Exploring the CDCA-Scd1 Axis: Molecular Mechanisms Linking the Colitis Microbiome to Neurological Deficits
Abstract
1. Introduction
2. Results
2.1. DSS-Induced Colitis Lead to Gut Microbiome Alteration
2.2. DSS-Induced Colitis Leads to Neurological Dysfunction
2.3. Metabolite Changes in the Colon and Brain After Multiple-Cycle Administration of DSS
2.4. Transcriptome and Proteome Sequencing of the Brain After Multiple-Cycle Administration of DSS
2.5. Colitis Gut Microbiome Leads to Colitis and Neurological Dysfunction
2.6. DSS-Induced Gut Microbiome Decreases the Content of CDCA and Expression of Scd1 in the Brain
2.7. CDCA Ameliorates Colitis and Neurological Dysfunction in DSS-Induced Colitis
2.8. CDCA Elevates the Expression of Scd1 in the Brain of Colitis Mice
3. Discussion
4. Materials and Methods
4.1. Experimental Animal Model of Colitis and Treatment
4.2. Behavioral Tests (Stoelting, Kiel, WI, USA)
4.2.1. Morris Water Maze Task
4.2.2. Open Field Test
4.2.3. Tail Suspension Test
4.2.4. Forced Swimming Test
4.3. Antibiotic Treatment Protocol and Fecal Microbiota Transplant Protocol
4.4. Shotgun Metagenomic and 16S rRNA Sequencing
4.4.1. Shotgun Metagenomic Sequencing
4.4.2. Fecal 16s rRNA Sequencing
4.4.3. Data Analysis
4.5. Metabonomic Analysis Based on LC/MS
4.6. Transcriptome
4.7. Proteomics Analysis Based on Data-Independent Acquisition (DIA) Mass Detection
4.8. GC-MS Analysis of Monounsaturated Fatty Acids
4.9. Immunofluorescence Staining
4.10. Quantitative Real-Time PCR
- GAPDH (AGGTCGGTGTGAACGGATTTG and GGGGTCGTTGATGGCAACA);
- IL-6 (CCAAGAGGTGAGTGCTTCCC and CTGTTGTTCAGACTCTCTCCCT);
- IL-1β (GCAACTGTTCCTGAACTCAACT and ATCTTTTGGGGTCCGTCAACT);
- TNF-α (GACGTGGAACTGGCAGAAGAG and TTGGTGGTTTGTGAGTGTGAG);
- Scd1 (TTCTTGCGATACACTCTGGTGC and CGGGATTGAATGTTCTTGTCGT);
- Fabp7 (GGACACAATGCACATTCAAGAAC and CCGAACCACAGACTTACAGTTT);
- Plin4 (GTGTCCACCAACTCACAGATG and GGACCATTCCTTTTGCAGCAT);
- Hmgcs1 (AACTGGTGCAGAAATCTCTAGC and GGTTGAATAGCTCAGAACTAGCC);
- Pltp (CTTCCCTCTGAAGGAGGACAA and GGAAAAGGCCACGTACACCAT).
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| DSS | Dextran Sulfate Sodium |
| CDCA | Chenodeoxycholic Acid |
| Scd1 | Stearoyl-CoA desaturase |
| MUFA | Monounsaturated fatty acid |
| IBD | Inflammatory bowel disease |
| UC | Ulcerative colitis |
| DCA | Deoxycholic acid |
| DAI | Disease Activity Index |
| MWM | Water maze task |
| OFT | Open field test |
| TST | Tail Suspension Test |
| FST | Forced Swimming Test |
| FMT | Fecal Microbiota Transplanting |
| FC | Fold change |
| NK | Normal Drinking |
| OPLS-DA | Orthogonal Partial Least-Squares Discriminant Analysis |
| PD | Parkinson’s Disease |
| AD | Alzheimer’s Disease |
| BA | Bile acid |
References
- Farzaei, M.H.; Rahimi, R.; Abdollahi, M. The role of dietary polyphenols in the management of inflammatory bowel disease. Curr. Pharm. Biotechnol. 2015, 16, 196–210. [Google Scholar] [CrossRef]
- Danne, C.; Skerniskyte, J.; Marteyn, B.; Sokol, H. Neutrophils: From IBD to the gut microbiota. Nat. Rev. Gastroenterol. Hepatol. 2023, 21, 184–197. [Google Scholar] [CrossRef]
- Ananthakrishnan, A.N. Epidemiology and risk factors for IBD. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 205–217. [Google Scholar] [CrossRef]
- Kaplan, G.G. The global burden of IBD: From 2015 to 2025. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 720–727. [Google Scholar] [CrossRef]
- Thomann, A.K.; Mak, J.W.Y.; Zhang, J.W.; Wuestenberg, T.; Ebert, M.P.; Sung, J.J.Y.; Bernstein, Ç.N.; Reindl, W.; Ng, S.C. Review article: Bugs, inflammation and mood-a microbiota-based approach to psychiatric symptoms in inflammatory bowel diseases. Aliment. Pharmacol. Ther. 2020, 52, 247–266. [Google Scholar] [CrossRef]
- Dubinsky, M.C.; Dotan, I.; Rubin, D.T.; Bernauer, M.; Patel, D.; Cheung, R.; Modesto, I.; Latymer, M.; Keefer, L. Burden of comorbid anxiety and depression in patients with inflammatory bowel disease: A systematic literature review. Expert Rev. Gastroenterol. Hepatol. 2021, 15, 985–997. [Google Scholar] [CrossRef]
- Kredentser, M.S.; Graff, L.A.; Bernstein, C.N. Psychological Comorbidity and Intervention in Inflammatory Bowel Disease. J. Clin. Gastroenterol. 2021, 55, 30–35. [Google Scholar] [CrossRef]
- Neuendorf, R.; Harding, A.; Stello, N.; Hanes, D.; Wahbeh, H. Depression and anxiety in patients with Inflammatory Bowel Disease: A systematic review. J. Psychosom. Res. 2016, 87, 70–80. [Google Scholar] [CrossRef]
- Bonaz, B.L.; Bernstein, C.N. Brain-gut interactions in inflammatory bowel disease. Gastroenterology 2013, 144, 36–49. [Google Scholar] [CrossRef]
- Villarán, R.F.; Espinosa-Oliva, A.M.; Sarmiento, M.; De Pablos, R.M.; Argüelles, S.; Delgado-Cortés, M.J.; Sobrino, V.; Van Rooijen, N.; Venero, J.L.; Herrera, A.J.; et al. Ulcerative colitis exacerbates lipopolysaccharide-induced damage to the nigral dopaminergic system: Potential risk factor in Parkinson`s disease. J. Neurochem. 2010, 114, 1687–1700. [Google Scholar] [CrossRef]
- Yokoyama, J.S.; Wang, Y.; Schork, A.J.; Thompson, W.K.; Karch, C.M.; Cruchaga, C.; McEvoy, L.K.; Witoelar, A.; Chen, C.H.; Holland, D.; et al. Association Between Genetic Traits for Immune-Mediated Diseases and Alzheimer Disease. JAMA Neurol. 2016, 73, 691–697. [Google Scholar] [CrossRef]
- Kim, J.Y.; Choi, M.J.; Ha, S.; Hwang, J.; Koyanagi, A.; Dragioti, E.; Radua, J.; Smith, L.; Jacob, L.; Salazar de Pablo, G.; et al. Association between autism spectrum disorder and inflammatory bowel disease: A systematic review and meta-analysis. Autism Res. 2022, 15, 340–352. [Google Scholar] [CrossRef]
- Goodyear, B.G.; Heidari, F.; Ingram, R.J.M.; Cortese, F.; Sharifi, N.; Kaplan, G.G.; Ma, C.; Panaccione, R.; Sharkey, K.A.; Swain, M.G. Multimodal Brain MRI of Deep Gray Matter Changes Associated With Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2023, 29, 405–416. [Google Scholar] [CrossRef]
- Wang, H.; Labus, J.S.; Griffin, F.; Gupta, A.; Bhatt, R.R.; Sauk, J.S.; Turkiewicz, J.; Bernstein, C.N.; Kornelsen, J.; Mayer, E.A. Functional brain rewiring and altered cortical stability in ulcerative colitis. Mol. Psychiatry 2022, 27, 1792–1804. [Google Scholar] [CrossRef]
- Zonis, S.; Pechnick, R.N.; Ljubimov, V.A.; Mahgerefteh, M.; Wawrowsky, K.; Michelsen, K.S.; Chesnokova, V. Chronic intestinal inflammation alters hippocampal neurogenesis. J. Neuroinflamm. 2015, 12, 65. [Google Scholar] [CrossRef]
- Han, Y.; Zhao, T.; Cheng, X.; Zhao, M.; Gong, S.H.; Zhao, Y.Q.; Wu, H.T.; Fan, M.; Zhu, L.L. Cortical Inflammation is Increased in a DSS-Induced Colitis Mouse Model. Neurosci. Bull. 2018, 34, 1058–1066. [Google Scholar] [CrossRef]
- Mayer, E.A.; Nance, K.; Chen, S. The Gut-Brain Axis. Annu. Rev. Med. 2022, 73, 439–453. [Google Scholar] [CrossRef]
- Quigley, E.M.M. Microbiota-Brain-Gut Axis and Neurodegenerative Diseases. Curr. Neurol. Neurosci. Rep. 2017, 17, 94. [Google Scholar] [CrossRef]
- Barrio, C.; Arias-Sánchez, S.; Martín-Monzón, I. The gut microbiota-brain axis, psychobiotics and its influence on brain and behaviour: A systematic review. Psychoneuroendocrinology 2022, 137, 105640. [Google Scholar] [CrossRef]
- Needham, B.D.; Funabashi, M.; Adame, M.D.; Wang, Z.; Boktor, J.C.; Haney, J.; Wu, W.L.; Rabut, C.; Ladinsky, M.S.; Hwang, S.J.; et al. A gut-derived metabolite alters brain activity and anxiety behaviour in mice. Nature 2022, 602, 647–653. [Google Scholar] [CrossRef]
- Ni, J.; Wu, G.D.; Albenberg, L.; Tomov, V.T. Gut microbiota and IBD: Causation or correlation? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 573–584. [Google Scholar] [CrossRef]
- Bisgaard, T.H.; Allin, K.H.; Keefer, L.; Ananthakrishnan, A.N.; Jess, T. Depression and anxiety in inflammatory bowel disease: Epidemiology, mechanisms and treatment. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 717–726. [Google Scholar] [CrossRef]
- Vogt, B.A. Pain and emotion interactions in subregions of the cingulate gyrus. Nat. Rev. Neurosci. 2005, 6, 533–544. [Google Scholar] [CrossRef]
- Ren, P.; Chen, J.; Li, B.; Zhang, M.; Yang, B.; Guo, X.; Chen, Z.; Cheng, H.; Wang, P.; Wang, S.; et al. Nrf2 Ablation Promotes Alzheimer’s Disease-Like Pathology in APP/PS1 Transgenic Mice: The Role of Neuroinflammation and Oxidative Stress. Oxid. Med. Cell Longev. 2020, 2020, 3050971. [Google Scholar] [CrossRef]
- Gershon, M.D.; Margolis, K.G. The gut, its microbiome, and the brain: Connections and communications. J. Clin. Investig. 2021, 131, e143768. [Google Scholar] [CrossRef]
- Schirmer, M.; Garner, A.; Vlamakis, H.; Xavier, R.J. Microbial genes and pathways in inflammatory bowel disease. Nat. Rev. Microbiol. 2019, 17, 497–511. [Google Scholar] [CrossRef]
- Zarrinpar, A.; Chaix, A.; Xu, Z.Z.; Chang, M.W.; Marotz, C.A.; Saghatelian, A.; Knight, R.; Panda, S. Antibiotic-induced microbiome depletion alters metabolic homeostasis by affecting gut signaling and colonic metabolism. Nat. Commun. 2018, 9, 2872. [Google Scholar] [CrossRef]
- Morais, L.H.; Schreiber, H.L.; Mazmanian, S.K. The gut microbiota-brain axis in behaviour and brain disorders. Nat. Rev. Microbiol. 2021, 19, 241–255. [Google Scholar] [CrossRef]
- Hoyles, L.; Pontifex, M.G.; Rodriguez-Ramiro, I.; Anis-Alavi, M.A.; Jelane, K.S.; Snelling, T.; Solito, E.; Fonseca, S.; Carvalho, A.L.; Carding, S.R.; et al. Regulation of blood-brain barrier integrity by microbiome-associated methylamines and cognition by trimethylamine N-oxide. Microbiome 2021, 9, 235. [Google Scholar] [CrossRef]
- Li, Z.; Lai, J.; Zhang, P.; Ding, J.; Jiang, J.; Liu, C.; Huang, H.; Zhen, H.; Xi, C.; Sun, Y.; et al. Multi-omics analyses of serum metabolome, gut microbiome and brain function reveal dysregulated microbiota-gut-brain axis in bipolar depression. Mol. Psychiatry 2022, 27, 4123–4135. [Google Scholar] [CrossRef]
- Wang, S.; Xu, C.; Liu, H.; Wei, W.; Zhou, X.; Qian, H.; Zhou, L.; Zhang, H.; Wu, L.; Zhu, C.; et al. Connecting the Gut Microbiota and Neurodegenerative Diseases: The Role of Bile Acids. Mol. Neurobiol. 2023, 60, 4618–4640. [Google Scholar] [CrossRef]
- Yang, R.; Qian, L. Research on Gut Microbiota-Derived Secondary Bile Acids in Cancer Progression. Integr. Cancer Ther. 2022, 21, 15347354221114100. [Google Scholar] [CrossRef]
- MahmoudianDehkordi, S.; Arnold, M.; Nho, K.; Ahmad, S.; Jia, W.; Xie, G.; Louie, G.; Kueider-Paisley, A.; Moseley, M.A.; Thompson, J.W.; et al. Altered bile acid profile associates with cognitive impairment in Alzheimer’s disease-An emerging role for gut microbiome. Alzheimer’s Dement. J. Alzheimer’s Assoc. 2019, 15, 76–92. [Google Scholar] [CrossRef]
- Pan, X.; Elliott, C.T.; McGuinness, B.; Passmore, P.; Kehoe, P.G.; Hölscher, C.; McClean, P.L.; Graham, S.F.; Green, B.D. Metabolomic Profiling of Bile Acids in Clinical and Experimental Samples of Alzheimer’s Disease. Metabolites 2017, 7, 28. [Google Scholar] [CrossRef]
- Dionísio, P.A.; Amaral, J.D.; Ribeiro, M.F.; Lo, A.C.; D’Hooge, R.; Rodrigues, C.M. Amyloid-β pathology is attenuated by tauroursodeoxycholic acid treatment in APP/PS1 mice after disease onset. Neurobiol. Aging 2015, 36, 228–240. [Google Scholar] [CrossRef]
- Bazzari, F.H.; Abdallah, D.M.; El-Abhar, H.S. Chenodeoxycholic Acid Ameliorates AlCl(3)-Induced Alzheimer’s Disease Neurotoxicity and Cognitive Deterioration via Enhanced Insulin Signaling in Rats. Molecules 2019, 24, 1992. [Google Scholar] [CrossRef]
- Rodríguez, M.; Pintado, C.; Torrillas-de la Cal, R.; Moltó, E.; Gallardo, N.; Andrés, A.; Arribas, C. Ageing alters the lipid sensing process in the hypothalamus of Wistar rats. Effect of food restriction. Nutr. Neurosci. 2022, 25, 1509–1523. [Google Scholar] [CrossRef]
- Stamatikos, A.D.; Paton, C.M. Role of stearoyl-CoA desaturase-1 in skeletal muscle function and metabolism. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E767–E775. [Google Scholar] [CrossRef]
- Sartorius, T.; Ketterer, C.; Kullmann, S.; Balzer, M.; Rotermund, C.; Binder, S.; Hallschmid, M.; Machann, J.; Schick, F.; Somoza, V.; et al. Monounsaturated fatty acids prevent the aversive effects of obesity on locomotion, brain activity, and sleep behavior. Diabetes 2012, 61, 1669–1679. [Google Scholar] [CrossRef]
- Papsdorf, K.; Miklas, J.W.; Hosseini, A.; Cabruja, M.; Morrow, C.S.; Savini, M.; Yu, Y.; Silva-García, C.G.; Haseley, N.R.; Murphy, L.M.; et al. Lipid droplets and peroxisomes are co-regulated to drive lifespan extension in response to mono-unsaturated fatty acids. Nat. Cell Biol. 2023, 25, 672–684. [Google Scholar] [CrossRef]
- He, X.F.; Li, L.L.; Xian, W.B.; Li, M.Y.; Zhang, L.Y.; Xu, J.H.; Pei, Z.; Zheng, H.Q.; Hu, X.Q. Chronic colitis exacerbates NLRP3-dependent neuroinflammation and cognitive impairment in middle-aged brain. J. Neuroinflamm. 2021, 18, 153. [Google Scholar] [CrossRef]
- Schmidt, D.R.; Schmidt, S.; Holmstrom, S.R.; Makishima, M.; Yu, R.T.; Cummins, C.L.; Mangelsdorf, D.J.; Kliewer, S.A. AKR1B7 is induced by the farnesoid X receptor and metabolizes bile acids. J. Biol. Chem. 2011, 286, 2425–2432. [Google Scholar] [CrossRef]
- Kim, W.K.; Jang, Y.J.; Seo, B.; Han, D.H.; Park, S.J.; Ko, G. Administration of Lactobacillus paracasei strains improves immunomodulation and changes the composition of gut microbiota leading to improvement of colitis in mice. J. Funct. Foods 2019, 52, 565–575. [Google Scholar] [CrossRef]
- Jang, Y.J.; Kim, W.K.; Han, D.H.; Lee, K.; Ko, G. Lactobacillus fermentum species ameliorate dextran sulfate sodium-induced colitis by regulating the immune response and altering gut microbiota. Gut Microbes 2019, 10, 696–711. [Google Scholar] [CrossRef]
- Jhan, K.Y.; Lai, G.J.; Chang, P.K.; Tang, R.Y.; Cheng, C.J.; Chen, K.Y.; Wang, L.C. Angiostrongylus cantonensis causes cognitive impairments in heavily infected BALB/c and C57BL/6 mice. Parasites Vectors 2020, 13, 405. [Google Scholar] [CrossRef]
- Liu, S.; Fan, M.; Xu, J.X.; Yang, L.J.; Qi, C.C.; Xia, Q.R.; Ge, J.F. Exosomes derived from bone-marrow mesenchymal stem cells alleviate cognitive decline in AD-like mice by improving BDNF-related neuropathology. J. Neuroinflamm. 2022, 19, 35. [Google Scholar] [CrossRef]
- Yuan, X.; Chen, B.; Duan, Z.; Xia, Z.; Ding, Y.; Chen, T.; Liu, H.; Wang, B.; Yang, B.; Wang, X.; et al. Depression and anxiety in patients with active ulcerative colitis: Crosstalk of gut microbiota, metabolomics and proteomics. Gut Microbes 2021, 13, 1987779. [Google Scholar] [CrossRef]
- Amorim, N.; McGovern, E.; Raposo, A.; Khatiwada, S.; Shen, S.; Koentgen, S.; Hold, G.; Behary, J.; El-Omar, E.; Zekry, A. Refining a Protocol for Faecal Microbiota Engraftment in Animal Models After Successful Antibiotic-Induced Gut Decontamination. Front. Med. 2022, 9, 770017. [Google Scholar] [CrossRef]
- Li, N.; Ma, P.; Li, Y.; Shang, X.; Nan, X.; Shi, L.; Han, X.; Liu, J.; Hong, Y.; Li, Q.; et al. Gut microbiota-derived 12-ketolithocholic acid suppresses the IL-17A secretion from colonic group 3 innate lymphoid cells to prevent the acute exacerbation of ulcerative colitis. Gut Microbes 2023, 15, 2290315. [Google Scholar] [CrossRef]
- Jia, D.; Wang, Q.; Qi, Y.; Jiang, Y.; He, J.; Lin, Y.; Sun, Y.; Xu, J.; Chen, W.; Fan, L.; et al. Microbial metabolite enhances immunotherapy efficacy by modulating T cell stemness in pan-cancer. Cell 2024, 187, 1651–1665.e21. [Google Scholar] [CrossRef]
- Lv, D.; Cao, X.; Zhong, L.; Dong, Y.; Xu, Z.; Rong, Y.; Xu, H.; Wang, Z.; Yang, H.; Yin, R.; et al. Targeting phenylpyruvate restrains excessive NLRP3 inflammasome activation and pathological inflammation in diabetic wound healing. Cell Rep. Med. 2023, 4, 101129. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Liu, H.; Zhong, J.; Guo, Z.; Wu, J.; Zhang, H.; Huang, Z.; Jiang, L.; Li, H.; Zhang, Z.; et al. Bexarotene protects against neurotoxicity partially through a PPARγ-dependent mechanism in mice following traumatic brain injury. Neurobiol. Dis. 2018, 117, 114–124. [Google Scholar] [CrossRef] [PubMed]








Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Du, D.; Li, Q.; Wei, Z.; Wang, Z.; Xu, L. Exploring the CDCA-Scd1 Axis: Molecular Mechanisms Linking the Colitis Microbiome to Neurological Deficits. Int. J. Mol. Sci. 2025, 26, 2111. https://doi.org/10.3390/ijms26052111
Du D, Li Q, Wei Z, Wang Z, Xu L. Exploring the CDCA-Scd1 Axis: Molecular Mechanisms Linking the Colitis Microbiome to Neurological Deficits. International Journal of Molecular Sciences. 2025; 26(5):2111. https://doi.org/10.3390/ijms26052111
Chicago/Turabian StyleDu, Donglin, Qi Li, Zhengqiang Wei, Ziwei Wang, and Lei Xu. 2025. "Exploring the CDCA-Scd1 Axis: Molecular Mechanisms Linking the Colitis Microbiome to Neurological Deficits" International Journal of Molecular Sciences 26, no. 5: 2111. https://doi.org/10.3390/ijms26052111
APA StyleDu, D., Li, Q., Wei, Z., Wang, Z., & Xu, L. (2025). Exploring the CDCA-Scd1 Axis: Molecular Mechanisms Linking the Colitis Microbiome to Neurological Deficits. International Journal of Molecular Sciences, 26(5), 2111. https://doi.org/10.3390/ijms26052111
