Interplay Between TGFβ1 Signaling and Cancer-Testis Antigen MAGEB2: A New Thorn in Cancer’s Side?
Abstract
1. Introduction
2. Results
2.1. MAGEB2 Is a True Cancer-Testis Antigen
2.2. DNA Methylation Regulates Expression of MAGEB2
2.3. JunD Is the Transcription Factor That Regulates the Expression of MAGEB2
2.4. MAGEB2 Is Both Necessary and Sufficient for Cellular Proliferation
2.5. MAGEB2 Expression Leads to the Suppression of TGFβ1 Signaling
2.6. MAGEB2 Expression Results in Decreased Levels of Secreted TGFβ1 and TSP-1
2.7. Restoring TGFβ1 Levels Results in the Reversal of MAGEB2-Driven Anchorage-Independent Growth
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Culture
4.2. Antibodies
4.3. Bioinformatics
4.3.1. UCSC Xena Platform for MAGEB2 Expression Profile
4.3.2. UCSC Genome Browser for Methylome Profile
4.3.3. Transcription Factor Analysis
4.4. Azacytidine Assay
4.5. RT-qPCR
4.6. Chromatin Immuno-Precipitation
4.7. Transient Expression of MAGEB2 in HEK Cells
4.8. Lentiviral (Stable) Expression of MAGE Proteins in HEK Cells
4.9. Phenotypic Assays
4.9.1. Population Doubling
4.9.2. Anchorage-Independent Growth
4.10. RT-qPCR Array
4.11. ELISA Measurement of TSP-1, TGFβ1, and EREG
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Simpson, A.J.; Caballero, O.L.; Jungbluth, A.; Chen, Y.T.; Old, L.J. Cancer/testis antigens, gametogenesis and cancer. Nat. Rev. Cancer 2005, 5, 615–625. [Google Scholar] [CrossRef] [PubMed]
 - Chomez, P.; De Backer, O.; Bertrand, M.; De Plaen, E.; Boon, T.; Lucas, S. An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res. 2001, 61, 5544–5551. [Google Scholar]
 - Lee, A.K.; Potts, P.R.A. Comprehensive Guide to the MAGE Family of Ubiquitin Ligases. J. Mol. Biol. 2017, 429, 1114–1142. [Google Scholar] [CrossRef] [PubMed]
 - Fon Tacer, K.; Montoya, M.C.; Oatley, M.J.; Lord, T.; Oatley, J.M.; Klein, J.; Ravichandran, R.; Tillman, H.; Kim, M.; Connelly, J.P.; et al. MAGE cancer-testis antigens protect the mammalian germline under environmental stress. Sci. Adv. 2019, 5, eaav4832. [Google Scholar] [CrossRef] [PubMed]
 - Doyle, J.M.; Gao, J.; Wang, J.; Yang, M.; Potts, P.R. MAGE-RING protein complexes comprise a family of E3 ubiquitin ligases. Mol. Cell 2010, 39, 963–974. [Google Scholar] [CrossRef]
 - Colemon, A.; Harris, T.M.; Ramanathan, S. DNA hypomethylation drives changes in MAGE-A gene expression resulting in alteration of proliferative status of cells. Genes Environ. 2020, 42, 24. [Google Scholar] [CrossRef]
 - Pineda, C.T.; Ramanathan, S.; Fon Tacer, K.; Weon, J.L.; Potts, M.B.; Ou, Y.H.; White, M.A.; Potts, P.R. Degradation of AMPK by a cancer-specific ubiquitin ligase. Cell 2015, 160, 715–728. [Google Scholar] [CrossRef]
 - Yang, S.W.; Li, L.; Connelly, J.P.; Porter, S.N.; Kodali, K.; Gan, H.; Park, J.M.; Tacer, K.F.; Tillman, H.; Peng, J.; et al. A Cancer-Specific Ubiquitin Ligase Drives mRNA Alternative Polyadenylation by Ubiquitinating the mRNA 3’ End Processing Complex. Mol. Cell 2020, 77, 1206–1221. [Google Scholar] [CrossRef]
 - Tyagi, P.; Mirakhur, B. MAGRIT: The largest-ever phase III lung cancer trial aims to establish a novel tumor-specific approach to therapy. Clin. Lung. Cancer 2009, 10, 371–374. [Google Scholar] [CrossRef]
 - Vansteenkiste, J.F.; Cho, B.C.; Vanakesa, T.; De Pas, T.; Zielinski, M.; Kim, M.S.; Jassem, J.; Yoshimura, M.; Dahabreh, J.; Nakayama, H.; et al. Efficacy of the MAGE-A3 cancer immunotherapeutic as adjuvant therapy in patients with resected MAGE-A3-positive non-small-cell lung cancer (MAGRIT): A randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Oncol. 2016, 17, 822–835. [Google Scholar] [CrossRef]
 - Shukla, S.A.; Bachireddy, P.; Schilling, B.; Galonska, C.; Zhan, Q.; Bango, C.; Langer, R.; Lee, P.C.; Gusenleitner, D.; Keskin, D.B.; et al. Cancer-Germline Antigen Expression Discriminates Clinical Outcome to CTLA-4 Blockade. Cell 2018, 173, 624–633.e8. [Google Scholar] [CrossRef]
 - Sharma, S.; Kelly, T.K.; Jones, P.A. Epigenetics in cancer. Carcinogenesis 2010, 31, 27–36. [Google Scholar] [CrossRef]
 - Yu, X.; Zhao, H.; Wang, R.; Chen, Y.; Ouyang, X.; Li, W.; Sun, Y.; Peng, A. Cancer epigenetics: From laboratory studies and clinical trials to precision medicine. Cell. Death. Discov. 2024, 10, 28. [Google Scholar] [CrossRef]
 - Wang, D.; Zhang, Y.; Li, Q.; Li, Y.; Li, W.; Zhang, A.; Xu, J.; Meng, J.; Tang, L.; Lyu, S. Epigenetics: Mechanisms, potential roles, and therapeutic strategies in cancer progression. Genes Dis. 2024, 11, 101020. [Google Scholar] [CrossRef] [PubMed]
 - Mecca, M.; Picerno, S.; Cortellino, S. The Killer’s Web: Interconnection between Inflammation, Epigenetics and Nutrition in Cancer. Int. J. Mol. Sci. 2024, 25, 2750. [Google Scholar] [CrossRef] [PubMed]
 - Azad, N.; Zahnow, C.A.; Rudin, C.M.; Baylin, S.B. The future of epigenetic therapy in solid tumours—Lessons from the past. Nat. Rev. Clin. Oncol. 2013, 10, 256–266. [Google Scholar] [CrossRef]
 - Yoo, C.B.; Jones, P.A. Epigenetic therapy of cancer: Past, present and future. Nat. Rev. Drug Discov. 2006, 5, 37–50. [Google Scholar] [CrossRef] [PubMed]
 - Cortiana, V.; Abbas, R.H.; Chorya, H.; Gambill, J.; Mahendru, D.; Park, C.H.; Leyfman, Y. Personalized Medicine in Pancreatic Cancer: The Promise of Biomarkers and Molecular Targeting with Dr. Michael, J. Pishvaian. Cancers 2024, 16, 2329. [Google Scholar] [CrossRef]
 - De Mattos-Arruda, L.; Rodon, J. Pilot studies for personalized cancer medicine: Focusing on the patient for treatment selection. Oncologist 2013, 18, 1180–1188. [Google Scholar] [CrossRef]
 - De Palma, M.; Hanahan, D. The biology of personalized cancer medicine: Facing individual complexities underlying hallmark capabilities. Mol. Oncol. 2012, 6, 111–127. [Google Scholar] [CrossRef]
 - Dey, A.; Mitra, A.; Pathak, S.; Prasad, S.; Zhang, A.S.; Zhang, H.; Sun, X.F.; Banerjee, A. Recent Advancements, Limitations, and Future Perspectives of the use of Personalized Medicine in Treatment of Colon Cancer. Technol. Cancer Res. Treat. 2023, 22, 15330338231178403. [Google Scholar] [CrossRef] [PubMed]
 - Lee, A.K.; Klein, J.; Fon Tacer, K.; Lord, T.; Oatley, M.J.; Oatley, J.M.; Porter, S.N.; Pruett-Miller, S.M.; Tikhonova, E.B.; Karamyshev, A.L.; et al. Translational Repression of G3BP in Cancer and Germ Cells Suppresses Stress Granules and Enhances Stress Tolerance. Mol. Cell 2020, 79, 645–659. [Google Scholar] [CrossRef]
 - Peche, L.Y.; Ladelfa, M.F.; Toledo, M.F.; Mano, M.; Laiseca, J.E.; Schneider, C.; Monte, M. Human MageB2 Protein Expression Enhances E2F Transcriptional Activity, Cell Proliferation, and Resistance to Ribotoxic Stress. J. Biol. Chem. 2015, 290, 29652–29662. [Google Scholar] [CrossRef]
 - Goldman, M.; Craft, B.; Kamath, A.; Brooks, A.N.; Zhu, J.; Haussler, D. The UCSC Xena Platform for cancer genomics data visualization and interpretation. bioRxiv 2018. [Google Scholar] [CrossRef]
 - Loriot, A.; De Plaen, E.; Boon, T.; De Smet, C. Transient down-regulation of DNMT1 methyltransferase leads to activation and stable hypomethylation of MAGE-A1 in melanoma cells. J. Biol. Chem. 2006, 281, 10118–10126. [Google Scholar] [CrossRef] [PubMed]
 - Kutilin, D.S. Regulation of Gene Expression of Cancer/Testis Antigens in Colorectal Cancer Patients. Mol. Biol. 2020, 54, 580–595. [Google Scholar] [CrossRef]
 - Akalin, A.; Garrett-Bakelman, F.E.; Kormaksson, M.; Busuttil, J.; Zhang, L.; Khrebtukova, I.; Milne, T.A.; Huang, Y.; Biswas, D.; Hess, J.L.; et al. Base-pair resolution DNA methylation sequencing reveals profoundly divergent epigenetic landscapes in acute myeloid leukemia. PLoS Genet. 2012, 8, e1002781. [Google Scholar] [CrossRef]
 - Blattler, A.; Yao, L.; Witt, H.; Guo, Y.; Nicolet, C.M.; Berman, B.P.; Farnham, P.J. Global loss of DNA methylation uncovers intronic enhancers in genes showing expression changes. Genome Biol. 2014, 15, 469. [Google Scholar] [CrossRef] [PubMed]
 - Hansen, K.D.; Timp, W.; Bravo, H.C.; Sabunciyan, S.; Langmead, B.; McDonald, O.G.; Wen, B.; Wu, H.; Liu, Y.; Diep, D.; et al. Increased methylation variation in epigenetic domains across cancer types. Nat. Genet. 2011, 43, 768–775. [Google Scholar] [CrossRef]
 - Christman, J.K. 5-Azacytidine and 5-aza-2’-deoxycytidine as inhibitors of DNA methylation: Mechanistic studies and their implications for cancer therapy. Oncogene 2002, 21, 5483–5495. [Google Scholar] [CrossRef]
 - Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed]
 - Powers, R.K.; Goodspeed, A.; Pielke-Lombardo, H.; Tan, A.C.; Costello, J.C. GSEA-InContext: Identifying novel and common patterns in expression experiments. Bioinformatics 2018, 34, i555–i564. [Google Scholar] [CrossRef]
 - Wawrzykowski, J.; Jamiol, M.; Kankofer, M. A pilot study on the relationship between thrombospondin-1 (THBS1) and transforming growth factor beta1 (TGFbeta1) in the bovine placenta during early mid-pregnancy as well as parturition with normally released and retained placenta. Mol. Reprod. Dev. 2024, 91, e23710. [Google Scholar] [CrossRef] [PubMed]
 - Tietze, L.; Christ, M.; Yu, J.; Stock, P.; Nickel, S.; Schulze, A.; Bartels, M.; Tautenhahn, H.M.; Christ, B. Approaching Thrombospondin-1 as a Potential Target for Mesenchymal Stromal Cells to Support Liver Regeneration after Partial Hepatectomy in Mouse and Humans. Cells 2024, 13, 529. [Google Scholar] [CrossRef]
 - Kaur, S.; Roberts, D.D. Emerging functions of thrombospondin-1 in immunity. Semin. Cell Dev. Biol. 2024, 155 Pt B, 22–31. [Google Scholar] [CrossRef]
 - Xiao, Q.; Li, X.; Liu, C.; Jiang, Y.; He, Y.; Zhang, W.; Azevedo, H.S.; Wu, W.; Xia, Y.; He, W. Improving cancer immunotherapy via co-delivering checkpoint blockade and thrombospondin-1 downregulator. Acta. Pharm. Sin. B 2023, 13, 3503–3517. [Google Scholar] [CrossRef] [PubMed]
 - Kaur, S.; Roberts, D.D. Why do humans need thrombospondin-1? J. Cell Commun. Signal. 2023, 17, 485–493. [Google Scholar] [CrossRef]
 - Kumar, R.; Mickael, C.; Kassa, B.; Gebreab, L.; Robinson, J.C.; Koyanagi, D.E.; Sanders, L.; Barthel, L.; Meadows, C.; Fox, D.; et al. TGF-beta activation by bone marrow-derived thrombospondin-1 causes Schistosoma and hypoxia-induced pulmonary hypertension. Nat. Commun. 2017, 8, 15494. [Google Scholar] [CrossRef]
 - Murphy-Ullrich, J.E.; Suto, M.J. Thrombospondin-1 regulation of latent TGF-beta activation: A therapeutic target for fibrotic disease. Matrix Biol. 2018, 68–69, 28–43. [Google Scholar] [CrossRef]
 - Murphy-Ullrich, J.E.; Poczatek, M. Activation of latent TGF-beta by thrombospondin-1: Mechanisms and physiology. Cytokine Growth Factor Rev. 2000, 11, 59–69. [Google Scholar] [CrossRef]
 - Kuroki, H.; Hayashi, H.; Nakagawa, S.; Sakamoto, K.; Higashi, T.; Nitta, H.; Hashimoto, D.; Chikamoto, A.; Beppu, T.; Baba, H. Effect of LSKL peptide on thrombospondin 1-mediated transforming growth factor beta signal activation and liver regeneration after hepatectomy in an experimental model. Br. J. Surg. 2015, 102, 813–825. [Google Scholar] [CrossRef]
 - Laurent, M.A.; Bonnier, D.; Theret, N.; Tuffery, P.; Moroy, G. In silico characterization of the interaction between LSKL peptide, a LAP-TGF-beta derived peptide, and ADAMTS1. Comput. Biol. Chem. 2016, 61, 155–161. [Google Scholar] [CrossRef]
 - Liao, F.; Li, G.; Yuan, W.; Chen, Y.; Zuo, Y.; Rashid, K.; Zhang, J.H.; Feng, H.; Liu, F. LSKL peptide alleviates subarachnoid fibrosis and hydrocephalus by inhibiting TSP1-mediated TGF-beta1 signaling activity following subarachnoid hemorrhage in rats. Exp. Ther. Med. 2016, 12, 2537–2543. [Google Scholar] [CrossRef] [PubMed]
 - Xie, X.S.; Li, F.Y.; Liu, H.C.; Deng, Y.; Li, Z.; Fan, J.M. LSKL, a peptide antagonist of thrombospondin-1, attenuates renal interstitial fibrosis in rats with unilateral ureteral obstruction. Arch. Pharm. Res. 2010, 33, 275–284. [Google Scholar] [CrossRef] [PubMed]
 - Xu, X.; Khoong, Y.M.; Gu, S.; Huang, X.; Ren, J.Y.; Gu, Y.H.; Li, H.; Gao, Y.; Wang, Z.; Zan, T. Investigating the potential of LSKL peptide as a novel hypertrophic scar treatment. Biomed. Pharmacother. 2020, 124, 109824. [Google Scholar] [CrossRef] [PubMed]
 - Yee, K.O.; Streit, M.; Hawighorst, T.; Detmar, M.; Lawler, J. Expression of the Type-1 Repeats of Thrombospondin-1 Inhibits Tumor Growth Through Activation of Transforming Growth Factor-β. Am. J. Pathol. 2004, 165, 541–552. [Google Scholar]
 - Almeida, L.G.; Sakabe, N.J.; deOliveira, A.R.; Silva, M.C.; Mundstein, A.S.; Cohen, T.; Chen, Y.T.; Chua, R.; Gurung, S.; Gnjatic, S.; et al. CTdatabase: A knowledge-base of high-throughput and curated data on cancer-testis antigens. Nucleic Acids Res. 2009, 37, D816–D819. [Google Scholar] [CrossRef]
 - Hao, Y.H.; Doyle, J.M.; Ramanathan, S.; Gomez, T.S.; Jia, D.; Xu, M.; Chen, Z.J.; Billadeau, D.D.; Rosen, M.K.; Potts, P.R. Regulation of WASH-dependent actin polymerization and protein trafficking by ubiquitination. Cell 2013, 152, 1051–1064. [Google Scholar] [CrossRef]
 - Ladelfa, M.F.; Peche, L.Y.; Amato, G.E.; Escalada, M.C.; Zampieri, S.; Pascucci, F.A.; Benevento, A.F.; Do Porto, D.F.; Dardis, A.; Schneider, C.; et al. Expression of the tumor-expressed protein MageB2 enhances rRNA transcription. Biochim. Biophys. Acta Mol. Cell Res. 2021, 1868, 119015. [Google Scholar] [CrossRef]
 - Zhao, X.; Huang, Z.; Chen, Y.; Zhou, Q.; Zhu, F.; Zhang, H.; Zhou, D. MAGEB2-Mediated Degradation of EGR1 Regulates the Proliferation and Apoptosis of Human Spermatogonial Stem Cell Lines. Stem. Cells Int. 2023, 2023, 3610466. [Google Scholar] [CrossRef]
 - Lempesis, I.G.; Georgakopoulou, V.E.; Papalexis, P.; Chrousos, G.P.; Spandidos, D.A. Role of stress in the pathogenesis of cancer (Review). Int. J. Oncol. 2023, 63, 1–14. [Google Scholar] [CrossRef]
 - Aranda-Anzaldo, A.; Dent, M.A.R. Is cancer a disease set up by cellular stress responses? Cell Stress Chaperones 2021, 26, 597–609. [Google Scholar] [CrossRef] [PubMed]
 - Johnstone, S.E.; Baylin, S.B. Stress and the epigenetic landscape: A link to the pathobiology of human diseases? Nat. Rev. Genet. 2010, 11, 806–812. [Google Scholar] [CrossRef]
 - Wu, Z.; Qu, J.; Zhang, W.; Liu, G.H. Stress, epigenetics, and aging: Unraveling the intricate crosstalk. Mol. Cell. 2024, 84, 34–54. [Google Scholar] [CrossRef]
 - Meixner, A.; Karreth, F.; Kenner, L.; Penninger, J.M.; Wagner, E.F. Jun and JunD-dependent functions in cell proliferation and stress response. Cell. Death. Differ. 2010, 17, 1409–1419. [Google Scholar] [CrossRef]
 - Derynck, R.; Turley, S.J.; Akhurst, R.J. TGFβ biology in cancer progression and immunotherapy. Nat. Rev. Clin. Oncol. 2021, 18, 9–34. [Google Scholar] [CrossRef] [PubMed]
 - Siegel, P.M.; Massague, J. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat. Rev. Cancer 2003, 3, 807–821. [Google Scholar] [CrossRef] [PubMed]
 - Katsuno, Y.; Lamouille, S.; Derynck, R. TGF-β signaling and epithelial-mesenchymal transition in cancer progression. Curr. Opin. Oncol. 2013, 25, 76–84. [Google Scholar] [CrossRef]
 - Massagué, J. TGFbeta in Cancer. Cell 2008, 134, 215–230. [Google Scholar] [CrossRef]
 







| Gene | Forward Primer | Reverse Primer | 
|---|---|---|
| MAGEB2 | CAGCCAGGGGTGAATTCTCAG | TTCTCACGGGCACGGAGCTTA | 
| MAGEL2 | CACCTTCCTGATGGCTACAGCA | CTGTCCTCTTGGGCTTCCAGAT | 
| RPLP0 (housekeeping gene) | TCTACAACCCTGAAGTGCTTGAT | CAATCTGCAGACAGACACTGG | 
| ELF-1 (ChIP) | CTGCTGAGGCACTCCTCAAT | CCATGTCATCTTCAGGTGAACTA | 
| JUND (ChIP) | CAGCGAGGAGCAGGAGTT | GAGCTGGTTCTGCTTGTGTAAAT | 
| GAPB-A (ChIP) | GGACGGGTCTAGGTGAGACA | TGGCTGGAGTATTTCAAAGGAT | 
| CTCF (ChIP) | AAGAAAGATGCGCTCTAAGAAAGA | CATCCTCATTGTCGTCCAGA | 
| JunD | ATCGACATGGACACGCAGGAGC | CTCCGTGTTCTGACTCTTGAGG | 
| KDR | GGAACCTCACTATCCGCAGAGT | CCAAGTTCGTCTTTTCCTGGGC | 
| TGFb1 | TACCTGAACCCGTGTTGCTCTC | GTTGCTGAGGTATCGCCAGGAA | 
| CTNNB1 | CACAAGCAGAGTGCTGAAGGTG | GATTCCTGAGAGTCCAAAGACAG | 
| CD44 | CCAGAAGGAACAGTGGTTTGGC | ACTGTCCTCTGGGCTTGGTGTT | 
| MUC1 | CCTACCATCCTATGAGCGAGTAC | GCTGGGTTTGTGTAAGAGAGGC | 
| APC | AGGCTGCATGAGAGCACTTGTG | CACACTTCCAACTTCTCGCAACG | 
| CDH1 | GCCTCCTGAAAAGAGAGTGGAAG | TGGCAGTGTCTCTCCAAATCCG | 
| EREG | CTTATCACAGTCGTCGGTTCCAC | GCCATTCAGACTTGCGGCAACT | 
| SMAD4 | CTACCAGCACTGCCAACTTTCC | CCTGATGCTATCTGCAACAGTCC | 
| THBS1 | GCTGGAAATGTGGTGCTTGTCC | CTCCATTGTGGTTGAAGCAGGC | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Colemon, A.; Romney, C.V.; Jones, A.D.; Bagsby, C.; Jackson, R.; Ramanathan, S. Interplay Between TGFβ1 Signaling and Cancer-Testis Antigen MAGEB2: A New Thorn in Cancer’s Side? Int. J. Mol. Sci. 2025, 26, 2448. https://doi.org/10.3390/ijms26062448
Colemon A, Romney CV, Jones AD, Bagsby C, Jackson R, Ramanathan S. Interplay Between TGFβ1 Signaling and Cancer-Testis Antigen MAGEB2: A New Thorn in Cancer’s Side? International Journal of Molecular Sciences. 2025; 26(6):2448. https://doi.org/10.3390/ijms26062448
Chicago/Turabian StyleColemon, Ashley, Carlan V. Romney, Angelle D. Jones, Clarke Bagsby, Richala Jackson, and Saumya Ramanathan. 2025. "Interplay Between TGFβ1 Signaling and Cancer-Testis Antigen MAGEB2: A New Thorn in Cancer’s Side?" International Journal of Molecular Sciences 26, no. 6: 2448. https://doi.org/10.3390/ijms26062448
APA StyleColemon, A., Romney, C. V., Jones, A. D., Bagsby, C., Jackson, R., & Ramanathan, S. (2025). Interplay Between TGFβ1 Signaling and Cancer-Testis Antigen MAGEB2: A New Thorn in Cancer’s Side? International Journal of Molecular Sciences, 26(6), 2448. https://doi.org/10.3390/ijms26062448
        
