Genome-Wide Identification and Expression Analysis of Thionin Family in Rice (Oryza sativa) and Functional Characterization of OsTHION15 in Drought Stress and ABA Stress

Response to Reviewer 3 Comments

1. Summary

Thank you very much for taking the time to review this manuscript. Please find the detailed responses below and the corresponding revisions/corrections highlighted/in track changes in the re-submitted files.

2. Questions for General Evaluation

Reviewer’s Evaluation

Does the introduction provide sufficient background and include all relevant references?

Yes

Are all the cited references relevant to the research?

Can be improved

Is the research design appropriate?

Can be improved

Are the methods adequately described?

Can be improved

Are the results clearly presented?

Can be improved

Are the conclusions supported by the results?

Can be improved

3. Point-by-point response to Comments and Suggestions for Authors

4. Response to Comments on the Quality of English Language

Point 1: The English could be improved to more clearly express the research.

Response 1:  We sincerely appreciate the reviewer's constructive feedback on improving the manuscript's language clarity. In response, we have thoroughly revised the entire text to enhance readability and scientific precision, including refining phrasing for better flow, standardizing key terminology, and correcting grammatical structures. All language edits have been carefully implemented and marked in the revised manuscript. We believe these revisions have significantly strengthened the manuscript's overall quality and clarity. 

Response to Reviewer 2 Comments

1. Summary

Thank you very much for taking the time to review this manuscript. Please find the detailed responses below and the corresponding revisions/corrections highlighted/in track changes in the re-submitted files.

2. Questions for General Evaluation

Reviewer’s Evaluation

Does the introduction provide sufficient background and include all relevant references?

Must be improved

Are all the cited references relevant to the research?

Must be improved

Is the research design appropriate?

Must be improved

Are the methods adequately described?

Must be improved

Are the results clearly presented?

Must be improved

Are the conclusions supported by the results?

Must be improved

3. Point-by-point response to Comments and Suggestions for Authors

Comments 1: This study addresses an important area regarding environmental adaptability and provides potentially valuable insights. However, the manuscript requires significant revisions to improve clarity and rigor, particularly in the Methods section.

Response 1: We sincerely appreciate the reviewer's constructive feedback and recognition of our study's significance. In response to the concerns regarding methodological clarity and rigor, we have thoroughly revised the Methods section to include detailed experimental protocols (e.g., stress treatment conditions, RNA-seq analysis parameters, and CRISPR/Cas9 validation steps), and added supplemental materials (primers, qRT-PCR). All revisions were highlighted in the manuscript.

Comments 2: Introduction:   When discussing the innate immune system (lines 46-47, consider incorporating and citing relevant studies on plant defense responses. For example, the following papers may offer valuable insights into the complexities of plant-aphid interactions and genotype-specific defenses:
1. The effectiveness of physical and chemical defense responses of wild emmer wheat against aphids depends on leaf position and genotype'
2. Variation Between Three Eragrostis tef Accessions in Defense Responses to Rhopalosiphum padi Aphid Infestation'

Response 2: Thank you for highlighting this point.  We fully agree with your comment regarding the importance of these references.  After carefully reviewing the two suggested articles on enhancing crop resistance to pests—which provide valuable insights highly relevant to our study—we have incorporated citations to these works in the introduction. ( Lines 46–47).

Comments 3: Lines 106-115: Why authors have not mentioned anywhere about salt stress?

Response 3: Thank you for raising this important point. Our expression analysis did indeed show significant upregulation of OsTHION15 following salt stress, suggesting its potential involvement in rice salt stress response. However, phenotypic comparison under salt stress conditions revealed no observable differences between Osthion15 mutant and wild-type plants. This finding suggests possible functional redundancy of OsTHION15 in salt stress adaptation. Consequently, our study focuses primarily on characterizing THION15's role in ABA and drought stress response, where we observed more definitive phenotype effects.

Comments 4: Line 543: Specify the exact database and genome version used to retrieve the Rice Thion protein sequences.

Response 4: Thank you for your comment.  We retrieved 44 OsTHION protein sequences from the Phytozome V13 database using the Oryza sativa genome version MSN v7.0 (Phytozome genome ID: 323, NCBI taxonomy ID: 39947).  We have revised the corresponding section and added the proper citations in the manuscript. (Line 593-595, highlighted in yellow).

Comments 5: - Consider expanding the analysis to include wild rice species. Utilizing databases containing wild rice genomes could provide a comparative perspective, given their potential for enhanced stress tolerance. This would strengthen the study's relevance to environmental adaptability.

Response 5: We sincerely appreciate the reviewer's insightful suggestion regarding wild rice species. While our current study focused on Zhonghua 11, we have expanded the discussion (Lines 577-588) to highlight: (1) the genetic diversity of wild rice THION orthologs and their stress-responsive traits, and (2) comparative insights from the Oryza super-pangenome project revealing wild rice-specific gene expansions linked to stress tolerance. Looking forward, we propose to analyze OsTHION15 homologs in wild rice datasets for GWAS-based screening of superior THION alleles. Although current transgenic regulations may limit direct utilization of wild rice genes, their genomic insights remain invaluable for marker-assisted breeding. These additions significantly strengthen our work's translational impact, and we thank the reviewer for this constructive suggestion.

Comments 6: Figure 3, 4: All the details of tissue sampling for qrt-PCR validation and a list of all the primers used in qrt-PCR analysis used in validation steps.

Response 6: Thank you for your valuable feedback, which has significantly improved our manuscript. We sincerely apologize for the omission of these important methodological details.    We have now thoroughly revised the Methods section to include complete information regarding tissue sampling procedures for qRT-PCR validation. The details of tissue sampling for qRT-PCR validation has been added and modified in Section4.3 (highlighted in yellow, Line 615-625). Additionally, we have updated Table S8 to comprehensively list all primers used throughout our qRT-PCR analyses.

Comments 7: - In the introduction section, you have mentioned the role of THION genes towards biotic stress resilience; did you validate some of genes in response to biotic stress?

Response 7: Thank you for your insightful question. In the introduction, we referenced the documented role of the THION genes in biotic stress responses, as previous studies have reported its involvement in plant disease resistance (highlighted in yellow, Line 85-90). However, the primary focus of our study was to investigate the response of the THION gene to abiotic stress conditions. While we did not experimentally validate its role in biotic stress in this work, our findings contribute to understanding its function under abiotic stress, which may provide a foundation for future studies exploring its dual roles in stress responses.

Comments 8: Figure 4B: Provide detailed protocols for the drought, salt, and cold stress treatments. Include the age of the plants at the time of treatment, the specific concentrations or intensities of the stressors, and the duration of the treatments. Elaborate on the tissue sampling procedures under different time points. Specify the tissues collected and the time intervals. Include the expression analysis of known stress-responsive marker genes to validate the effectiveness of the stress treatments.

Response 8: We sincerely appreciate the reviewer's constructive feedback. In our revised Methods section 4.3 (Lines 564-574), we have now provided complete experimental details for the stress treatments conducted on 14-day-old Zhonghua 11 japonica rice seedlings. The treatments included: salt stress (150 mM NaCl), drought stress (200 mM mannitol), and cold stress (4°C). Whole seedlings were collected at specific time points (0, 3, 6, 12, and 24 hours post-treatment).

In addition, the expression of known stress-responsive marker genes (drought stress genes: OsDREB2A and Os-NAC2, salt stress genes: OsHAK9 and OsHAK21, cold stress genes: OsCBF1 and OsTPP1) were performed to validate the effectiveness of the stress treatments to validate the efficacy of the drought, salt, and cold stress treatments. The experimental method of expression verification was supplemented in section 4.3 (Line 625-631) and the results were shown in Figure S5.

Comments 9: Justify the use of the Student's t-test. Consider using a one-way ANOVA, which would be more appropriate for analyzing temporal treatment effects and providing a more robust assessment of significance.

Response 9: We sincerely appreciate the reviewer's valuable suggestion regarding our statistical methodology. We fully agree that one-way ANOVA is indeed more appropriate for analyzing temporal treatment effects, as it provides a more comprehensive assessment of significance across multiple time points. I am very sorry for the wrong marks in the Figure notes. Significance analysis in our study was conducted by using one-way ANOVA analysis of variance in EXCEL. We have made revisions in the paper (Line 257, 309, 331 and 451).

Comments 9: Line 280: Provide a more detailed description of the gene editing technology used to generate the Osthion15 mutant lines Osthion15-1 and Osthion15-2. Include information on the specific editing method (e.g., CRISPR-Cas9), the target sequence, and the validation procedures used to confirm the mutations.

Response 9: We sincerely appreciate the reviewer's valuable suggestion regarding our gene editing methodology. In response, we have added a comprehensive CRISPR/Cas9 gene editing protocol in Section 4.6 (Lines 650-658) that details our precise targeting of the OsTHION15 gene sequence "CCGTTTTGCGCATGGCACAAGGG", including mutant screening and verification procedures using OsTTHION15-ID-F/R primers (provided in Table S8). These revisions ensure complete methodological transparency and experimental reproducibility for our gene editing approach.

Comments 10: - Include a comprehensive section detailing the RNA-sequencing methodology. 
Library preparation protocols. Sequencing platform and parameters. Bioinformatic pipeline for data analysis, including read mapping, differential gene expression (DEG) analysis, Gene Ontology (GO) enrichment, and KEGG pathway analysis.

Response 10: Sincerely appreciate the reviewer's valuable suggestions regarding our transcriptomic analysis. In response to your comments, we have substantially enhanced our RNA-sequencing and bioinformatics methodology in the Methods section (Lines 676-682), including detailed descriptions of our analytical pipeline from quality control (Fast QC) to differential expression analysis) and functional enrichment (GO/KEGG). We have also incorporated key references to support our analytical framework and expanded the discussion of transcriptomic findings. These revisions provide a more rigorous and reproducible foundation for our RNA-seq data interpretation while maintaining consistency with established bioinformatics standards in the field.

Comments 11: - A graphical model summarizing the key findings and proposed mechanisms would significantly enhance the clarity and impact of the research. 

Response 11: We sincerely appreciate the reviewer's insightful suggestion regarding the need for a graphical summary of our key findings. In response, we have designed a schematic model (as Figure 12) that visually integrates our major discoveries about the role of OsTHION15 in drought and ABA stress responses. We believe this graphical representation significantly enhances the clarity of our proposed mechanisms and provides readers with an immediate, intuitive understanding of the function of OsTHION15 in stress response pathways.

4. Response to Comments on the Quality of English Language

Point 1: the English is fine and does not require any improvement.

Response 1:  We are grateful for your kind assessment of our manuscript and appreciate the time you have taken to review our work.  

Response to Reviewer 3 Comments

1. Summary

Thank you very much for taking the time to review this manuscript. Please find the detailed responses below and the corresponding revisions/corrections highlighted/in track changes in the re-submitted files.

2. Questions for General Evaluation

Reviewer’s Evaluation

Does the introduction provide sufficient background and include all relevant references?

Yes

Are all the cited references relevant to the research?

Can be improved

Is the research design appropriate?

Can be improved

Are the methods adequately described?

Can be improved

Are the results clearly presented?

Can be improved

Are the conclusions supported by the results?

Can be improved

3. Point-by-point response to Comments and Suggestions for Authors

4. Response to Comments on the Quality of English Language

Point 1: The English could be improved to more clearly express the research.

Response 1:  We sincerely appreciate the reviewer's constructive feedback on improving the manuscript's language clarity. In response, we have thoroughly revised the entire text to enhance readability and scientific precision, including refining phrasing for better flow, standardizing key terminology, and correcting grammatical structures. All language edits have been carefully implemented and marked in the revised manuscript. We believe these revisions have significantly strengthened the manuscript's overall quality and clarity. 

Comments 1: Comments and Suggestions for Authors- I don't have any specific comments except that the statistics in Figure 4B are missing. Also improve the font size of the X-Y axis of all the figures; more specifically, Figure 4B, 8A-E, 11B,D.

- I strongly recommend the editor accept this paper after updating figures and statiscs.

Response 1: We sincerely appreciate the reviewer’s valuable comments, which have greatly improved our manuscript. In response to your suggestions, we have added statistical data for the qRT-PCR results in Figure 4B (now in Table S5) and adjusted the numbering of subsequent schedules (Table S6–S9), with corresponding updates in the text. Additionally, we have improved the clarity and the font size of Figures 1, 2, 3, 4, 8, 10, and 11 to ensure higher-quality visuals. Thank you for your constructive feedback, which has strengthened our manuscript.