Next Article in Journal
The Role of Rapid Curing on the Interrelationship Between Temperature Rise, Light Transmission, and Polymerisation Kinetics of Bulk-Fill Composites
Next Article in Special Issue
AcMYB176-Regulated AcCHS5 Enhances Salt Tolerance in Areca catechu by Modulating Flavonoid Biosynthesis and Reactive Oxygen Species Scavenging
Previous Article in Journal
A Two-Phage Cocktail Modulates Gut Microbiota Composition and Metabolic Profiles in an Ex Vivo Colon Model
Previous Article in Special Issue
Genome-Wide Identification and Expression Assessment for the Phosphate Transporter 2 Gene Family Within Sweet Potato Under Phosphorus Deficiency Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 6
10.3390/ijms26062807
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

DNA Demethylase ROS1 Interferes with DNA Methylation and Activates Stress Response Genes in Plants Infected with Beet Severe Curly Top Virus

by
Taicheng Jin
,
Yushuo Li
,
Xu Sun
,
Yidi Li
,
Zhuyi Xiao
,
Weiyan Wang
,
Jiaxue Yu
and
Liping Yang
*
The School of Life Sciences, Jilin Normal University, Siping 136000, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(6), 2807; https://doi.org/10.3390/ijms26062807
Submission received: 14 February 2025 / Revised: 11 March 2025 / Accepted: 12 March 2025 / Published: 20 March 2025
(This article belongs to the Special Issue Physiology and Molecular Biology of Plant Stress Tolerance: 2nd Edition)
Browse Figures
Versions Notes

Abstract

DNA methylation is one mechanism of epigenetic regulation in plants. Small interfering RNAs (siRNAs) targeted endogenous genes and caused the promoters to be hypermethylated, namely RNA-directed DNA methylation (RdDM). Repressor of silencing 1 (ROS1) is an active DNA demethylase involved in the regulation of DNA methylation. This study indicates that ROS1-mediated DNA demethylation plays important roles in regulating the expression of these stress response genes and in response to biotic stresses. Further experiments confirmed that the expression level of the ROS1 gene was significantly upregulated in A. thaliana plants infected with beet severe curly top virus (BSCTV). Moreover, the DNA sequencing results demonstrated that ROS1 interferes with DNA methylation of repeat regions in the promoters of ACD6, GSTF14, and ACO3 in A. thaliana plants infected with BSCTV. These findings reveal the epigenetic mechanisms by which ROS1 regulates the expression of the stress response genes, thereby improving the adaptability of plants to biotic stresses.

1. Introduction

RNA silencing has been an important defense pathway in plants over the course of evolution [1,2,3]. The RNA-induced silencing complex (RISC) recognizes and cleaves target mRNAs, resulting in post-transcriptional gene silencing (PTGS) [4,5,6]. In plants, the RNA-directed DNA methylation (RdDM) pathway targets repeat sequences in the promoter of endogenous genes or invasive DNA sequences, which leads to transcriptional gene silencing (TGS) [7]. The RdDM pathway can be triggered by the transcription of inverted repeats or dispersed repeats, and heterochromartin-realted siRNAs play an important role in DNA methylation [8,9]. In the process, the plant-specific Dicer-like ribonuclease 3 (DCL3) cleaves dsRNA into 24 nt siRNAs, which are loaded in Argonaut 4 (AGO4). AGO4 protein recruits methyltransferase DDM1, MET1, and CMT3 to form RISC and perform the de novo DNA methylation of cytosines and maintenance of methylation in the symmetric CG and CHG contexts (H is A, C, or T) and the asymmetric CHH context [10,11,12,13,14]. The RdDM pathway also plays an important role in defense against invasive DNA sequences [9].
Plant viruses counter DNA methylation-mediated defense by the virial suppressors, including DNA viruses and RNA viruses [15,16,17]. A previous study revealed that the C2 protein encoded by BSCTV counters host defense responses via the regulation of S-adenosylmethionine decarboxylase 1 (SAMDC1), which increases the dcSAM/SAM ratio and inhibits DNA methylation [18]. Our previous studies revealed that the viral suppressor C2 can decrease the DNA methylation of dispersed repeats (DRs) in the promoter of ACD6, which is an upstream regulator gene in the salicylic acid (SA) pathway in Arabidopsis thaliana [7]. We also found that the viral suppressor HC-Pro from tobacco vein banding mosaic virus (TVBMV) decreases in DNA methylation in the promoter and activates Accelerated cell death 6 (ACD6) and NONEXPRESSOR OF PR GENES 1 (NPR1) involved in the SA pathway and auxin biosynthesis genes [15,19].
Active DNA demethylation is performed by DNA demethylases in A. thaliana plants, including the repressor of silencing 1 (ROS1), 5-mC glycosylase (Demeter, DME), Demeter-like protein 2 (DML2), and Demeter-like protein 3 (DML3) [20,21]. In plants, ROS1 regulates DNA methylation and promotes the expression of defense-related genes [22,23]. Studies have shown that ros1 mutants are more susceptible to Pseudomonas syringae infection [24]. ROS1 has important functions in the regulation of stress tolerance and pathogen defense in plants [25,26,27]. For example, ROS1 promotes the expression of NICOTINAMIDASE 3 (NIC3) and participates in the abscisic acid (ABA) response in A. thaliana plants [28]. Our previous studies indicate that ROS1-mediated DNA demethylation plays an important role in the transcriptional activation of defense-related genes and stress response genes when A. thaliana plants are subjected to abiotic stresses [29]. However, whether ROS1-mediated DNA demethylation plays a role in virus–host interactions still remains unclear. And the molecular mechanisms that ROS1 actively in response to biotic stresses remain unknown.
In this study, we found that ros1-defective mutants are hypersensitive to BSCTV infection and that the accumulation of BSCTV in virus-infected ros1 mutants was clearly greater than that in virus-infected Col-0 plants. These findings revealed the important role of ROS1 in regulating the expression of the stress response genes, including ABA pathway-related gene ACO3, stress-responsive gene GSTF14, and defense-related gene ACD6. Further experiments demonstrated that ROS1 was induced by BSCTV in A. thaliana plants and involved in regulating DNA demethylation in the promoters of ACD6, GSTF14, and ACO3. This study suggests that ROS1 actively responds to biotic stresses by regulating the DNA methylation of stress response genes, thereby improving the adaptability of plants to the environment.

2. Results

2.1. Symptoms of BSCTV-Infected Arabidopsis Thaliana Col-0 and ros1 Plants

A. thaliana wild-type Col-0 plants and ros1-defective mutants were used as plant materials, and Agrobacterium inoculation was used to perform BSCTV infection. The mock-infected Col-0 plants used as controls (Figure 1a) and the leaves of the mock-infected ros1 mutants presented no developmental defects (Figure 1b), and the leaves of the BSCTV-infected ros1 mutants presented more severe curling deformation and yellowing (Figure 1d) than those of BSCTV-infected Col-0 plants (Figure 1c) at 7 days post-inoculation (dpi). The most typical viral symptom was a curled-top phenomenon in BSCTV-infected Col-0 at 14 dpi (Figure 1f,i). The flowers of BSCTV-infected ros1 mutants developed more severe curled-top symptoms (Figure 1g,j), whereas the flowers of the mock-infected ros1 mutants presented no developmental defects (Figure 1e).
Our previous study revealed that ros1 mutants presented more severe phenotypic changes in p-HCPro-infected Col-0 plants [19]. To examine whether ros1 mutants are more susceptible to BSCTV infection, the accumulation of BSCTV in virus-infected Col-0 and ros1 plants was determined by Southern blotting at 14 dpi. Consistent with these observations, the Southern blotting results indicated that the accumulation of BSCTV in virus-infected ros1 mutants was clearly greater than that in virus-infected Col-0 plants (Figure 1k). These results suggest that ROS1 might play a role in the defense against the invasion of viruses.

2.2. Increased Expression of Stress Response Genes Is Mediated by C2 in BSCTV-Infected and C2 Transgenic Plants

Our previous study revealed that tobacco vein banding mosaic virus (TVBMV) increased the expression of defense-related gene ACD6 [7]. To examine whether BSCTV infection also increases the expression of stress response genes GSTF14 and ACO3, total RNA was extracted from mock-infected and BSCTV-infected Col-0 plants at 14 dpi. The RNA was used for RT experiments to obtain cDNA, and the expression of stress response genes was determined by qPCR. When the expression levels in mock-infected Col-0 plants were used as a control, the expression levels of ACD6, GSTF14, and ACO3, the defense-related genes NPR1, and pathogenesis-related gene 5 (PR5) were significantly increased in BSCTV-infected plants (Figure 2a,b).
To confirm whether the increased expression of these genes was also regulated by the virial suppressor C2 encoded by BSCTV, the expression levels of these genes in C2 transgenic plants were determined via RT-qPCR. The results confirmed that the expression levels of stress response genes and the defense-related genes were significantly upregulated in C2 transgenic plants compared with those in the empty-vector controls (Figure 2c,d). These results indicated that the BSCTV and C2 proteins can induce the expression of stress response genes.

2.3. The Repressor of Silencing ROS1 Is Involved in Regulating the Expression of the Stress Response Genes in BSCTV-Infected Plants

Our previous studies revealed that ROS1 plays an important role in the regulation of the stress response genes in A. thaliana plants subjected to cold stress [29]. To determine whether ROS1 is involved in the regulation of gene expression in BSCTV-infected plants, the expression levels of the stress response genes were analyzed via RT-qPCR in BSCTV-infected Col-0 plants and ros1 mutants. Relative to the expression levels in the mock-infected Col-0 plants used as controls, the expression of ACD6, GSTF14, and ACO3 was significantly increased in BSCTV-infected Col-0 plants at 14 dpi. However, this increase in expression in the ros1 mutants at 14 dpi was partially inhibited (Figure 3a). The expression levels of these genes in the ros1 mutants were not significantly altered compared with those in mock-infected Col-0 plants. Moreover, the results demonstrated that ROS1 also plays a role in the regulation of defense-related genes NPR1 and PR5 in BSCTV-infected plants (Figure 3b).
We detected the expression of related genes in plants mutated at key functional elements of the RdDM pathway. Compared with those in Col-0 ecotypes, the expression levels of ACD6, NPR1, ACO3, and GSTF14 clearly increased in the mutants ago4, met1, dcl3, ddm1, and cmt3 (Figure 3c). In addition, the results revealed that the expression level of ROS1 was significantly greater in BSCTV-infected plants than in mock-infected plants at 10 dpi, 15 dpi, and 20 dpi (Figure 3d). Our previous studies revealed that HCPro, which is encoded by TVBMV, induced the expression of ROS1 [19]. These results indicate that both the repressor of silencing ROS1 and the virial suppressor C2 are involved in the activation of the stress response genes and the defense-related genes.

2.4. Increased Gene Expression Is Correlated with ROS1-Mediated DNA Demethylation in the Promoters of Stress Response Genes

To investigate whether increased gene expression is correlated with ROS1-mediated DNA demethylation, we performed sequencing analysis of the DNA methylation of repeat sequences at the promoters of related genes in BSCTV-infected Col-0 and ros1 plants. The sequencing analysis discovered that the DNA methylation levels in the ACD6 promoter were reduced by 24.91% (a change from 82.16 to 57.25%) in CG sites, by 18.09% (a change from 25.65 to 7.56%) in CHG sites, and by 11.93% (a change from 17.28 to 5.35%) in CHH sites in BSCTV-infected Col-0 compared with those in mock-infected Col-0 (Figure 4a). The DNA methylation levels in the ACD6 promoter were reduced by 15.50% (a change from 85.75 to 70.25%) in CG sites, by 10.22% (a change from 28.33 to 18.11%) in CHG sites, and by 6.72% (a change from 19.52 to 12.80%) in CHH sites in BSCTV-infected ros1 plants compared with those in ros1 mutants. The results indicate that the decrease in DNA methylation in the ACD6 promoter in BSCTV-infected ros1 mutants was partially inhibited (Figure 4a).
Sequencing analysis of DNA methylation in the promoters of AtGSTF14 and AtACO3 further confirmed the role of ROS1. Compared with those in mock-infected Col-0, the DNA methylation levels in the promoters of GSTF14 were reduced by 13.74% (a change from 92.30 to 78.56%) in CG sites, by 14.29% (a change from 66.04 to 52.75%) in CHG sites, and by 12.13% (a change from 20.78 to 8.65%) in CHH sites in BSCTV-infected Col-0, whereas the decreases in DNA methylation in the promoter of GSTF14 in the BSCTV-infected ros1 mutants were clearly inhibited (Figure 4b). The DNA methylation levels in the promoters of ACO3 were reduced by 5.33% (a change from 93.77 to 88.00%) in CG sites, by 35.43% (a change from 65.43 to 30.00%) in CHG sites, and by 31.03% (a change from 39.19 to 9.38%) in CHH sites in BSCTV-infected Col-0 plants, whereas the decreases in the DNA methylation in the promoter of ACO3 in the BSCTV-infected ros1 mutants were clearly inhibited (Figure 4c). Moreover, compared with those in mock-infected Col-0 plants, the DNA methylation levels in the promoters of ACD6, GSTF14, and ACO3 in the ros1 plants were clearly not altered (Figure 4a–c). These results demonstrated that the repressor of silencing ROS1 is involved in the process of DNA demethylation in the promoters of these genes.

3. Discussion

3.1. ROS1 Is Involved in the Regulation of Stress Response Gene Expression

Plant virus infection can activate a number of signaling pathways, including the salicylic acid (SA) pathway and jasmonic acid (JA) [7,15]. Gene chip analysis of Arabidopsis thaliana infected with Cabbage leaf curl virus (CaLCuV) found that a total of 5365 genes showed differential expression after virus infection, and data analysis showed that the virus activated the SA pathway-mediated immune response and affected the gene expression of multiple signaling pathways [30]. Glutathione S-transferases (GSTs) respond to biotic and abiotic stresses [31,32,33]. The activity of GSTs is closely related to the stress tolerance of plants [34]. GSTF14 is an endogenous gene of the GST superfamily. ACO3 is an ABA pathway-related gene, and ACD6 is a defense-related gene. Our previous studies indicate that the stress response genes ACD6, GSTF14, and ACO3 are RdDM pathway target genes, and the RdDM pathway plays an important role in maintaining the low transcription levels of these endogenous genes in Col-0 plants [29].
ROS1 reduces the methylation of immune-related genes and induces their expression to complete the defense response [23,26]. Increased expression of the upstream regulator ACD6 in plants can further induce SA accumulation and the acquisition of systemic resistance [35]. In this study, we discovered that ros1 mutants are more susceptible to BSCTV infection (Figure 1), and the accumulation of the virus in BSCTV-infected ros1 mutants was increased compared with that in BSCTV-infected Col-0 plants (Figure 1k). The findings suggest that ROS1 might play a role in the defense against viruses. Our results revealed that BSCTV C2 increased in the expression of stress response genes ACD6, GSTF14, and ACO3 and defense-related genes NPR1 and PR5 (Figure 2). Furthermore, we found the important role of ROS1 in regulating the expression of these genes in BSCTV-infected Col-0 plants (Figure 3a,b). These findings indicate that both the repressor of silencing ROS1 and the virial suppressor C2 are involved in the activation of the stress response genes and defense-related genes. An increase in the expression of stress response genes can further increase the adaptability of plants to biotic stresses.

3.2. DNA Demethylation in the Promoters of Stress Response Genes in BSCTV-Infected Plants Is Partially Dependent on ROS1

DNA methylation is an epigenetic marker involved in silencing transposable elements (TEs) in plants and animals [36,37]. The RdDM pathway is a protective mechanism that defends invasive DNA sequences and maintains the stability of the genome [9]. As a counter strategy, viruses effectively block the RdDM pathway and inhibit gene silencing by encoding viral suppressors [15]. Viral suppressor C2 interferes with DNA methylation in the promoters of endogenous genes, which is considered a passive DNA demethylation process [7]. Our previous studies also revealed that the viral suppressor HC-Pro interferes with DNA methylation in the promoters of auxin biosynthesis genes, resulting in an increase in auxin accumulation in plants [19].
The repressor of silencing ROS1 is an active DNA demethylase, which regulates DNA methylation and gene expression in plants [38,39,40]. This study found that the expression of ROS1 was activated after BSCTV infection and that ROS1 expression increased over time in A. thaliana plants (Figure 3d). Increased ROS1 expression can increase the DNA demethylation activity of ROS1. A further study revealed that DNA demethylation in the promoters of ACD6, GSTF14, and ACO3 in BSCTV-infected Col-0 plants is partially dependent on ROS1 (Figure 4a–c). These results indicate that ROS1 participates in the biotic stress response by regulating the DNA demethylation of these genes, which is an active DNA demethylation process. Our results discover that ROS1 actively in response to biotic stresses by regulating the expression of these stress response genes, thereby promoting plant adaptability to stress.

4. Materials and Methods

4.1. Plant Growth Conditions

A. thaliana ecotype Columbia (Col-0) and ros1 mutant seeds were used as plant materials for this study. The seeds were surface-sterilized with 30% bleach, washed three times with sterile water, sown on MS plates (pH 5.9), and then incubated at 25 °C with a 16 h light/8 h dark cycle, after which the plants were transferred to soil [7]. The ros1 and rdd [29] mutant seeds were obtained from the Shanghai Center for Plant Stress Biology, Shanghai Institute of Biological Sciences, Chinese Academy of Sciences (CAS).

4.2. Agrobacterium Tumefaciens Inoculation

The EHA105 strain carrying pCambia1300-BSCTV was used to infect the plants at an OD600 of 2.0, as described previously, and the inoculation experiments were performed [7]. BSCTV-infected plants that presented obvious viral symptoms were collected and used for DNA or RNA extraction and further experimental analysis. Sixty-four A. thaliana ecotype Col-0 plants or ros1 mutants were infected with BSCTV each time. The BSCTV infection experiments were repeated three times.

4.3. Bisulfite Sequencing

Total DNA was extracted at 14 days post-inoculation (dpi) from BSCTV-infected Col-0 and ros1 mutants using CTAB buffer. The collected DNA was purified using a DNA purification kit. The purified DNA was subjected to bisulfite treatment using an EpiTect bisulfite kit, as described previously [18,29]. The bisulfite-treated DNA was used to amplify from the promoter-specific sequences of ACD6 (AT4G14400) and GSTF14 (AT1G49860). The primer pairs used were as follows: ACD6-F: 5′-AAGTTTATTGATGAAAGGAG-3′; R: 5′-CTTACTT(G/A)TCTTCATCAA-3′; GSTF14-F: 5′-TTTGAAAGTTGGTGTATTAAA-3′; R: 5′-CCCATACCTATCATATTTCAT-3′; ACO3-F, 5′- GTAATATTAGTAAAGATGTGT -3′; and ACO3-R, 5′-CACTACTTTCATTATACTCTTT-3′. The results of the DNA methylation analysis were obtained from https://www.cymate.org/cymate.html (accessed on 22 December 2024). One-way ANOVA and Tukey’s multiple comparison test were used for statistical analysis, as described previously [29].

4.4. RT-qPCR Analysis

Total RNA was extracted from BSCTV-infected Col-0 and ros1 mutants using TRIzol reagent at 14 dpi. Complementary DNA synthesis was conducted using a reverse transcription kit (Takara, Borri Medical Biotechnology (Beijing) Co., Ltd., Beijing, China) for RT experiments. The DNA was subsequently used for quantitative PCR (qPCR), which was performed using SYBR Green mix (Qiagen, Shanghai BaoKe Biotechnology Co., Ltd., Shanghai, China), as described previously [19]. The ACD6 (AT4G14400) and GSTF14 (AT1G49860) probe primer pairs were used as described previously [29].

4.5. Southern Blotting Analysis and Northern Blotting Analysis

Total DNA was extracted from the BSCTV-infected Col-0 plants and ros1 mutants at 14 dpi and used for Southern blotting analysis. The DNA was separated on 1% agarose gels and then transferred to Hybond-Nþ membranes, which were hybridized with DIG-labeled probes [15,19]. For Northern blotting analysis, 10 ug of total RNA of the mutant plants was extracted by using Tizol reagent. The blotting analysis was conducted according to a previously described method [15].

5. Conclusions

In summary, an in-depth investigation and elucidation of the molecular mechanisms underlying the interaction between BSCTV and host epigenetic regulation were performed in this study. The results reveal that the transcriptional activation of stress response genes was partially dependent on ROS1 in BSCTV-infected plants. Moreover, a further study demonstrated that ROS1-mediated DNA demethylation plays a role in the regulation of stress response genes, which suggests that ROS1 is involved in the regulation of plant defense mechanisms in response to biotic stresses.

Author Contributions

Conceptualization, T.J. and L.Y.; methodology, Y.L. (Yushuo Li); software, X.S.; validation, J.Y. and Z.X.; formal analysis, W.W.; investigation, Y.L. (Yushuo Li); resources, L.Y.; data curation, Y.L. (Yidi Li); writing—original draft preparation, T.J.; writing—review and editing, L.Y.; visualization, T.J.; supervision, L.Y.; project administration, L.Y.; funding acquisition, L.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Jilin Province, grant number YDZJ202301ZYTS527.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

We choose exclude this statement because the study did not involve humans.

Data Availability Statement

Data contained within the article.

Acknowledgments

We thank Chengguo Duan, Shanghai Center for Plant Stress Biology, Shanghai Institute of Biological Sciences, and Chinese Academy of Sciences (CAS) for providing the ros1 and other mutant seeds. This work was supported by the Key Laboratory of Jilin Province for Plant Resources Science and Green Production, China.

Conflicts of Interest

We declare that we have no financial or personal relationships with other people or organizations that can inappropriately influence our work; there are no professional or other personal interests of any nature or kind in any product, service, and/or company that could be construed as influencing the position presented in, or the review of, this manuscript. We confirm that the manuscript has been read and approved by all of the named authors and that there are other people who satisfied the criteria for authorship but are not listed. We further confirm that the order of the authors listed in the manuscript has been approved by all of us.

References

  1. Baulcombe, D. RNA silencing in plants. Nature 2004, 431, 356–363. [Google Scholar] [CrossRef] [PubMed]
  2. Meister, G.; Tuschl, T. Mechanisms of gene silencing by double-stranded RNA. Nature 2004, 431, 343–349. [Google Scholar] [CrossRef] [PubMed]
  3. Voinnet, O. Post-transcriptional RNA silencing in plant-microbe interactions: A touch of robustness and versatility. Curr. Opin. Plant Biol. 2008, 11, 464–470. [Google Scholar] [CrossRef] [PubMed]
  4. Llave, C. Virus-derived small interfering RNAs at the core of plant-virus interactions. Trends Plant Sci. 2010, 15, 701–707. [Google Scholar] [CrossRef]
  5. Brodersen, P.; Sakvarelidze-Achard, L.; Bruun-Rasm Ussen, M.; Dunoyer, P.; Yamamoto, Y.Y.; Sieburth, L.; Voinnet, O. Widespread translational inhibition by plant miRNAs and siRNAs. Science 2008, 320, 1185–1190. [Google Scholar] [CrossRef]
  6. Voinnet, O. Induction and suppression of RNA silencing: Insights from viral infections. Nat. Rev. Genet. 2005, 6, 206–220. [Google Scholar] [CrossRef]
  7. Yang, L.P.; Fang, Y.Y.; An, C.P.; Dong, L.; Zhang, Z.H.; Chen, H.; Xie, Q.; Guo, H.S. C2-mediated decrease in DNA methylation, accumulation of siRNAs, and increase in expression for genes involved in defense pathways in plants infected with beet severe curly top virus. Plant J. 2013, 73, 910–917. [Google Scholar] [CrossRef]
  8. Wang, H.; Buckley, K.J.; Yang, X.J.; Buchmann, R.C.; Bisaro, D.M. Adenosine kinase inhibition and suppression of RNA silencing by geminivirus AL2 and L2 proteins. J. Virol. 2005, 79, 7410–7418. [Google Scholar] [CrossRef]
  9. Raja, P.; Sanville, B.C.; Buchmann, R.C.; Bisaro, D.M. Viral genome methylation as an epigenetic defense against geminiviruses. J. Virol. 2008, 82, 8997–9007. [Google Scholar] [CrossRef]
  10. Qi, Y.J.; Denli, A.M.; Hannon, G.J. Biochemical specialization within Arabidopsis RNA silencing pathways. Mol. Cell 2005, 19, 421–428. [Google Scholar] [CrossRef]
  11. Vanitharani, R.; Chellappan, P.; Fauquet, C.M. Geminiviruses and RNA silencing. Trends Plant Sci. 2005, 10, 144–151. [Google Scholar] [CrossRef] [PubMed]
  12. Meyer, P. DNA methylation systems and targets in plants. FEBS Lett. 2011, 585, 2008–2015. [Google Scholar] [CrossRef] [PubMed]
  13. Simon, S.A.; Meyers, B.C. Small RNA-mediated epigenetic modifications in plants. Curr. Opin. Plant Biol. 2011, 14, 148–155. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, H.M.; Zhu, J.K. RNA-directed DNA methylation. Curr. Opin. Plant Biol. 2011, 14, 142–147. [Google Scholar] [CrossRef]
  15. Yang, L.P.; Xu, Y.N.; Liu, Y.Q.; Meng, D.W.; Jin, T.C.; Zhou, X.F. HC-Pro viral suppressor from tobacco vein banding mosaic virus interferes with DNA methylation and activates the salicylic acid pathway. Virology 2016, 497, 244–250. [Google Scholar] [CrossRef]
  16. Wang, B.; Yang, X.; Wang, Y.; Xie, Y.; Zhou, X. Tomato yellow leaf curl Virus V2 interacts with host histone deacetylase6 to suppress methylation-mediated transcriptional gene silencing in plants. J. Virol. 2018, 92, 10–1128. [Google Scholar] [CrossRef]
  17. Wang, Y.; Wu, Y.; Gong, Q.; Ismayil, A.; Yuan, Y.; Lian, B.; Jia, Q.; Han, M.; Deng, H.; Hong, Y.; et al. Geminiviral V2 protein suppresses transcriptional gene silencing through interaction with AGO4. J. Virol. 2019, 93, 10–1128. [Google Scholar] [CrossRef]
  18. Zhang, Z.H.; Chen, H.; Huang, X.H.; Xia, R.; Zhao, Q.Z.; Lai, J.B.; Teng, K.L.; Li, Y.; Liang, L.M.; Du, Q.S.; et al. BSCTV C2 Attenuates the Degradation of SAMDC1 to Suppress DNA Methylation-Mediated Gene Silencing in Arabidopsis. Plant Cell 2011, 23, 273–288. [Google Scholar] [CrossRef]
  19. Yang, L.P.; Meng, D.W.; Wang, Y.; Wu, Y.J.; Lang, C.J.; Jin, T.C.; Zhou, X.F. The viral suppressor HCPro decreases DNA methylation and activates auxin biosynthesis genes. Virology 2020, 546, 133–140. [Google Scholar] [CrossRef]
  20. Gehring, M.; Jin, H.H.; Hsieh, T.F.; Penterman, J.; Choi, Y.; Harada, J.J.; Goldberg, R.B.; Fischer, R.L. DEMETER DNA glycosylase establishes MEDEA polycomb gene self-imprinting by allele-specific demethylation. Cell 2006, 124, 495–506. [Google Scholar] [CrossRef]
  21. Ortega-Galisteo, A.P.; Morales-Ruiz, T.; Ariza, R.R.; Roldán-Arjona, T. Arabidopsis Demeter-Like proteins DML2 and DML3 are required for appropriate distribution of DNA methylation marks. Plant Mol. Biol. 2008, 67, 671–681. [Google Scholar] [CrossRef] [PubMed]
  22. Ponferrada-Marin, M.I.; Roldan-Arjona, T.; Ariza, R.R. Demethylationinitiated by ROS1 glycosylase involves random sliding along DNA. Nucleic. Acids Res. 2012, 40, 11554–11562. [Google Scholar] [CrossRef] [PubMed]
  23. Schumann, U.; Lee, J.; Kazan, K.; Ayliffe, M.; Wang, M.B. DNA-demethylase regulated genes show methylation-independent spatiotemporal expression patterns. Front. Plant Sci. 2017, 8, 1449. [Google Scholar] [CrossRef] [PubMed]
  24. Le, T.N.; Schumann, U.; Smith, N.A.; Tiwari, S.; Au, P.; Zhu, Q.H.; Taylor, J.; Kazan, K.; Llewellyn, D.J.; Zhang, R. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis. Genome Biol. 2014, 15, 458. [Google Scholar] [CrossRef]
  25. Dowen, R.H.; Pelizzola, M.; Schmitz, R.J.; Lister, R.; Ecker, J.R. Widespread dynamicDNA methylation in response to biotic stress. Proc. Natl. Acad. Sci. USA 2012, 109, 2183–2191. [Google Scholar] [CrossRef]
  26. Yu, A.; Lepere, G.; Jay, F.; Wang, J.; Bapaume, L.; Wang, Y.; Abraham, A.L.; Penterman, J.; Fischer, R.L.; Voinnet, O.; et al. Dynamics and biological relevance of DNA demethylation in Arabidopsis antibacterial defense. Proc. Natl. Acad. Sci. USA 2013, 110, 2389–2394. [Google Scholar] [CrossRef]
  27. Liu, R.; Lang, Z. The mechanism and function of active DNA demethylation in plants. J. Integr. Plant Biol. 2019, 62, 148–159. [Google Scholar] [CrossRef]
  28. Kim, J.S.; Lim, J.Y.; Shin, H.; Kim, B.G.; Yoo, S.D.; Kim, W.T.; Huh, J.H. ROS1-dependent DNA demethylation is required for ABA-inducible NIC3 expression. Plant Physiol. 2019, 179, 1810–1821. [Google Scholar] [CrossRef]
  29. Yang, L.P.; Lang, C.J.; Wu, Y.J.; Meng, D.W.; Yang, T.B.; Li, D.Q.; Jin, T.C.; Zhou, X.F. ROS1-mediated decrease in DNA methylation and increase in expression of defense genes and stress response genes in Arabidopsis thaliana due to abiotic stresses. BMC Plant Biol. 2022, 22, 104. [Google Scholar] [CrossRef]
  30. Ascencio-Ibáñez, J.T.; Sozzani, R.; Lee, T.J.; Chu, T.M.; Wolfinger, R.D.; Cella, R.; Hanley-Bowdoin, L. Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. Plant Physiol. 2008, 148, 436–454. [Google Scholar] [CrossRef]
  31. Marrs, K.A. The functions and regulation of glutathione stransferases in plants, Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996, 47, 127–158. [Google Scholar] [CrossRef] [PubMed]
  32. Dixon, D.P.; Davis, B.G.; Edwardset, R. Functional divergence in the glutathione transferase superfamily in plants. J. Biol. Chem. 2002, 277, 30859–30869. [Google Scholar] [CrossRef] [PubMed]
  33. Jain, M.; Ghanashyam, C.; Bhattacharjee, A. Comprehensive expression analysis suggests overlapping and specific roles of rice glutathione S-transferase genes during development and stress responses. BMC Genom. 2010, 11, 73. [Google Scholar] [CrossRef]
  34. Nianiou-Obeidat, I.; Madesis, P.; Kissoudis, C.; Voulgari, G.; Chronopoulou, E.; Tsaftaris, A.; Labrou, N.E. Plant glutathione transferase-mediated stress tolerance: Functions and biotechnological applications. Plant Cell Rep. 2017, 36, 791–805. [Google Scholar] [CrossRef]
  35. Chen, H.; Zhang, Z.; Teng, K.; Lai, J.; Zhang, Y.; Huang, Y.; Li, Y.; Liang, L.; Wang, Y.; Chu, C.; et al. Up-regulation of LSB1/GDU3 affects geminivirus infection by activating the salicylic acid pathway. Plant J. 2010, 62, 12–23. [Google Scholar] [CrossRef]
  36. Zhang, H.; Lang, Z.; Zhu, J.K. Dynamics and function of DNA methylation in plants. Nat. Rev. Mol. Cell Biol. 2018, 19, 489–506. [Google Scholar] [CrossRef]
  37. Deniz, Ö.; Frost, M.F.; Branco, M.R. Regulation of transposable elements by DNA modifications. Nat. Rev. Genet. 2019, 20, 417–431. [Google Scholar] [CrossRef]
  38. Gong, Z.Z.; Morales-Ruiz, T.; Ariza, R.R.; Roldán-Arjona, T.; David, L.; Zhu, J.K. ROS1, a repressor of transcriptional gene silencing in Arabidopsis, encodes a DNA glycosylase/lyase. Cell 2002, 111, 803–814. [Google Scholar] [CrossRef]
  39. Agius, F.; Kapoor, A.; Zhu, J.K. Role of the “Arabidopsis” DNA glycosylase/lyase ROS1 in active DNA demethylation. Proc. Natl. Acad. Sci. USA 2006, 103, 11796–11801. [Google Scholar] [CrossRef]
  40. Duan, C.G.; Wang, X.G.; Xie, S.J.; Li, P.; Miki, D.; Tang, K.; Hsu, C.C.; Lei, M.; Zhong, Y.; Hou, Y.J.; et al. A pair of transposon-derived proteins function in a histone acetyltransferase complex for active DNA demethylation. Cell Res. 2017, 27, 226–240. [Google Scholar] [CrossRef]
Ijms 26 02807 g001
Figure 1. BSCTV symptoms in Arabidopsis Col-0 plants and ros1 mutants. (a) Arabidopsis thaliana Col-0 plants were used as controls. (b) Arabidopsis thaliana ros1 mutants presented no obvious changes. (c) The leaves of BSCTV-infected Col-0 exhibited deformation at 7 dpi. (d) The leaves of BSCTV-infected ros1 mutants presented more severe deformation than BSCTV-infected Col-0 at 7 dpi. (e) Mock-infected ros1 mutants presented no obvious changes. (h) Mock-infected Col-0 plants were used as controls. (f,i) BSCTV-infected Col-0 presented curled-top symptoms at 14 dpi. (g,j) ros1 mutants presented more severe curved-top symptoms than BSCTV-infected Col-0 at 14 dpi. (k) The accumulation of BSCTV in virus-infected Col-0 and ros1 plants was determined by Southern blotting at 14 dpi, and the accumulation of virus in mock-infected plants served as a control.
Figure 1. BSCTV symptoms in Arabidopsis Col-0 plants and ros1 mutants. (a) Arabidopsis thaliana Col-0 plants were used as controls. (b) Arabidopsis thaliana ros1 mutants presented no obvious changes. (c) The leaves of BSCTV-infected Col-0 exhibited deformation at 7 dpi. (d) The leaves of BSCTV-infected ros1 mutants presented more severe deformation than BSCTV-infected Col-0 at 7 dpi. (e) Mock-infected ros1 mutants presented no obvious changes. (h) Mock-infected Col-0 plants were used as controls. (f,i) BSCTV-infected Col-0 presented curled-top symptoms at 14 dpi. (g,j) ros1 mutants presented more severe curved-top symptoms than BSCTV-infected Col-0 at 14 dpi. (k) The accumulation of BSCTV in virus-infected Col-0 and ros1 plants was determined by Southern blotting at 14 dpi, and the accumulation of virus in mock-infected plants served as a control.
Ijms 26 02807 g001
Ijms 26 02807 g002
Figure 2. Analysis of gene expression levels in BSCTV-infected plants and C2 transgenic plants. (a,b) RT-qPCR analysis of the expression levels of the stress response genes ACD6, GSTF14, and ACO3 and the defense-related genes NPR1 and PR5 in BSCTV-infected Col-0. (c,d) RT-qPCR analysis of the expression levels of the stress response genes and the defense-related genes in C2 transgenic plants. Means identified by different letters are significantly different from each other. Error bars represent SEs from three biological replicates. One-way ANOVA followed by Tukey’s multiple comparison test was used for statistical analysis (p < 0.05).
Figure 2. Analysis of gene expression levels in BSCTV-infected plants and C2 transgenic plants. (a,b) RT-qPCR analysis of the expression levels of the stress response genes ACD6, GSTF14, and ACO3 and the defense-related genes NPR1 and PR5 in BSCTV-infected Col-0. (c,d) RT-qPCR analysis of the expression levels of the stress response genes and the defense-related genes in C2 transgenic plants. Means identified by different letters are significantly different from each other. Error bars represent SEs from three biological replicates. One-way ANOVA followed by Tukey’s multiple comparison test was used for statistical analysis (p < 0.05).
Ijms 26 02807 g002
Ijms 26 02807 g003
Figure 3. Analysis of gene expression levels in Col-0 and ros1 plants infected with BSCTV. (a) Expression in mock-infected plants was used as a control, and RT-qPCR analysis of the expression levels of stress response genes in BSCTV-infected Col-0, ros1, and rdd mutants was performed. (b) RT-qPCR analysis of the expression levels of the defense-related genes in BSCTV-infected Col-0, ros1, and rdd plants. (c) Northern blotting analyses of the expression levels in the mutants ago4, met1, dcl3, ddm1, and cmt3. (d) RT-qPCR analysis of the expression levels of ROS1 in BSCTV-infected Col-0; GAPDH served as a reference gene. Means identified by different letters are significantly different from each other. The error bars represent the SEs from three biological replicates. One-way ANOVA followed by Tukey’s multiple comparison test was used for statistical analysis (p < 5).
Figure 3. Analysis of gene expression levels in Col-0 and ros1 plants infected with BSCTV. (a) Expression in mock-infected plants was used as a control, and RT-qPCR analysis of the expression levels of stress response genes in BSCTV-infected Col-0, ros1, and rdd mutants was performed. (b) RT-qPCR analysis of the expression levels of the defense-related genes in BSCTV-infected Col-0, ros1, and rdd plants. (c) Northern blotting analyses of the expression levels in the mutants ago4, met1, dcl3, ddm1, and cmt3. (d) RT-qPCR analysis of the expression levels of ROS1 in BSCTV-infected Col-0; GAPDH served as a reference gene. Means identified by different letters are significantly different from each other. The error bars represent the SEs from three biological replicates. One-way ANOVA followed by Tukey’s multiple comparison test was used for statistical analysis (p < 5).
Ijms 26 02807 g003
Ijms 26 02807 g004
Figure 4. DNA methylation analysis of promoters and analysis of gene expression in the mutants. (a–c) DNA methylation analysis at CG, CNG, and CHH sites in the promoters of ACD6, GSTF14, and ACO3. The methylation levels in the mock-infected plants were used as controls. ros1-BSCTV represents the methylation levels in the BSCTV-infected ros1 mutants. Means identified by different letters are significantly different from each other. The error bars represent the SEs from three biological replicates. One-way ANOVA followed by Tukey’s multiple comparison test was used for statistical analysis (p < 5).
Figure 4. DNA methylation analysis of promoters and analysis of gene expression in the mutants. (a–c) DNA methylation analysis at CG, CNG, and CHH sites in the promoters of ACD6, GSTF14, and ACO3. The methylation levels in the mock-infected plants were used as controls. ros1-BSCTV represents the methylation levels in the BSCTV-infected ros1 mutants. Means identified by different letters are significantly different from each other. The error bars represent the SEs from three biological replicates. One-way ANOVA followed by Tukey’s multiple comparison test was used for statistical analysis (p < 5).
Ijms 26 02807 g004
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jin, T.; Li, Y.; Sun, X.; Li, Y.; Xiao, Z.; Wang, W.; Yu, J.; Yang, L. DNA Demethylase ROS1 Interferes with DNA Methylation and Activates Stress Response Genes in Plants Infected with Beet Severe Curly Top Virus. Int. J. Mol. Sci. 2025, 26, 2807. https://doi.org/10.3390/ijms26062807

AMA Style

Jin T, Li Y, Sun X, Li Y, Xiao Z, Wang W, Yu J, Yang L. DNA Demethylase ROS1 Interferes with DNA Methylation and Activates Stress Response Genes in Plants Infected with Beet Severe Curly Top Virus. International Journal of Molecular Sciences. 2025; 26(6):2807. https://doi.org/10.3390/ijms26062807

Chicago/Turabian Style

Jin, Taicheng, Yushuo Li, Xu Sun, Yidi Li, Zhuyi Xiao, Weiyan Wang, Jiaxue Yu, and Liping Yang. 2025. "DNA Demethylase ROS1 Interferes with DNA Methylation and Activates Stress Response Genes in Plants Infected with Beet Severe Curly Top Virus" International Journal of Molecular Sciences 26, no. 6: 2807. https://doi.org/10.3390/ijms26062807

APA Style

Jin, T., Li, Y., Sun, X., Li, Y., Xiao, Z., Wang, W., Yu, J., & Yang, L. (2025). DNA Demethylase ROS1 Interferes with DNA Methylation and Activates Stress Response Genes in Plants Infected with Beet Severe Curly Top Virus. International Journal of Molecular Sciences, 26(6), 2807. https://doi.org/10.3390/ijms26062807

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop