Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids
Abstract
1. Introduction
2. Results and Discussion
2.1. Immunofluorescent Staining and Polymerase Chain Reaction (PCR) Confirm the Presence of Piezo1 in eMSC Spheroids
2.2. Selective Chemical Piezo1 Activation Induces Ca2+ Entry in eMSC Spheroids
2.3. Role of Piezo1 Activity in Formation of eMSC Spheroids
2.4. Piezo1 Activation Decrease the Rate of eMSCs Spheroid Spreading
2.5. Piezo1 Activation Eliminates the Differences in eMSC Spreading Rates on Plastic and Glass Surfaces
3. Materials and Methods
3.1. Cells and Reagents
3.2. Spheroid Formation and Viability Assay
3.3. RNA Extraction and cDNA Synthesis
3.4. Reverse Transcription (RT) and Quantitative Polymerase Chain Reaction (qPCR)
3.5. Immunofluorescence
3.6. Ca2+ Measurements
3.7. Spheroid Spreading Assay
3.8. Statistics
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pampaloni, F.; Reynaud, E.G.; Stelzer, E.H. The third dimension bridges the gap between cell culture and live tissue. Nat. Rev. Mol. Cell Biol. 2007, 8, 839–845. [Google Scholar] [CrossRef] [PubMed]
- Cesarz, Z.; Tamama, K. Spheroid Culture of Mesenchymal Stem Cells. Stem Cells Int. 2016, 2016, 9176357. [Google Scholar] [CrossRef] [PubMed]
- Domnina, A.; Ivanova, J.; Alekseenko, L.; Kozhukharova, I.; Borodkina, A.; Pugovkina, N.; Smirnova, I.; Lyublinskaya, O.; Fridlyanskaya, I.; Nikolsky, N. Three-Dimensional Compaction Switches Stress Response Programs and Enhances Therapeutic Efficacy of Endometrial Mesenchymal Stem/Stromal Cells. Front. Cell Dev. Biol. 2020, 8, 473. [Google Scholar] [CrossRef] [PubMed]
- Han, H.-W.; Asano, S.; Hsu, S.-H. Cellular Spheroids of Mesenchymal Stem Cells and Their Perspectives in Future Healthcare. Appl. Sci. 2019, 9, 627. [Google Scholar] [CrossRef]
- Cooper, D.; Dimri, M. Biochemistry, Calcium Channels. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2025. Available online: https://www.ncbi.nlm.nih.gov/books/NBK562198/ (accessed on 15 January 2025).
- Ma, N.; Huang, L.; Zhou, Q.; Zhang, X.; Luo, Q.; Song, G. Mechanical stretch promotes the migration of mesenchymal stem cells via Piezo1/F-actin/YAP axis. Exp. Cell Res. 2025, 446, 114461. [Google Scholar] [CrossRef]
- Pathak, M.M.; Nourse, J.L.; Tran, T.; Hwe, J.; Arulmoli, J.; Le, D.T.T.; Bernardis, E.; Flanagan, L.A.; Tombola, F. Stretch-activated ion channel Piezo1 directs lineage choice in human neural stem cells. Proc. Natl. Acad. Sci. USA 2014, 111, 16148–16153. [Google Scholar] [CrossRef]
- Hu, R.; Yang, Z.Y.; Li, Y.H.; Zhou, Z. LIPUS Promotes Endothelial Differentiation and Angiogenesis of Periodontal Ligament Stem Cells by Activating Piezo1. Int. J. Stem Cells 2022, 15, 372–383. [Google Scholar] [CrossRef]
- Huang, Z.; Huang, Y.; Ning, X.; Li, H.; Li, Q.; Wu, J. The functional effects of Piezo channels in mesenchymal stem cells. Stem Cell Res. Ther. 2023, 14, 222. [Google Scholar] [CrossRef]
- Mousawi, F.; Peng, H.; Li, J.; Ponnambalam, S.; Roger, S.; Zhao, H.; Yang, X.; Jiang, L.H. Chemical activation of the Piezo1 channel drives mesenchymal stem cell migration via inducing ATP release and activation of P2 receptor purinergic signaling. Stem Cells 2020, 38, 410–421. [Google Scholar] [CrossRef]
- Sugimoto, A.; Miyazaki, A.; Kawarabayashi, K.; Shono, M.; Akazawa, Y.; Hasegawa, T.; Ueda-Yamaguchi, K.; Kitamura, T.; Yoshizaki, K.; Fukumoto, S.; et al. Piezo type mechanosensitive ion channel component 1 functions as a regulator of the cell fate determination of mesenchymal stem cells. Sci. Rep. 2017, 7, 17696. [Google Scholar] [CrossRef]
- Huang, X.; Chen, D.; Liang, C.; Shi, K.; Zhou, X.; Zhang, Y.; Li, Y.; Chen, J.; Xia, K.; Shu, J.; et al. Swelling-Mediated Mechanical Stimulation Regulates Differentiation of Adipose-Derived Mesenchymal Stem Cells for Intervertebral Disc Repair Using Injectable UCST Microgels. Adv. Healthc. Mater. 2023, 12, e2201925. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Chennupati, R.; Kaur, H.; Iring, A.; Wettschureck, N.; Offermanns, S. Endothelial cation channel PIEZO1 controls blood pressure by mediating flow-induced ATP release. J. Clin. Investig. 2016, 126, 4527–4536. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Liu, J.; Xu, Z.; Lin, X.; Zhang, X.; Li, L.; Li, Y. Matrix stiffness regulates myocardial differentiation of human umbilical cord mesenchymal stem cells. Aging 2020, 13, 2231–2250. [Google Scholar] [CrossRef] [PubMed]
- Białkowska, K.; Komorowski, P.; Bryszewska, M.; Miłowska, K. Spheroids as a Type of Three-Dimensional Cell Cultures-Examples of Methods of Preparation and the Most Important Application. Int. J. Mol. Sci. 2020, 21, 6225. [Google Scholar] [CrossRef]
- Syeda, R.; Xu, J.; Dubin, A.E.; Coste, B.; Mathur, J.; Huynh, T.; Matzen, J.; Lao, J.; Tully, D.C.; Engels, I.H.; et al. Chemical activation of the mechanotransduction channel Piezo1. eLife 2015, 4, e07369. [Google Scholar] [CrossRef]
- Chubinskiy-Nadezhdin, V.; Semenova, S.; Vasileva, V.; Shatrova, A.; Pugovkina, N.; Negulyaev, Y. Store-Operated Ca2+ Entry Contributes to Piezo1-Induced Ca2+ Increase in Human Endometrial Stem Cells. Int. J. Mol. Sci. 2022, 23, 3763. [Google Scholar] [CrossRef]
- Zemelko, V.I.; Grinchuk, T.M.; Domnina, A.P.; Artzibasheva, I.V.; Zenin, V.V.; Kirsanov, A.A.; Bichevaia, N.K.; Korsak, V.S.; Nikolsky, N.N. Multipotent mesenchymal stem cells of desquamated endometrium: Isolation, characterization, and application as a feeder layer for maintenance of human embryonic stem cells. Cell Tiss. Biol. 2012, 6, 1–11. [Google Scholar] [CrossRef]
- Chubinskiy-Nadezhdin, V.I.; Sudarikova, A.V.; Shorokhova, M.A.; Vasileva, V.Y.; Khairullina, Z.M.; Negulyaev, Y.A. Single ion channel recording in 3D culture of stem cells using patch-clamp technique. Biochem. Biophys. Res. Commun. 2022, 619, 22–26. [Google Scholar] [CrossRef]
- Lin, R.Z.; Chou, L.F.; Chien, C.C.; Chang, H.Y. Dynamic analysis of hepatoma spheroid formation: Roles of E-cadherin and beta1-integrin. Cell Tissue Res. 2006, 324, 411–422. [Google Scholar] [CrossRef]
- Lin, R.Z.; Chang, H.Y. Recent advances in three-dimensional multicellular spheroid culture for biomedical research. Biotechnol. J. 2008, 3, 1172–1184. [Google Scholar] [CrossRef]
- Wang, J.; Jiang, J.; Yang, X.; Zhou, G.; Wang, L.; Xiao, B. Tethering Piezo channels to the actin cytoskeleton for mechanogating via the cadherin-β-catenin mechanotransduction complex. Cell Rep. 2022, 38, 110342. [Google Scholar] [CrossRef] [PubMed]
- Lei, M.; Wang, W.; Zhang, H.; Gong, J.; Wang, Z.; Cai, H.; Yang, X.; Wang, S.; Ma, C. Cell-cell and cell-matrix adhesion regulated by Piezo1 is critical for stiffness-dependent DRG neuron aggregation. Cell Rep. 2023, 42, 113522. [Google Scholar] [CrossRef] [PubMed]
- Cheng, D.; Wang, J.; Yao, M.; Cox, C.D. Joining forces: Crosstalk between mechanosensitive PIEZO1 ion channels and integrin-mediated focal adhesions. Biochem. Soc. Trans. 2023, 51, 1897–1906. [Google Scholar] [CrossRef]
- Vasileva, V.Y.; Khairullina, Z.M.; Chubinskiy-Nadezhdin, V.I. Piezo1 Activation Prevents Spheroid Formation by Malignant Melanoma SK-MEL-2 Cells. Int. J. Mol. Sci. 2023, 24, 15703. [Google Scholar] [CrossRef] [PubMed]
- Bae, C.; Sachs, F.; Gottlieb, P.A. The mechanosensitive ion channel Piezo1 is inhibited by the peptide GsMTx4. Biochemistry 2011, 50, 6295–6300. [Google Scholar] [CrossRef]
- Kinsella, J.A.; Debant, M.; Parsonage, G.; Morley, L.C.; Bajarwan, M.; Revill, C.; Foster, R.; Beech, D.J. Pharmacology of PIEZO1 channels. Br. J. Pharmacol. 2024, 181, 4714–4732. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, J.; Zhang, J.; Wang, Y.; Wang, Y.; Kang, H.; Zhao, W.; Bai, W.; Miao, N.; Wang, J. Stiffness sensing via Piezo1 enhances macrophage efferocytosis and promotes the resolution of liver fibrosis. Sci. Adv. 2024, 10, eadj3289. [Google Scholar] [CrossRef]
- Atcha, H.; Jairaman, A.; Holt, J.R.; Meli, V.S.; Nagalla, R.R.; Veerasubramanian, P.K.; Brumm, K.T.; Lim, H.E.; Othy, S.; Cahalan, M.D.; et al. Mechanically activated ion channel Piezo1 modulates macrophage polarization and stiffness sensing. Nat. Commun. 2021, 12, 3256. [Google Scholar] [CrossRef]
- Tilghman, R.W.; Cowan, C.R.; Mih, J.D.; Koryakina, Y.; Gioeli, D.; Slack-Davis, J.K.; Blackman, B.R.; Tschumperlin, D.J.; Parsons, J.T. Matrix rigidity regulates cancer cell growth and cellular phenotype. PLoS ONE 2010, 5, e12905. [Google Scholar] [CrossRef]
- Li, J.; Han, D.; Zhao, Y.P. Kinetic behaviour of the cells touching substrate: The interfacial stiffness guides cell spreading. Sci. Rep. 2014, 4, 3910. [Google Scholar] [CrossRef]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.J.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [PubMed]
- Domnina, A.; Alekseenko, L.; Kozhukharova, I.; Lyublinskaya, O.; Shorokhova, M.; Zenin, V.; Fridlyanskaya, I.; Nikolsky, N. Generation of Therapeutically Potent Spheroids from Human Endometrial Mesenchymal Stem/Stromal Cells. J. Pers. Med. 2021, 11, 466. [Google Scholar] [CrossRef] [PubMed]
- Vasileva, V.Y.; Khairullina, Z.M.; Sudarikova, A.V.; Chubinskiy-Nadezhdin, V.I. Role of Calcium-Activated Potassium Channels in Proliferation, Migration and Invasion of Human Chronic Myeloid Leukemia K562 Cells. Membranes 2023, 13, 583. [Google Scholar] [CrossRef] [PubMed]
- Rauh, J.; Jacobi, A.; Stiehler, M. Identification of stable reference genes for gene expression analysis of three-dimensional cultivated human bone marrow-derived mesenchymal stromal cells for bone tissue engineering. Tissue Eng. Part C Methods 2015, 21, 192–206. [Google Scholar] [CrossRef]
Gene | Primer Sequence |
---|---|
Piezo1 | forward: ACTTTCCCATCAGCACTCGG; reverse: CCAAGCAGTCCTTGAGACCC |
HPRT1 | forward: TGACACTGGCAAAACAATGCA; reverse: GGTCCTTTTCACCAGCAAGCT |
TBP | forward: CACGAACCACGGCACTGATT; reverse: TTTTCTTGCTGCCAGTCTGGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khairullina, Z.M.; Vasileva, V.Y.; Chubinskiy-Nadezhdin, V.I. Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids. Int. J. Mol. Sci. 2025, 26, 2474. https://doi.org/10.3390/ijms26062474
Khairullina ZM, Vasileva VY, Chubinskiy-Nadezhdin VI. Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids. International Journal of Molecular Sciences. 2025; 26(6):2474. https://doi.org/10.3390/ijms26062474
Chicago/Turabian StyleKhairullina, Zuleikha M., Valeria Y. Vasileva, and Vladislav I. Chubinskiy-Nadezhdin. 2025. "Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids" International Journal of Molecular Sciences 26, no. 6: 2474. https://doi.org/10.3390/ijms26062474
APA StyleKhairullina, Z. M., Vasileva, V. Y., & Chubinskiy-Nadezhdin, V. I. (2025). Piezo1 Ion Channels Regulate the Formation and Spreading of Human Endometrial Mesenchymal Stem Cell Spheroids. International Journal of Molecular Sciences, 26(6), 2474. https://doi.org/10.3390/ijms26062474