.A. A Critical Role for IRF5 in Regulating Allergic Airway Inflammation. Mucosal Immunol. 2017, 10, 716–726. [Google Scholar] [CrossRef]
  79. Chen, R.-X.; Luan, Z.; Shen, C.; Dai, M.-D.; Qiu, C.-Y.; Zhu, X.-J.; Zhang, Q.-Z.; Lu, M.-P.; Cheng, L. Genetic Variants in PD-1 and Its Ligands, Gene-Gene and Gene-Environment Interactions in Allergic Rhinitis. Int. Immunopharmacol. 2025, 147, 113912. [Google Scholar] [CrossRef]
  80. Ali, S.; Hirschfeld, A.F.; Mayer, M.L.; Fortuno, E.S.; Corbett, N.; Kaplan, M.; Wang, S.; Schneiderman, J.; Fjell, C.D.; Yan, J.; et al. Functional Genetic Variation in NFKBIA and Susceptibility to Childhood Asthma, Bronchiolitis, and Bronchopulmonary Dysplasia. J. Immunol. 2013, 190, 3949–3958. [Google Scholar] [CrossRef]
  81. Sharma, P.; Pandey, A.K.; Bhattacharyya, D.K. Determining Crucial Genes Associated with COVID-19 Based on COPD Findings✶,✶✶. Comput. Biol. Med. 2021, 128, 104126. [Google Scholar] [CrossRef] [PubMed]
  82. Camblor, D.G.; Miranda, D.; Albaiceta, G.M.; Amado-Rodríguez, L.; Cuesta-Llavona, E.; Vázquez-Coto, D.; Gómez de Oña, J.; García-Lago, C.; Gómez, J.; Coto, E. Genetic Variants in the NF-κB Signaling Pathway (NFKB1, NFKBIA, NFKBIZ) and Risk of Critical Outcome among COVID-19 Patients. Hum. Immunol. 2022, 83, 613–617. [Google Scholar] [CrossRef] [PubMed]
  83. Li, N.; Salter, R.C.; Ramji, D.P. Molecular Mechanisms Underlying the Inhibition of IFN-γ-Induced, STAT1-Mediated Gene Transcription in Human Macrophages by Simvastatin and Agonists of PPARs and LXRs. J. Cell. Biochem. 2011, 112, 675–683. [Google Scholar] [CrossRef] [PubMed]
  84. Calvier, L.; Chouvarine, P.; Legchenko, E.; Hoffmann, N.; Geldner, J.; Borchert, P.; Jonigk, D.; Mozes, M.M.; Hansmann, G. PPARγ Links BMP2 and TGFβ1 Pathways in Vascular Smooth Muscle Cells, Regulating Cell Proliferation and Glucose Metabolism. Cell Metab. 2017, 25, 1118–1134.e7. [Google Scholar] [CrossRef]
  85. Rosas-Salazar, C.; Chirkova, T.; Gebretsadik, T.; Chappell, J.D.; Peebles, R.S.; Dupont, W.D.; Jadhao, S.J.; Gergen, P.J.; Anderson, L.J.; Hartert, T.V. Respiratory Syncytial Virus Infection during Infancy and Asthma during Childhood in the USA (INSPIRE): A Population-Based, Prospective Birth Cohort Study. Lancet 2023, 401, 1669–1680. [Google Scholar] [CrossRef]
  86. Min, Z.; Wan, J.; Xin, H.; Liu, X.; Rao, X.; Fan, Z.; Yang, L.; Li, D. NR2C2 of Macrophages Promotes Inflammation via NF-κB in LPS-Induced Orchitis in Mice. Reproduction 2023, 166, 209–220. [Google Scholar] [CrossRef]
  87. Seuter, S.; Neme, A.; Carlberg, C. ETS Transcription Factor Family Member GABPA Contributes to Vitamin D Receptor Target Gene Regulation. J. Steroid Biochem. Mol. Biol. 2018, 177, 46–52. [Google Scholar] [CrossRef]
  88. Zheng, R.; Wan, C.; Mei, S.; Qin, Q.; Wu, Q.; Sun, H.; Chen, C.-H.; Brown, M.; Zhang, X.; Meyer, C.A.; et al. Cistrome Data Browser: Expanded Datasets and New Tools for Gene Regulatory Analysis. Nucleic Acids Res. 2019, 47, D729–D735. [Google Scholar] [CrossRef]
  89. Chen, E.Y.; Tan, C.M.; Kou, Y.; Duan, Q.; Wang, Z.; Meirelles, G.V.; Clark, N.R.; Ma’ayan, A. Enrichr: Interactive and Collaborative HTML5 Gene List Enrichment Analysis Tool. BMC Bioinform. 2013, 14, 128. [Google Scholar] [CrossRef]
  90. Kuleshov, M.V.; Jones, M.R.; Rouillard, A.D.; Fernandez, N.F.; Duan, Q.; Wang, Z.; Koplev, S.; Jenkins, S.L.; Jagodnik, K.M.; Lachmann, A.; et al. Enrichr: A Comprehensive Gene Set Enrichment Analysis Web Server 2016 Update. Nucleic Acids Res. 2016, 44, W90–W97. [Google Scholar] [CrossRef]
  91. Xie, Z.; Bailey, A.; Kuleshov, M.V.; Clarke, D.J.B.; Evangelista, J.E.; Jenkins, S.L.; Lachmann, A.; Wojciechowicz, M.L.; Kropiwnicki, E.; Jagodnik, K.M.; et al. Gene Set Knowledge Discovery with Enrichr. Curr. Protoc. 2021, 1, e90. [Google Scholar] [CrossRef]
  92. Meng, E.C.; Goddard, T.D.; Pettersen, E.F.; Couch, G.S.; Pearson, Z.J.; Morris, J.H.; Ferrin, T.E. UCSF ChimeraX: Tools for Structure Building and Analysis. Protein Sci. 2023, 32, e4792. [Google Scholar] [CrossRef]
  93. Sundström, C.; Nilsson, K. Establishment and Characterization of a Human Histiocytic Lymphoma Cell Line (U-937). Int. J. Cancer 1976, 17, 565–577. [Google Scholar] [CrossRef]
  94. Ding, C.; Chan, D.W.; Liu, W.; Liu, M.; Li, D.; Song, L.; Li, C.; Jin, J.; Malovannaya, A.; Jung, S.Y.; et al. Proteome-Wide Profiling of Activated Transcription Factors with a Concatenated Tandem Array of Transcription Factor Response Elements. Proc. Natl. Acad. Sci. USA 2013, 110, 6771–6776. [Google Scholar] [CrossRef]
  95. Attri, K.S.; Mehla, K.; Shukla, S.K.; Singh, P.K. Microscale Gene Expression Analysis of Tumor-Associated Macrophages. Sci. Rep. 2018, 8, 2408. [Google Scholar] [CrossRef]
  96. Alvi, A.A.; Munir, H.; Zulfiqar, M.; Waqas, M.; Basit, A.; Moazzam, A. Analysis Of Gene Expression Of GAPDH Across Three Different Cell Lines Using RT-qPCR. Int. J. Pharm. Sci. 2024, 10, 435–447. [Google Scholar]
Ijms 27 00409 g001aIjms 27 00409 g001b
Figure 1. Logos of the VDR/RXRA, VDR/PPARG, VDR/NR2C2 novel potential CEs.
Figure 1. Logos of the VDR/RXRA, VDR/PPARG, VDR/NR2C2 novel potential CEs.
Ijms 27 00409 g001aIjms 27 00409 g001b
Ijms 27 00409 g002aIjms 27 00409 g002b
Figure 2. Changes in immune system gene expression levels in U937 cells exposed to 10 and 100 nM calcitriol. Note: *—p < 0.05, where p is the significance level of differences with the control.
Figure 2. Changes in immune system gene expression levels in U937 cells exposed to 10 and 100 nM calcitriol. Note: *—p < 0.05, where p is the significance level of differences with the control.
Ijms 27 00409 g002aIjms 27 00409 g002b
Table 1. VDR partner motifs derived from MCOT output.
Table 1. VDR partner motifs derived from MCOT output.
Motif NameFull Overlap, p-ValuePartial Overlap, p-ValueOverlap, p-ValueSpacer, p-ValueAny, p-Value
PPARG12.1 × 10−222.1 × 10−2211
RXRA6.3 × 10−292.3 × 10−156 × 10−3012.6 × 10−07
PPARA11.3 × 10−221.3 × 10−2215.9 × 10−06
NR2C21.4 × 10−116.5 × 10−259.1 × 10−3415.5 × 10−06
Table 2. ChIP-Seq top 10 regulators of 98 vitamin D target genes.
Table 2. ChIP-Seq top 10 regulators of 98 vitamin D target genes.
№Namep-ValueAdjusted p-ValueOdds RatioCombined Score
1VDR 24763502 ChIP-Seq THP-1 Human6.358 × 10−454.508 × 10−4224.722515.98
2VDR 24787735 ChIP-Seq THP-1 Human7.968 × 10−422.825 × 10−3927.652616.57
3VDR 23401126 ChIP-Seq LCL-AND-THP1 Human8.539 × 10−222.018 × 10−1928.001358.21
4IRF8 27001747 Chip-Seq BMDM Mouse8.847 × 10−90.0000015684.5183.72
5VDR 21846776 ChIP-Seq THP-1 Human1.313 × 10−80.0000018626.48117.67
6PPARG 20176806 ChIP-Seq 3T3-L1 Mouse3.075 × 10−80.0000035744.4777.40
7BCL6 25482012 ChIP-Seq CML-JURL-MK1 Human3.529 × 10−80.0000035744.1971.91
8ELK3 25401928 ChIP-Seq HUVEC Human9.817 × 10−80.0000087003.9663.91
9GATA1 19941827 ChIP-Seq MEL86 Mouse2.158 × 10−70.000017003.9961.29
10LMO2 20887958 ChIP-Seq HPC-7 Mouse3.020 × 10−70.000021414.1662.44
Table 3. Top 7 vitamin D target genes involved in the etiopathogenesis of respiratory infections and atopy.
Table 3. Top 7 vitamin D target genes involved in the etiopathogenesis of respiratory infections and atopy.
№ Gene MCID Disorder MIFTS Search Score
1CD14IGR001Ige Responsiveness, Atopic42.4715.22
2NOD2DRM053Dermatitis, Atopic61.189.83
3NFKBIAAST005Asthma79.867.92
4PDCD1LG2TBR010Tuberculosis59.936.74
5IRF5VRL011Viral Infectious Disease44.323.30
6MAPK13LNG099Lung Disease55.772.50
7LGALS9VRL011Viral Infectious Disease44.321.22
Note: MCID—MalaCards database identifier for this disorder. MIFTS—MalaCards InformaTion Score. MIFTS defines the richness of information in each card. Search score: Gene-disease association scores, computed as weighted sums of individual scores derived from OMIM, ClinVar, Orphanet, SwissProt/Humsavar, GeneTests, DISEASES, Novoseek and GeneCards.
Table 4. Predicted CEs in the enhancers of genes IRF5, MAPK13, LGALS9, PDCD1LG2, NFKBIA, NOD2 and CD14 were identified in THP-1 cells.
Table 4. Predicted CEs in the enhancers of genes IRF5, MAPK13, LGALS9, PDCD1LG2, NFKBIA, NOD2 and CD14 were identified in THP-1 cells.
Potential CEVDR MotifPartner MotifDistance Between Potential CE and TSSGeneGeneHancer Identifier/
GH Type
VDR/RXRAaggtcacagaggaaaggcctggagctgaggtcacag−25,133IRF5GH07J128909/
Promoter
VDR/NR2C2aggtcaacaggtctgagctctgaggtca−2296IRF5GH07J128932/
Enhancer
VDR/RXRAgggtcactcaggtcatggaggaggagagggtcactc−251MAPK13GH06J036126/Promoter
VDR/RXRAgggtcactcaggtcatgggaggggaggaggagaggg−251MAPK13GH06J036126/Promoter
VDR/PPARGaggtcaaagggtttaccaccaggtcaaagggtt168,537MAPK13GH06J036297/
Enhancer
VDR/NR2C2aggtgacccgggccttaggcccgggtca−297,160LGALS9GH17J027331/
Promoter
VDR/RXRAaggtcactggggctggggaggagggaaaggtcactg1242LGALS9GH17J027630/
Promoter
VDR/PPARGaggtcactggggctggggaggagggaaaggtca1242LGALS9GH17J027630/
Promoter
VDR/RXRAgggtcagcccggccatggtggggagaagggtcagcc−72,794PDCD1LG2GH09J005435/
Promoter
VDR/PPARGgggtcagcccggccatggtggggagaagggtca−72,794PDCD1LG2GH09J005435/
Promoter
VDR/RXRAagttcacggagttcaccacagagtcagagttcacgg−1324NFKBIAGH14J035396/Promoter
VDR/PPARGagttcacggagttcaccacagagtcagagttca−1324NFKBIAGH14J035396/Promoter
VDR/NR2C2agttcacggagttcacagtcagagttca−1324NFKBIAGH14J035396/Promoter
VDR/RXRAaggtcactggtgacagtgagcaatgggaggtcactg2225NOD2GH16J050695/
Promoter
VDR/NR2C2gggtcaccggggtgccgcctcggggtca16,038NOD2GH16J050710/
Enhancer
VDR/NR2C2ggttcaagcagttctccttccgggttca−33,724CD14GH05J140663/
Promoter
VDR/NR2C2acttcagggaggtcgaaggtcgaggtcg−15,685CD14GH05J140646/Promoter
VDR/NR2C2gggacgccagggtcacaggtcgaggtcg−15,705CD14GH05J140646/Promoter
VDR/NR2C2gggacgccagggtcacacgccagggtca−15,705CD14GH05J140646/Promoter
VDR/RXRAggttcacagaggaggggaggtgatcagggttcacag−1500CD14GH05J140635/
Enhancer
VDR/NR2C2ggttcacagaggaggggatcagggttca−1500CD14GH05J140635/
Enhancer
VDR/PPARGaggttaatgggttctaaagtagattaaaggtta24,519CD14GH05J140609/
Promoter
VDR/NR2C2gggttggagggtgcaggcttagggttgg36,255CD14GH05J140596/
Promoter
VDR/NR2C2gggtcagggaggtcacgtccaagggtca309,648CD14GH05J140322/
Enhancer
VDR/PPARGgggtcagggaggtcacacctggtccaagggtca309,648CD14GH05J140322/
Enhancer
Note: Table 4 partially duplicates Table S1 and consists detailed information about potential CEs in enhancers of IRF5, MAPK13, LGALS9, PDCD1LG2, NFKBIA, NOD2, CD14 genes.
Table 5. Primer sequences for real-time RT-PCR.
Table 5. Primer sequences for real-time RT-PCR.
GenePrimerSequences
18SForward5′-CGGCTACCACATCCAAGGAA-3′
Reverse5′-GCTGGAATTACCGCGGCT-3′
GAPDHForward5′-ACAACTTTGGTATCGTGGAAGGAC-3′
Reverse5′-CAGGGATGATGTTCTGGAGAGC-3′
NFKBIAForward5′-ACTCGTTCCTGCACTTGGC-3′
Reverse5′-CGAAAGTCTCGGAGCTCAG-3′
IRF5Forward5′-ATGAGCTCATCCTGTTCCAAAA-3′
Reverse5′-ATAGCTCCCCTGAGAACATC-3′
LGALS9Forward5′-GCTGTGAACTTTCAGACTGG-3′
Reverse5′- ACCATCACCTTGAAATCTGAGC-3′
NOD2Forward5′-TCATCTGGCTCATCCGGAG-3′
Reverse5′-AAATACAGAGCCTTGCAGACAC-3′
MAPK13Forward5′-GGGATGGAGTTCAGTGAGGA-3′
Reverse5′-TCACCACGTAGCCAGTCATC-3′
PDCD1LG2Forward5′-CAGATAGCAGCTTTATTCACAGT-3′
Reverse5′-TTGAGGTATGTGGAACGAGG-3′
CD14Forward5′-GACCATGGAGCGCGCGT-3′
Reverse5′-TGGAAGGCTTCGGACCAG-3′
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Popov, A.V.; Oshchepkov, D.Y.; Kononchuk, V.V.; Kalinina, T.S.; Valembakhov, I.S.; Lukin, A.D.; Kondyurina, E.G.; Zelenskaya, V.V.; Vavilin, V. Search for Potential VDR/Partner Composite Elements in Regulatory DNA of Genes Associated with Respiratory Infections and Atopic Diseases. Int. J. Mol. Sci. 2026, 27, 409. https://doi.org/10.3390/ijms27010409

AMA Style

Popov AV, Oshchepkov DY, Kononchuk VV, Kalinina TS, Valembakhov IS, Lukin AD, Kondyurina EG, Zelenskaya VV, Vavilin V. Search for Potential VDR/Partner Composite Elements in Regulatory DNA of Genes Associated with Respiratory Infections and Atopic Diseases. International Journal of Molecular Sciences. 2026; 27(1):409. https://doi.org/10.3390/ijms27010409

Chicago/Turabian Style

Popov, Alexey V., Dmitry Yu. Oshchepkov, Vladislav V. Kononchuk, Tatiana S. Kalinina, Ilya S. Valembakhov, Alexander D. Lukin, Elena G. Kondyurina, Vera V. Zelenskaya, and Valentin Vavilin. 2026. "Search for Potential VDR/Partner Composite Elements in Regulatory DNA of Genes Associated with Respiratory Infections and Atopic Diseases" International Journal of Molecular Sciences 27, no. 1: 409. https://doi.org/10.3390/ijms27010409

APA Style

Popov, A. V., Oshchepkov, D. Y., Kononchuk, V. V., Kalinina, T. S., Valembakhov, I. S., Lukin, A. D., Kondyurina, E. G., Zelenskaya, V. V., & Vavilin, V. (2026). Search for Potential VDR/Partner Composite Elements in Regulatory DNA of Genes Associated with Respiratory Infections and Atopic Diseases. International Journal of Molecular Sciences, 27(1), 409. https://doi.org/10.3390/ijms27010409

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop