Introducing a Porcine Inflammatory Ex Vivo Retina Model for Diabetic Retinopathy
Abstract
1. Introduction
1.1. Pathogenesis
1.2. Ex Vivo Models
1.3. Different Species
1.4. Research Question
2. Results
2.1. Glucose Treatment-Induced Cell Death
2.2. Treatment with Glucose-Induced Retinal Inflammation
2.3. Effect of Glucose Treatment on Endothelial Cells and Müller Cells
3. Discussion
3.1. Inflammation
3.2. Limitations
4. Materials and Methods
4.1. Culture Preparation
4.2. TUNEL
4.3. Immunofluorescence
4.4. Histological Evaluation
4.5. qRT-PCR
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| CD31 | Cluster of Differentiation 31 |
| Co | Control |
| DAPI | 4′-6-diaminodino-2-phenylindol-staining |
| DM | Diabetes mellitus |
| DR | Diabetic retinopathy |
| ELAM-1 | endothelial-leukocyte adhesion molecule 1 |
| EPO | Erythropoietin |
| GCL | Ganglion cell layer |
| GFAP | Glial fibrillary protein |
| Glc25 | 25 mM D-Glukose group |
| Glc50 | 50 mM D-Glukose group |
| GM-CSF | granulocyte-macrophage colony-stimulating factor |
| gp130 | Glycoprotein 130 |
| HIF | Hypoxia-inducible factor |
| ICAM-1 | Intercellular adhesion molecule 1 |
| IF | Immunofluorescence |
| IFN-γ | Interferon-γ |
| IKKβ | inhibitor of nuclear factor kappa-B kinase subunit beta |
| IL | Interleukin |
| INL | Inner nuclear layer |
| iNOS | Inducible nitric oxide synthetase |
| IPL | Inner plexiform layer |
| JAK | Januskinase |
| Man25 | 25 mM D-Mannitol group |
| Man50 | 50 mM D-Mannitol group |
| mRNA | Messenger RNA |
| NF-κB | nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells |
| ONL | Outer nuclear layer |
| OPL | Outer plexiform layer |
| PDGF-BB | Platelet-derived growth factor |
| qRT-PCR | Quantitative real-time polymerase chain reaction |
| RLP4 | Receptor-like protein 4 |
| STAT | Signal transducer and activator of transcription |
| TNF-α | Tumor necrosis factor α |
| TUNEL | Terminal deoxynucleotidyl transferase dUTP nick end labelling |
| VCAM-1 | vascular cell adhesion protein 1 |
| VEGF | Vascular endothelial growth factor |
References
- Ting, D.S.; Cheung, G.C.; Wong, T.Y. Diabetic retinopathy: Global prevalence, major risk factors, screening practices and public health challenges: A review. Clin. Exp. Ophthalmol. 2016, 44, 260–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lechner, J.; O’Leary, O.E.; Stitt, A.W. The pathology associated with diabetic retinopathy. Vis. Res. 2017, 139, 7–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antonetti, D.A. The neuroscience of diabetic retinopathy. Vis. Neurosci. 2021, 38, E001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Padovani-Claudio, D.A.; Morales, M.S.; Smith, T.E.; Ontko, C.D.; Namburu, N.S.; Palmer, S.A.; Jhala, M.G.; Ramos, C.J.; Capozzi, M.E.; McCollum, G.W.; et al. Induction, amplification, and propagation of diabetic retinopathy-associated inflammatory cytokines between human retinal microvascular endothelial and Muller cells and in the mouse retina. Cell Signal. 2024, 124, 111454. [Google Scholar] [CrossRef] [Scilit]
- de Lemos, L.; Antas, P.; Ferreira, I.S.; Santos, I.P.; Felgueiras, B.; Gomes, C.M.; Brito, C.; Seabra, M.C.; Tenreiro, S. Modelling neurodegeneration and inflammation in early diabetic retinopathy using 3D human retinal organoids. Vitr. Model. 2024, 3, 33–48. [Google Scholar] [CrossRef] [Scilit]
- Kowluru, R.A. Cross Talks between Oxidative Stress, Inflammation and Epigenetics in Diabetic Retinopathy. Cells 2023, 12, 300. [Google Scholar] [CrossRef]
- Tang, L.; Xu, G.T.; Zhang, J.F. Inflammation in diabetic retinopathy: Possible roles in pathogenesis and potential implications for therapy. Neural Regen. Res. 2023, 18, 976–982. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.; Kern, T.S. Inflammation in diabetic retinopathy. Prog. Retin. Eye Res. 2011, 30, 343–358. [Google Scholar] [CrossRef] [Scilit]
- Stitt, A.W.; Curtis, T.M.; Chen, M.; Medina, R.J.; McKay, G.J.; Jenkins, A.; Gardiner, T.A.; Lyons, T.J.; Hammes, H.P.; Simo, R.; et al. The progress in understanding and treatment of diabetic retinopathy. Prog. Retin. Eye Res. 2016, 51, 156–186. [Google Scholar] [CrossRef] [Scilit]
- Schnichels, S.; Paquet-Durand, F.; Löscher, M.; Tsai, T.; Hurst, J.; Joachim, S.C.; Klettner, A. Retina in a dish: Cell cultures, retinal explants and animal models for common diseases of the retina. Prog. Retin. Eye Res. 2021, 81, 100880. [Google Scholar] [CrossRef] [Scilit]
- U.S. Environmental Protection Agency. Directive to Prioritize Efforts to Reduce Animal Testing; U.S. Environmental Protection Agency: Washington, DC, USA, 2019.
- Schnichels, S.; Kiebler, T.; Hurst, J.; Maliha, A.M.; Loscher, M.; Dick, H.B.; Bartz-Schmidt, K.U.; Joachim, S.C. Retinal Organ Cultures as Alternative Research Models. Altern. Lab. Anim. 2019, 47, 19–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hurst, J.; Fietz, A.; Tsai, T.; Joachim, S.C.; Schnichels, S. Organ Cultures for Retinal Diseases. Front. Neurosci. 2020, 14, 583392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murali, A.; Ramlogan-Steel, C.A.; Andrzejewski, S.; Steel, J.C.; Layton, C.J. Retinal explant culture: A platform to investigate human neuro-retina. Clin. Exp. Ophthalmol. 2019, 47, 274–285. [Google Scholar] [CrossRef] [Scilit]
- Lai, A.K.; Lo, A.C. Animal models of diabetic retinopathy: Summary and comparison. J. Diabetes. Res. 2013, 2013, 106594. [Google Scholar] [CrossRef] [Scilit]
- Knott, R.M.; Robertson, M.; Muckersie, E.; Folefac, V.A.; Fairhurst, F.E.; Wileman, S.M.; Forrester, J.V. A model system for the study of human retinal angiogenesis: Activation of monocytes and endothelial cells and the association with the expression of the monocarboxylate transporter type 1 (MCT-1). Diabetologia 1999, 42, 870–877. [Google Scholar] [CrossRef] [Scilit]
- Louie, H.H.; Shome, A.; Kuo, C.Y.; Rupenthal, I.D.; Green, C.R.; Mugisho, O.O. Connexin43 hemichannel block inhibits NLRP3 inflammasome activation in a human retinal explant model of diabetic retinopathy. Exp. Eye Res. 2021, 202, 108384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oshitari, T.; Bikbova, G.; Yamamoto, S. Increased expression of phosphorylated c-Jun and phosphorylated c-Jun N-terminal kinase associated with neuronal cell death in diabetic and high glucose exposed rat retinas. Brain Res. Bull. 2014, 101, 18–25. [Google Scholar] [CrossRef] [Scilit]
- Valdes, J.; Trachsel-Moncho, L.; Sahaboglu, A.; Trifunovic, D.; Miranda, M.; Ueffing, M.; Paquet-Durand, F.; Schmachtenberg, O. Organotypic retinal explant cultures as in vitro alternative for diabetic retinopathy studies. Altex 2016, 33, 459–464. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zhou, Y.; Xiao, L.; Zheng, S.; Yan, N.; Chen, D. E2f1 mediates high glucose-induced neuronal death in cultured mouse retinal explants. Cell Cycle 2017, 16, 1824–1834. [Google Scholar] [CrossRef] [Scilit]
- Quiroz, J.; Yazdanyar, A. Animal models of diabetic retinopathy. Ann. Transl. Med. 2021, 9, 1272. [Google Scholar] [CrossRef] [Scilit]
- Slijkerman, R.W.; Song, F.; Astuti, G.D.; Huynen, M.A.; van Wijk, E.; Stieger, K.; Collin, R.W. The pros and cons of vertebrate animal models for functional and therapeutic research on inherited retinal dystrophies. Prog. Retin. Eye Res. 2015, 48, 137–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guduric-Fuchs, J.; Ringland, L.J.; Gu, P.; Dellett, M.; Archer, D.B.; Cogliati, T. Immunohistochemical study of pig retinal development. Mol. Vis. 2009, 15, 1915–1928. [Google Scholar]
- Middleton, S. Porcine ophthalmology. Vet. Clin. Food Anim. Pract. 2010, 26, 557–572. [Google Scholar] [CrossRef] [Scilit]
- van Dijk, H.W.; Verbraak, F.D.; Kok, P.H.; Stehouwer, M.; Garvin, M.K.; Sonka, M.; DeVries, J.H.; Schlingemann, R.O.; Abramoff, M.D. Early neurodegeneration in the retina of type 2 diabetic patients. Investig. Ophthalmol. Vis. Sci. 2012, 53, 2715–2719. [Google Scholar] [CrossRef] [Scilit]
- Schnichels, S.; Blak, M.; Hurst, J.; Dorfi, T.; Bartz-Schmidt, K.U.; Ziemssen, F.; Spitzer, M.S.; Schultheiss, M. Establishment of a retinal hypoxia organ culture model. Biol. Open 2017, 6, 1056–1064. [Google Scholar] [CrossRef] [Scilit]
- Zapuskalov, I.V.; Filippova, S.V.; Shilova, O.G.; Krivosheina, O.I. The role of the osmotic pressure of the blood in the pathogenesis of diabetic changes in the retin. Vestn. Oftalmol. 2000, 116, 32–34. [Google Scholar] [PubMed]
- Zheng, L.; Kern, T.S. Role of nitric oxide, superoxide, peroxynitrite and PARP in diabetic retinopathy. Front. Biosci. 2009, 14, 3974–3987. [Google Scholar] [CrossRef] [Scilit]
- Gopinathan, G.; Milagre, C.; Pearce, O.M.; Reynolds, L.E.; Hodivala-Dilke, K.; Leinster, D.A.; Zhong, H.; Hollingsworth, R.E.; Thompson, R.; Whiteford, J.R.; et al. Interleukin-6 Stimulates Defective Angiogenesis. Cancer Res. 2015, 75, 3098–3107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goldman, D. Muller glial cell reprogramming and retina regeneration. Nat. Rev. Neurosci. 2014, 15, 431–442. [Google Scholar] [CrossRef] [Scilit]
- Pollak, J.; Wilken, M.S.; Ueki, Y.; Cox, K.E.; Sullivan, J.M.; Taylor, R.J.; Levine, E.M.; Reh, T.A. ASCL1 reprograms mouse Muller glia into neurogenic retinal progenitors. Development 2013, 140, 2619–2631. [Google Scholar] [CrossRef] [Scilit]
- Sanges, D.; Simonte, G.; Di Vicino, U.; Romo, N.; Pinilla, I.; Nicolas, M.; Cosma, M.P. Reprogramming Muller glia via in vivo cell fusion regenerates murine photoreceptors. J. Clin. Investig. 2016, 126, 3104–3116. [Google Scholar] [CrossRef] [Scilit]
- Kuehn, S.; Hurst, J.; Rensinghoff, F.; Tsai, T.; Grauthoff, S.; Satgunarajah, Y.; Dick, H.B.; Schnichels, S.; Joachim, S.C. Degenerative effects of cobalt-chloride treatment on neurons and microglia in a porcine retina organ culture model. Exp. Eye Res. 2017, 155, 107–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abu El-Asrar, A.M.; Ahmad, A.; Allegaert, E.; Siddiquei, M.M.; Alam, K.; Gikandi, P.W.; De Hertogh, G.; Opdenakker, G. Galectin-1 studies in proliferative diabetic retinopathy. Acta Ophthalmol. 2020, 98, e1–e12. [Google Scholar] [CrossRef] [Scilit]
- Figueiredo, A.M.; Barbacena, P.; Russo, A.; Vaccaro, S.; Ramalho, D.; Pena, A.; Lima, A.P.; Ferreira, R.R.; Fidalgo, M.A.; El-Marjou, F.; et al. Endothelial cell invasion is controlled by dactylopodia. Proc. Natl. Acad. Sci. USA 2021, 118, e2023829118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, G.; Que, L.; Liu, Y.; Lu, Q. Interplay of endothelial-mesenchymal transition, inflammation, and autophagy in proliferative diabetic retinopathy pathogenesis. Heliyon 2024, 10, e25166. [Google Scholar] [CrossRef] [Scilit]
- Lin, F.; Wang, N.; Zhang, T.C. The role of endothelial-mesenchymal transition in development and pathological process. IUBMB Life 2012, 64, 717–723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, A.A.; Biswas, S.; Feng, B.; Chen, S.; Gonder, J.; Chakrabarti, S. lncRNA H19 prevents endothelial-mesenchymal transition in diabetic retinopathy. Diabetologia 2019, 62, 517–530. [Google Scholar] [CrossRef] [Scilit]
- Busik, J.V.; Mohr, S.; Grant, M.B. Hyperglycemia-induced reactive oxygen species toxicity to endothelial cells is dependent on paracrine mediators. Diabetes 2008, 57, 1952–1965. [Google Scholar] [CrossRef] [Scilit]
- Balzamino, B.O.; Cacciamani, A.; Dinice, L.; Cecere, M.; Pesci, F.R.; Ripandelli, G.; Micera, A. Retinal Inflammation and Reactive Muller Cells: Neurotrophins’ Release and Neuroprotective Strategies. Biology 2024, 13, 1030. [Google Scholar] [CrossRef] [Scilit]
- Schultz, R.; Krug, M.; Precht, M.; Wohl, S.G.; Witte, O.W.; Schmeer, C. Frataxin overexpression in Muller cells protects retinal ganglion cells in a mouse model of ischemia/reperfusion injury in vivo. Sci. Rep. 2018, 8, 4846. [Google Scholar] [CrossRef] [Scilit]
- Haydinger, C.D.; Ferreira, L.B.; Williams, K.A.; Smith, J.R. Mechanisms of macular edema. Front. Med. 2023, 10, 1128811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murakami, Y.; Notomi, S.; Hisatomi, T.; Nakazawa, T.; Ishibashi, T.; Miller, J.W.; Vavvas, D.G. Photoreceptor cell death and rescue in retinal detachment and degenerations. Prog. Retin. Eye Res. 2013, 37, 114–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andreazzoli, M.; Longoni, B.; Angeloni, D.; Demontis, G.C. Retinoid Synthesis Regulation by Retinal Cells in Health and Disease. Cells 2024, 13, 871. [Google Scholar] [CrossRef] [Scilit]
- Hurst, J.; Kuehn, S.; Jashari, A.; Tsai, T.; Bartz-Schmidt, K.U.; Schnichels, S.; Joachim, S.C. A novel porcine ex vivo retina culture model for oxidative stress induced by H2O2. Altern. Lab. Anim. 2017, 45, 11–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chandler, M.J.; Smith, P.J.; Samuelson, D.A.; MacKay, E.O. Photoreceptor density of the domestic pig retina. Vet. Ophthalmol. 1999, 2, 179–184. [Google Scholar] [CrossRef] [Scilit]
- Hebel, R. Distribution of retinal ganglion cells in five mammalian species (pig, sheep, ox, horse, dog). Anat. Embryol. 1976, 150, 45–51. [Google Scholar] [CrossRef] [Scilit]
- Simoens, P.; De Schaepdrijver, L.; Lauwers, H. Morphologic and clinical study of the retinal circulation in the miniature pig. A: Morphology of the retinal microvasculature. Exp. Eye Res. 1992, 54, 965–973. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]





| Reagent | Quantity |
|---|---|
| NeurobasalTM-A Medium | 50 mL |
| N2-Supplement (1X) | 500 µL |
| B-27™ Supplement minus Insulin | 1 mL |
| Ciliary Neurotrophic Factor (CNTF) | 0.5 µL |
| Brain-derived neurotrophic factor (BDNF) | 0.5 µL |
| Penicillin/Streptomycin | 500 µL |
| Gentamicin | 50 µL |
| Primary Antibodies | |||
|---|---|---|---|
| Name | Species | Manufacturer | Dilution |
| GFAP | Mouse | BD Pharmigen, Heidelberg, Germany, # 556330 | 1:100 |
| TNF-α | Goat | Santa Cruz, Eugene, OR, USA, # sc-1348 | 1:100 |
| iNOS | Rabbit | ThermoFischer, Waltham, MA, USA, # PA1-036 | 1:50 |
| Secondary Antibodies | |||
| Name | Species | Manufacturer | Dilution |
| Alexafluor 488 | Goat, anti-mouse | Invitrogen, Waltham, MA, USA, # A11001 | 1:1000 |
| Alfexafluor 488 | Donkey, anti-rabbit | Invitrogen, Waltham, MA, USA, # A21206 | 1:100 |
| Alexafluor 555 | Donkey, anti-goat | Abcam, Camebridge, Great Britain, # ab150130 | 1:50 |
| Gene | Forward 5′–3′ | Reverse 3′–5′ |
|---|---|---|
| b-Actin | GGAGTCTCTCCGATCTGTGC | ATCGGGGAAGAAAGGACAGT |
| RLP4 | CAAGAGTAACTACAACCTTC | GAACTCTACGATGAATCTTC |
| IL-6 | CACCAGGAACGAAAGAGAGC | GTTTTGTCCGGAGAGGTGAA |
| iNOS | TGTTCAGCTGTGCCTTCAAC | CAGAACTGGGGGTACATGCT |
| TNF-α | CCACCAACGTTTTCCTCACT | CCAAAATAGACCTGCCCAGA |
| GFAP | GGAGAAGCCTTTGCTACACG | GGAGAAGCCTTTGCTACACG |
| CD31 | CATTTCCAAAGTCAGCAGCA | CATCATCATGCCTCCCTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mühle, A.; Schnichels, S.; Hurst, J. Introducing a Porcine Inflammatory Ex Vivo Retina Model for Diabetic Retinopathy. Int. J. Mol. Sci. 2025, 26, 3919. https://doi.org/10.3390/ijms26083919
Mühle A, Schnichels S, Hurst J. Introducing a Porcine Inflammatory Ex Vivo Retina Model for Diabetic Retinopathy. International Journal of Molecular Sciences. 2025; 26(8):3919. https://doi.org/10.3390/ijms26083919
Chicago/Turabian StyleMühle, Agnes, Sven Schnichels, and José Hurst. 2025. "Introducing a Porcine Inflammatory Ex Vivo Retina Model for Diabetic Retinopathy" International Journal of Molecular Sciences 26, no. 8: 3919. https://doi.org/10.3390/ijms26083919
APA StyleMühle, A., Schnichels, S., & Hurst, J. (2025). Introducing a Porcine Inflammatory Ex Vivo Retina Model for Diabetic Retinopathy. International Journal of Molecular Sciences, 26(8), 3919. https://doi.org/10.3390/ijms26083919

