Salt-Resilient Cowpeas: Early Identification Through Growth Parameters and Gene Expression at Germination Stage
Abstract
1. Introduction
2. Results
2.1. Definition of the Optimal NaCl Concentrations
2.2. Effect of Salt Stress on Germination Parameters
2.3. Effect of Salt Stress on Lipid Peroxidation Through Malondialdehyde (MDA) Quantification
2.4. Screening of Cowpea Accessions for Salt Stress Resilience
2.5. Gene Expression Profiling to Screen Cowpea Salt Stress Resilience
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Determination of Optimal NaCl Concentration
4.3. Germination Conditions and Experimental Design
4.4. Growth Measurements and Data Collection
4.5. MDA Determination
4.6. Gene Expression of Salt-Related Genes
4.7. Data Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Irik, H.A.; Bikmaz, G. Effect of Different Salinity on Seed Germination, Growth Parameters and Biochemical Contents of Pumpkin (Cucurbita pepo L.) Seeds Cultivars. Sci. Rep. 2024, 14, 6929. [Google Scholar] [CrossRef]
- Ravelombola, W.S.; Shi, A.; Weng, Y.; Clark, J.; Motes, D.; Chen, P.; Srivastava, V. Evaluation of Salt Tolerance at Germination Stage in Cowpea [Vigna unguiculata (L.) Walp]. HortScience 2017, 52, 1168–1176. [Google Scholar] [CrossRef]
- Hameed, A.; Ahmed, M.Z.; Hussain, T.; Aziz, I.; Ahmad, N.; Gul, B.; Nielsen, B.L. Effects of Salinity Stress on Chloroplast Structure and Function. Cells 2021, 10, 2023. [Google Scholar] [CrossRef]
- Pereira, E.D.; Marinho, A.B.; Ramos, E.G.; Fernandes, C.N.D.; Borges, F.R.M.; de Nazaré José Adriano, J. Saline Stress Effect on Cowpea Beans Growth under Biofertilizer Correction. Biosci. J. 2019, 35, 1328–1338. [Google Scholar] [CrossRef]
- Carvalho, M.; Matos, M.; Castro, I.; Monteiro, E.; Rosa, E.; Lino-Neto, T.; Carnide, V. Screening of Worldwide Cowpea Collection to Drought Tolerant at a Germination Stage. Sci. Hortic. 2019, 247, 107–115. [Google Scholar] [CrossRef]
- Zahedi, S.M.; Ansari, A.; Azizi, M. The Study of the Effect of Salinity Stress on the Germination and the Initial Growth of Cowpea (Vigna unguiculata L. Walp). J. Agric. Technol. 2012, 8, 2363. [Google Scholar]
- Praxedes, S.C.; Damatta, F.M.; De Lacerda, C.F.; Prisco, J.T.; Gomes-Filho, E. Salt Stress Tolerance in Cowpea Is Poorly Related to the Ability to Cope with Oxidative Stress. Acta Bot. Croat. 2014, 73, 51–62. [Google Scholar] [CrossRef]
- Yu, B.; Chao, D.Y.; Zhao, Y. How Plants Sense and Respond to Osmotic Stress. J. Integr. Plant Biol. 2024, 66, 394–423. [Google Scholar] [CrossRef] [PubMed]
- Begum, M.A. Saline Stress on Seed Germination. Sci. Res. Essays 2013, 8, 1420–1423. [Google Scholar] [CrossRef]
- Shu, K.; Qi, Y.; Chen, F.; Meng, Y.; Luo, X.; Shuai, H.; Zhou, W.; Ding, J.; Du, J.; Liu, J.; et al. Salt Stress Represses Soybean Seed Germination by Negatively Regulating GA Biosynthesis While Positively Mediating ABA Biosynthesis. Front. Plant Sci. 2017, 8, 1372. [Google Scholar] [CrossRef]
- Qin, F.; Kakimoto, M.; Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Tran, L.S.P.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Regulation and Functional Analysis of ZmDREB2A in Response to Drought and Heat Stresses in Zea mays L. Plant J. 2007, 50, 54–69. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, P.K.; Gupta, K.; Lopato, S.; Agarwal, P. Dehydration Responsive Element Binding Transcription Factors and Their Applications for the Engineering of Stress Tolerance. J. Exp. Bot. 2017, 68, 2135–2148. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhang, D.; Li, H.; Wang, Y.; Zhang, Y.; Wood, A.J. EsDREB2B, a Novel Truncated DREB2-Type Transcription Factor in the Desert Legume Eremosparton songoricum, Enhances Tolerance to Multiple Abiotic Stresses in Yeast and Transgenic Tobacco. BMC Plant Biol. 2014, 14, 44. [Google Scholar] [CrossRef]
- Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AP2/ERF Family Transcription Factors in Plant Abiotic Stress Responses. Biochim. Biophys. Acta-Gene Regul. Mech. 2012, 1819, 86–96. [Google Scholar] [CrossRef] [PubMed]
- Joshi, R.; Wani, S.H.; Singh, B.; Bohra, A.; Dar, Z.A.; Lone, A.A.; Pareek, A.; Singla-Pareek, S.L. Transcription Factors and Plants Response to Drought Stress: Current Understanding and Future Directions. Front. Plant Sci. 2016, 7, 1265–1276. [Google Scholar] [CrossRef]
- Žárský, V.; Kulich, I.; Fendrych, M.; Pečenková, T. Exocyst Complexes Multiple Functions in Plant Cells Secretory Pathways. Curr. Opin. Plant Biol. 2013, 16, 726–733. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Gu, C.; Zhang, J.; Guo, J.; Zhang, X.; Zhou, Z. Genome-Wide Analysis of Exocyst Complex Subunit Exo70 Gene Family in Cucumber. Int. J. Mol. Sci. 2023, 24, 929. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Zhang, X.; Wan, W.; Zhang, H.; Liu, J.; Li, M.; Wang, H.; Xiao, J.; Wang, X. Identification and Characterization of the EXO70 Gene Family in Polyploid Wheat and Related Species. Int. J. Mol. Sci. 2019, 20, 60. [Google Scholar] [CrossRef]
- Gupta, S.; Kaur, R.; Sharma, T.; Bhardwaj, A.; Sharma, S.; Sohal, J.S.; Singh, S.V. Multi-Omics Approaches for Understanding Stressor-Induced Physiological Changes in Plants: An Updated Overview. Physiol. Mol. Plant Pathol. 2023, 126, 102047. [Google Scholar] [CrossRef]
- van Loon, M.P.; Alimagham, S.; Pronk, A.; Fodor, N.; Ion, V.; Kryvoshein, O.; Kryvobok, O.; Marrou, H.; Mihail, R.; Mínguez, M.I.; et al. Grain Legume Production in Europe for Food, Feed and Meat-Substitution. Glob. Food Sec. 2023, 39, 100723. [Google Scholar] [CrossRef]
- Kang, B.H.; Kim, W.J.; Chowdhury, S.; Moon, C.Y.; Kang, S.; Kim, S.H.; Jo, S.H.; Jun, T.H.; Do Kim, K.; Ha, B.K. Transcriptome Analysis of Differentially Expressed Genes Associated with Salt Stress in Cowpea (Vigna unguiculata L.) during the Early Vegetative Stage. Int. J. Mol. Sci. 2023, 24, 4762. [Google Scholar] [CrossRef]
- Ravelombola, W.; Shi, A.; Huynh, B.L.; Qin, J.; Xiong, H.; Manley, A.; Dong, L.; Olaoye, D.; Bhattarai, G.; Zia, B.; et al. Genetic Architecture of Salt Tolerance in a Multi-Parent Advanced Generation Inter-Cross (MAGIC) Cowpea Population. BMC Genom. 2022, 23, 100. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, M.; Carnide, V.; Sobreira, C.; Castro, I.; Coutinho, J.; Barros, A.; Rosa, E. Cowpea Immature Pods and Grains Evaluation: An Opportunity for Different Food Sources. Plants 2022, 11, 2079. [Google Scholar] [CrossRef] [PubMed]
- Boukar, O.; Belko, N.; Chamarthi, S.; Togola, A.; Batieno, J.; Owusu, E.; Haruna, M.; Diallo, S.; Umar, M.L.; Olufajo, O.; et al. Cowpea (Vigna unguiculata): Genetics, Genomics and Breeding. Plant Breed. 2019, 138, 415–424. [Google Scholar] [CrossRef]
- Carvalho, M.; Lino-Neto, T.; Rosa, E.; Carnide, V. Cowpea: A Legume Crop for a Challenging Environment. J. Sci. Food Agric. 2017, 97, 4273–4284. [Google Scholar] [CrossRef] [PubMed]
- Stagnari, F.; Maggio, A.; Galieni, A.; Pisante, M. Multiple Benefits of Legumes for Agriculture Sustainability: An Overview. Chem. Biol. Technol. Agric. 2017, 4, 2. [Google Scholar] [CrossRef]
- Padillaa, E.G.; Sáncheza, R.C.L.; Eichler-Loebermannb, B.; Fernández-Pascualc, M.; Katia; Barreroa, A.; Martíneza, L.A. Salt Stress Effects on Cowpea (Vigna unguiculata L. Walp.) Varieties at Different Growing Stages. In Proceedings of the Conference on International Research on Food Security, Natural Resource Management and Rural Development, Hamburg, Germany, 6–8 October 2009. [Google Scholar]
- Ma, Y.; Dias, M.C.; Freitas, H. Drought and Salinity Stress Responses and Microbe-Induced Tolerance in Plants. Front. Plant Sci. 2020, 11, 276. [Google Scholar] [CrossRef]
- Weiss, J.; Terry, M.I.; Martos-Fuentes, M.; Letourneux, L.; Ruiz-Hernández, V.; Fernández, J.A.; Egea-Cortines, M. Diel Pattern of Circadian Clock and Storage Protein Gene Expression in Leaves and during Seed Filling in Cowpea (Vigna unguiculata). BMC Plant Biol. 2018, 18, 33. [Google Scholar] [CrossRef]
- Da Silva, H.A.P.; Nardeli, S.M.; Alves-Ferreira, M.; Simões-Araújo, J.L. Evaluation of Reference Genes for RT-QPCR Normalization in Cowpea under Drought Stress during Biological Nitrogen Fixation. Crop Sci. 2015, 55, 1660–1672. [Google Scholar] [CrossRef]
- Amorim, L.L.B.; Ferreira-Neto, J.R.C.; Bezerra-Neto, J.P.; Pandolfi, V.; Araújo, F.T.; Silva Matos, M.K.; Santos, M.G.; Kido, E.A.; Benko-Iseppon, A.M. Cowpea and Abiotic Stresses: Identification of Reference Genes for Transcriptional Profiling by QPCR. Plant Methods 2018, 14, 88. [Google Scholar] [CrossRef]
- Dong, L.; Ravelombola, W.; Weng, Y.; Qin, J.; Bhattarai, G.; Zia, B.; Zhou, W.; Wang, Y.; Mou, B.; Shi, A. Seedling Salt Tolerance for above Ground-Related Traits in Cowpea (Vigna unguiculata (L.) Walp). Euphytica 2019, 215, 53. [Google Scholar] [CrossRef]
- Raggi, L.; Caproni, L.; Ciancaleoni, S.; D’Amato, R.; Businelli, D.; Negri, V. Investigating the Genetic Basis of Salt-Tolerance in Common Bean: A Genome-Wide Association Study at the Early Vegetative Stage. Sci. Rep. 2024, 14, 5315. [Google Scholar] [CrossRef]
- Nunes, L.R.D.L.; Pinheiro, P.R.; Pinheiro, C.L.; Lima, K.A.P.; Dutra, A.S. Germination and Vigour in Seeds of the Cowpea in Response to Salt and Heat Stress. Rev. Caatinga 2019, 32, 143–151. [Google Scholar] [CrossRef]
- Tavares, D.S.; Fernandes, T.E.K.; Rita, Y.L.; Rocha, D.C.; Sant’Anna-Santos, B.F.; Gomes, M.P. Germinative Metabolism and Seedling Growth of Cowpea (Vigna unguiculata) under Salt and Osmotic Stress. S. Afr. J. Bot. 2021, 139, 399–408. [Google Scholar] [CrossRef]
- Nikolić, N.; Ghirardelli, A.; Schiavon, M.; Masin, R. Effects of the Salinity-Temperature Interaction on Seed Germination and Early Seedling Development: A Comparative Study of Crop and Weed Species. BMC Plant Biol. 2023, 23, 446. [Google Scholar] [CrossRef] [PubMed]
- Thiam, M.; Champion, A.; Diouf, D.; Ourèye SY, M. NaCl Effects on In Vitro Germination and Growth of Some Senegalese Cowpea (Vigna unguiculata (L.) Walp.) Cultivars. ISRN Biotechnol. 2013, 2013, 382417. [Google Scholar] [CrossRef]
- Gogile, A.; Andargie, M.; Muthuswamy, M. The Response of Some Cowpea (Vigna unguiculata (L.) Walp.) Genotypes for Salt Stress during Germination and Seedling Stage. J. Stress Physiol. Biochem. 2013, 9, 73–84. [Google Scholar]
- Jayawardhane, J.; Goyali, J.C.; Zafari, S.; Igamberdiev, A.U. The Response of Cowpea (Vigna unguiculata) Plants to Three Abiotic Stresses Applied with Increasing Intensity: Hypoxia, Salinity, and Water Deficit. Metabolites 2022, 12, 38. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, M.; Castro, I.; Moutinho-Pereira, J.; Correia, C.; Egea-Cortines, M.; Matos, M.; Rosa, E.; Carnide, V.; Lino-Neto, T. Evaluating Stress Responses in Cowpea under Drought Stress. J. Plant Physiol. 2019, 241, 153001. [Google Scholar] [CrossRef]
- Sairam, R.K.; Srivastava, G.C.; Agarwal, S.; Meena, R.C. Differences in Antioxidant Activity in Response to Salinity Stress in Tolerant and Susceptible Wheat Genotypes. Biol. Plant. 2005, 49, 85–91. [Google Scholar] [CrossRef]
- Kaur, N.; Kumar, A.; Kaur, K.; Gupta, A.K.; Singh, I. DPPH Radical Scavenging Activity and Contents of H2O2, Malondialdehyde and Proline in Determining Salinity Tolerance in Chickpea Seedlings. Indian J. Geo-Mar. Sci. 2014, 51, 407–415. [Google Scholar]
- Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Qin, F.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Functional Analysis of an Arabidopsis Transcription Factor, DREB2A, Involved in Drought-Responsive Gene Expression. Plant Cell 2006, 18, 1292–1309. [Google Scholar] [CrossRef]
- Luo, Z.; Szczepanek, A.; Abdel-Haleem, H. Genome-Wide Association Study (GWAS) Analysis of Camelina Seedling Germination under Salt Stress Condition. Agronomy 2020, 10, 1444. [Google Scholar] [CrossRef]
- Razzaque, S.; Elias, S.M.; Haque, T.; Biswas, S.; Jewel, G.M.N.A.; Rahman, S.; Weng, X.; Ismail, A.M.; Walia, H.; Juenger, T.E.; et al. Gene Expression Analysis Associated with Salt Stress in a Reciprocally Crossed Rice Population. Sci. Rep. 2019, 9, 8249. [Google Scholar] [CrossRef] [PubMed]
- Chan, Z.; Loescher, W.; Grumet, R. Transcriptional Variation in Response to Salt Stress in Commonly Used Arabidopsis Thaliana Accessions. Plant Physiol. Biochem. 2013, 73, 189–201. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. Past: Paleontological Statistics Software Package for Education and Data Analysis Past: Paleontological Statistics Software Package for Education and Data Analysis Even a Cursory Glance at the Recent Paleontological Literature Should Convince Anyone Tha. Palaeontol. Electron. 2001, 4, 4. [Google Scholar]





| Accession | Treatment | %Germination | Germination Rate | Root Length | Shoot Length | Vigour Index |
|---|---|---|---|---|---|---|
| Co_1 | Control | 100.00 ± 0.00 b | 3.61 ± 0.84 a–f | 7.86 ± 1.86 a–h | 1.68 ± 0.63 c–h | 955.67 ± 116.51 a,b |
| Salt stress | 86.67 ± 11.55 A | 2.06 ± 0.26 A–C | 2.19 ± 0.68 A–E | without shoot | 191.47 ± 44.06 A,B | |
| Co_2 | Control | 100.00 ± 0.00 b | 4.83 ± 0.29 e,f | 7.99 ± 2.82 b–h | 1.39 ± 0.55 b–h | 973.33 ± 143.20 a,b |
| Salt stress | 100.00 ± 0.00 A | 3.06 ± 0.42 A–D | 3.57 ± 0.68 D–J | 1.11 ± 0.49 A,B | 468.33 ± 22.19 D–F | |
| Co_3 | Control | 73.33 ± 11.55 a | 2.42 ± 1.02 a,b | 9.32 ± 3.36 f–h | 2.17 ± 0.50 g–h | 843.33 ± 135.77 a,b |
| Salt stress | 73.33 ± 11.55 A | 2.17 ± 0.29 A–D | 1.98 ± 0.54 A | without shoot | 165.07 ± 13.15 A | |
| Co_4 | Control | 100.00 ± 0.00 b | 4.50 ± 0.50 d–f | 6.79 ± 2.85 d–h | 1.45 ± 0.46 b–h | 1009.50 ± 154.11 a,b |
| Salt stress | 86.67 ± 11.55 A | 2.36 ± 0.97 A–D | 3.08 ± 1.02 A–J | 1.20 ± 0.25 A,B | 370.50 ± 78.78 A–F | |
| Co_5 | Control | 80.00 ± 0.00 a,b | 4.17 ± 0.76 b–f | 6.75 ± 2.82 a–g | 2.29 ± 0.74 h | 648.67 ± 349.84 a |
| Salt stress | 80.00 ± 0.00 A | 2.17 ± 0.44 A–D | 2.14 ± 0.63 A–C | 1.00 ± 0.00 A,B | 224.67 ± 63.89 A–C | |
| Co_6 | Control | 86.67 ± 11.55 a,b | 3.67 ± 0.29 a–f | 5.92 ± 1.64 a–e | 1.67 ± 0.35 c–h | 653.33 ± 148.44 a |
| Salt stress | 86.67 ± 11.55 A | 2.31 ± 0.21 A–D | 3.29 ± 1.09 A–J | without shoot | 281.33 ± 73.79 A–D | |
| Co_7 | Control | 100.00 ± 0.00 b | 2.44 ± 0.10 a,b | 6.70 ± 1.68 a–g | 0.33 ± 0.58 a | 703.33 ± 170.39 a,b |
| Salt stress | 100.00 ± 0.00 A | 1.86 ± 0.41 A–C | 2.00 ± 0.54 A | without shoot | 233.33 ± 70.95 A–D | |
| Co_8 | Control | 93.33 ± 11.55 a,b | 4.17 ± 0.58 b–f | 6.87 ± 2.79 a–g | 1.64 ± 0.69 c–h | 783.56 ± 130.48 a,b |
| Salt stress | 93.33 ± 11.55 A | 2.61 ± 0.19 A–D | 3.07 ± 0.70 A–J | 1.00 ± 0.00 A,B | 364.83 ± 46.69 A–F | |
| Co_9 | Control | 100.00 ± 0.00 b | 4.33 ± 0.76 c–f | 6.90 ± 1.51 a–g | 1.78 ± 0.57 d–h | 874.72 ± 119.65 a,b |
| Salt stress | 100.00 ± 0.00 A | 3.22 ± 0.35 B–D | 2.15 ± 0.69 A–D | without shoot | 215.33 ± 34.43 A,B | |
| Co_10 | Control | 100.00 ± 0.00 b | 4.67 ± 0.29 d–f | 4.53 ± 0.61 a | 1.50 ± 0.45 b–h | 590.00 ± 43.59 a |
| Salt stress | 100.00 ± 0.00 A | 2.44 ± 0.10 A–D | 2.33 ± 0.56 A–G | without shoot | 233.33 ± 25.17 A–D | |
| Co_11 | Control | 100.00 ± 0.00 b | 3.06 ± 0.42 a–e | 7.77 ± 2.50 a–h | 1.40 ± 0.66 b–h | 908.33 ± 185.09 a,b |
| Salt stress | 100.00 ± 0.00 A | 2.06 ± 0.10 A–C | 2.13 ± 0.58 A–C | without shoot | 246.67 ± 40.42 A–D | |
| Co_12 | Control | 93.33 ± 11.55 a,b | 3.00 ± 0.00 a–d | 5.17 ± 1.67 a–c | 1.50 ± 0.35 b–h | 618.00 ± 43.24 a |
| Salt stress | 100.00 ± 0.00 A | 2.36 ± 0.13 A–D | 2.37 ± 0.95 A–H | 0.50 ± 0.00 A | 253.33 ± 72.34 A–D | |
| Co_13 | Control | 93.33 ± 11.55 a,b | 3.67 ± 1.04 a–f | 4.86 ± 1.67 a–b | 1.56 ± 0.90 b–h | 599.00 ± 150.74 a |
| Salt stress | 73.33 ± 30.55 A | 1.72 ± 0.84 A–C | 2.27 ± 1.13 A–F | without shoot | 172.33 ± 61.04 A | |
| Co_14 | Control | 100.00 ± 0.00 b | 4.50 ± 0.00 d–f | 6.13 ± 1.59 a–f | 1.43 ± 0.50 b–h | 756.67 ± 148.44 a,b |
| Salt stress | 86.67 ± 23.09 A | 2.56 ± 0.75 A–D | 2.33 ± 0.81 A–G | 1.00 ± 0.00 A,B | 248.61 ± 96.94 A–D | |
| Co_15 | Control | 93.33 ± 11.55 a,b | 3.33 ± 0.58 a–f | 5.43 ± 1.47 a–d | 1.10 ± 0.22 a–f | 588.17 ± 241.90 a |
| Salt stress | 86.67 ± 23.09 A | 1.83 ± 0.58 A–C | 2.07 ± 0.83 A–B | without shoot | 216.00 ± 116.83 A,B | |
| Co_16 | Control | 86.67 ± 23.09 a,b | 4.50 ± 0.87 d–f | 6.67 ± 1.32 a–g | 1.25 ± 0.26 b–g | 688.33 ± 199.77 a,b |
| Salt stress | 100.00 ± 0.00 A | 3.11 ± 0.67 A–D | 2.57 ± 0.78 A–I | 1.00 ± 0.00 A,B | 290.00 ± 121.44 A–E | |
| Co_17 | Control | 100.00 ± 0.00 b | 4.83 ± 0.29 e,f | 6.75 ± 1.89 a–g | 1.23 ± 0.26 a–g | 810.28 ± 151.44 a,b |
| Salt stress | 93.33 ± 11.55 A | 3.83 ± 1.04 D | 2.96 ± 0.75 A–J | 1.00 ± 0.00 a,b | 313.17 ± 135.81 A–E | |
| Co_18 | Control | 100.00 ± 0.00 b | 5.00 ± 0.00 f | 6.70 ± 1.72 a–g | 1.38 ± 0.31 b–h | 807.78 ± 56.99 a,b |
| Salt stress | 93.33 ± 11.55 A | 3.17 ± 0.29 B–D | 3.07 ± 0.92 A–J | without shoot | 276.50 ± 37.37 A–D | |
| Co_19 | Control | 100.00 ± 0.00 b | 4.67 ± 0.29 d–f | 7.97 ± 2.94 b–h | 1.23 ± 0.50 a–g | 920.00 ± 270.74 a,b |
| Salt stress | 86.67 ± 23.09 A | 2.94 ± 0.82 A–D | 2.89 ± 0.79 A–J | without shoot | 251.83 ± 72.87 A–D | |
| Co_20 | Control | 100.00 ± 0.00 b | 3.67 ± 0.29 a–f | 9.67 ± 2.30 g–h | 1.43 ± 0.29 b–h | 1112.22 ± 173.33 a,b |
| Salt stress | 100.00 ± 0.00 A | 2.39 ± 0.19 A–D | 3.63 ± 1.11 F–K | 0.58 ± 0.46 A,B | 400.00 ± 52.92 A–F | |
| Co_21 | Control | 100.00 ± 0.00 b | 2.94 ± 0.82 a–d | 5.64 ± 1.73 a–e | 0.79 ± 0.39 a–c | 656.94 ± 30.42 a |
| Salt stress | 86.67 ± 11.55 A | 2.33 ± 0.29 A–D | 3.07 ± 0.92 A–J | without shoot | 295.33 ± 35.01 A–E | |
| Co_22 | Control | 100.00 ± 0.00 b | 2.56 ± 0.42 a–c | 8.13 ± 2.94 b–h | 0.90 ± 0.42 a–d | 905.00 ± 118.22 a,b |
| Salt stress | 100.00 ± 0.00 A | 1.78 ± 0.10 A–C | 4.03 ± 1.14 J–K | without shoot | 403.33 ± 20.82 A–F | |
| Co_23 | Control | 93.33 ± 11.55 a,b | 2.50 ± 0.50 a,b | 6.75 ± 2.31 a–g | 1.70 ± 0.45 c–h | 812.17 ± 285.61 a,b |
| Salt stress | 93.33 ± 11.55 A | 2.44 ± 0.10 A–D | 3.50 ± 0.93 C–J | without shoot | 332.67 ± 108.08 A–E | |
| Co_24 | Control | 100.00 ± 0.00 b | 4.50 ± 0.50 d–f | 8.68 ± 3.88 d–h | 1.89 ± 0.45 e–h | 1065.83 ± 105.49 a,b |
| Salt stress | 93.33 ± 11.55 a | 3.00 ± 0.50 A–D | 5.00 ± 1.23 K | 1.23 ± 0.26 A,B | 580.17 ± 76.11 F | |
| Co_25 | Control | 100.00 ± 0.00 b | 4.67 ± 0.58 d–f | 10.73 ± 3.23 h | 2.04 ± 0.54 f–h | 1280.00 ± 298.66 b |
| Salt stress | 100.00 ± 0.00 A | 3.28 ± 0.10 C–D | 3.97 ± 1.48 I–K | 1.27 ± 0.33 B | 524.17 ± 13.77 E–F | |
| Co_26 | Control | 100.00 ± 0.00 b | 3.11 ± 0.54 a–e | 5.70 ± 2.17 a–e | 1.44 ± 0.32 b–h | 713.06 ± 106.39 a,b |
| Salt stress | 100.00 ± 0.00 A | 2.22 ± 0.10 A–D | 2.08 ± 0.90 A–C | without shoot | 224.67 ± 74.87 A–C | |
| Co_27 | Control | 100.00 ± 0.00 b | 2.94 ± 0.42 a–d | 5.43 ± 2.42 a–d | 1.30 ± 0.45 b–g | 665.83 ± 225.89 a,b |
| Salt stress | 100.00 ± 0.00 A | 2.11 ± 0.10 A–C | 2.10 ± 0.99 A–C | without shoot | 210.00 ± 40.00 A,B | |
| Co_28 | Control | 86.67 ± 23.09 a,b | 3.17 ± 0.76 a–e | 8.29 ± 3.09 c–h | 1.77 ± 0.41 d–h | 908.89 ± 336.01 a,b |
| Salt stress | 86.67 ± 11.55 A | 3.17 ± 0.76 A–D | 3.19 ± 1.55 A–J | 0.83 ± 0.35 A,B | 320.00 ± 150.997 A–E | |
| Co_29 | Control | 100.00 ± 0.00 b | 4.67 ± 0.29 d–f | 8.17 ± 2.83 b–h | 1.10 ± 0.22 a–f | 919.444 ± 121.864 a,b |
| Salt stress | 86.67 ± 23.09 A | 3.00 ± 1.32 A–D | 3.05 ± 1.30 A–J | 1.00 ± 0.25 A,B | 345.833 ± 177.056 A–F | |
| Co_30 | Control | 100.00 ± 0.00 b | 2.22 ± 0.26 a | 6.97 ± 1.92 a–g | without shoot | 696.667 ± 134.288 a,b |
| Salt stress | 100.00 ± 0.00 A | 2.17 ± 0.00 A–D | 3.43 ± 0.88 B–J | without shoot | 343.333 ± 30.551 A–F | |
| Co_31 | Control | 93.33 ± 11.55 a,b | 3.33 ± 0.58 a–f | 6.17 ± 1.31 a–f | without shoot | 580.000 ± 151.00 a |
| Salt stress | 100.00 ± 0.00 A | 2.50 ± 0.00 A–D | 3.33 ± 0.86 A–J | without shoot | 366.67 ± 65.06 A–F | |
| Co_32 | Control | 100.00 ± 0.00 b | 3.83 ± 1.26 a–f | 6.70 ± 1.87 a–g | 0.67 ± 0.29 a,b | 725.56 ± 179.33 a,b |
| Salt stress | 100.00 ± 0.00 A | 2.67 ± 0.29 A–D | 3.43 ± 0.68 B–J | without shoot | 343.33 ± 11.55 A–F | |
| Co_33 | Control | 100.00 ± 0.000 b | 4.67 ± 0.29 d–f | 8.17 ± 3.63 b–h | 0.97 ± 0.30 a–e | 913.33 ± 408.21 a,b |
| Salt stress | 93.33 ± 11.55 A | 2.56 ± 0.42 A–D | 3.31 ± 1.00 A–J | 0.75 ± 0.30 a,b | 321.89 ± 107.77 A–E | |
| Co_34 | Control | 100.00 ± 0.00 b | 4.67 ± 0.58 d–f | 7.27 ± 2.03 f–k | 1.32 ± 0.33 b–g | 855.83 ± 109.61 a,b |
| Salt stress | 100.00 ± 0.00 A | 3.11 ± 0.67 A–D | 3.63 ± 1.25 F–K | 1.00 ± 0.00 A,B | 430.00 ± 43.59 B–F | |
| Co_35 | Control | 100.00 ± 0.00 b | 2.56 ± 0.26 a–c | 5.97 ± 2.39 a–f | 0.64 ± 0.24 a,b | 668.89 ± 267.71 a,b |
| Salt stress | 100.00 ± 0.00 A | 1.78 ± 0.19 A–C | 3.73 ± 0.90 G–K | without shoot | 373.33 ± 20.82 A–F | |
| Co_36 | Control | 100.00 ± 0.00 b | 4.44 ± 0.51 d–f | 6.70 ± 3.18 a–e | 1.10 ± 0.39 a–f | 698.33 ± 53.41 a,b |
| Salt stress | 100.00 ± 0.00 A | 3.17 ± 0.17 B–D | 3.77 ± 1.37 H–K | 0.90 ± 0.21 A,B | 465.56 ± 27.96 C–F | |
| Co_37 | Control | 100.00 ± 0.00 b | 2.28 ± 0.10 a | 8.97 ± 2.39 e–h | 1.33 ± 0.41 b–h | 1013.33 ± 217.33 a,b |
| Salt stress | 100.00 ± 0.00 A | 2.06 ± 0.10 A–C | 3.60 ± 1.17 E–K | 0.75 ± 0.35 A,B | 385.00 ± 109.66 A–F | |
| Co_38 | Control | 100.00 ± 0.00 b | 2.22 ± 0.19 a | 7.57 ± 1.52 a–h | 1.00 ± 0.71 a–e | 782.50 ± 126.47 a,b |
| Salt stress | 93.33 ± 11.55 A | 1.44 ± 0.19 A | 3.23 ± 0.93 A–J | without shoot | 323.17 ± 96.94 A–E | |
| Co_39 | Control | 93.33 ± 11.55 a,b | 3.17 ± 0.29 a–e | 7.47 ± 1.51 a–h | 1.25 ± 0.42 g–h | 810.11 ± 131.30 a,b |
| Salt stress | 93.33 ± 11.55 A | 1.56 ± 0.19 A,B | 3.86 ± 1.05 I–K | without shoot | 364.00 ± 75.02 A–F | |
| Co_40 | Control | 100.00 ± 0.00 b | 4.67 ± 0.29 d–f | 8.50 ± 1.89 c–h | 1.50 ± 0.62 b–h | 1002.78 ± 119.89 a,b |
| Salt stress | 86.67 ± 11.55 A | 2.53 ± 0.17 A–D | 3.04 ± 0.77 A–J | 0.83 ± 0.26 A,B | 335.67 ± 38.55 A–E | |
| p-value (accession) | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | |
| p-value (treatment) | 0.011 | <0.001 | <0.001 | <0.001 | <0.001 | |
| p-value (accession × treatment) | 0.858 | <0.001 | <0.001 | 0.020 | 0.074 | |
| Gene Type | Gene | Gene Function | Primer Sequence (5′3′) | Fs (bp) | Ta (°C) | Reference |
|---|---|---|---|---|---|---|
| Reference | VuEF1-α | Elongation factor 1-alpha | F: GCCTGGTATGGTGGTGACTT R: GCGAACTTCACTGCAATGTG | 280 | 60 | [29] |
| VuPp2A | Regulatory subunit of phosphatase 2A protein | F: CATTGTTGAGCTTGCTGAGG R: GAGCACCAAGCTTGTCATCA | 150 | 60 | [30] | |
| VuSkip16 | ASK-interacting protein 16 | F: ACAGCCGTGAACAAAAAGG R: GTGGCTTCTTCGTCCACACT | 300 | 60 | [29] | |
| Salt stress related | Cyp | Plant protein | F: TGCCCGGAAATCAGTTTTGG R: TCAATAAAGGCCGCATGGTG | 100 | 60 | [21] |
| VuKT6 | Gene encoding potassium transporter 6 | F: GGTAATGCCTCAGGTTTGGC R: CGAGTGCAAGGAGGACATTC | 106 | 60 | [21] | |
| VuEXO | Exocyst complex protein EXO70 | F: GTCAAAGACGTGGAAGGCTG R: GTTGTCGGCTGTTATGGTGG | 175 | 60 | [21] | |
| VuCHiB | Hydrolytic enzyme chitinase | F: GGTAATGCCTCAGGTTTGGC R: CGAGTGCAAGGAGGACATTC | 130 | 58 | [31] | |
| DREB2A | Transcription factor gene | F: TTTGTGGACATGGGTGCTTA R: TCCCTTTCATGCATCCTTTC | 150 | 60 | This study |
| Accession Code | Origin Country | Material Type * |
| Co_1 | Greece | Landrace |
| Co_2 | Greece | Landrace |
| Co_3 | Colombia | Landrace |
| Co_4 | Bulgaria | Landrace |
| Co_5 | Brazil | Landrace |
| Co_6 | Portugal | Landrace |
| Co_7 | Spain | Landrace |
| Co_8 | Iran | Landrace |
| Co_9 | China | Landrace |
| Co_10 | India | Landrace |
| Co_11 | Italy | Landrace |
| Co_12 | Brazil | Landrace |
| Co_13 | Portugal | Variety a |
| Co_14 | Portugal | Landrace |
| Co_15 | Portugal | Landrace |
| Co_16 | Portugal | Landrace |
| Co_17 | Portugal | Landrace |
| Co_18 | Portugal | Landrace |
| Co_19 | Portugal | Landrace |
| Co_20 | Italy | Landrace |
| Co_21 | Spain | Landrace |
| Co_22 | Italy | Landrace |
| Co_23 | Spain | Landrace |
| Co_24 | Spain | Landrace |
| Co_25 | Spain | Landrace |
| Co_26 | Spain | Landrace |
| Co_27 | Congo | Landrace |
| Co_28 | Cuba | Landrace |
| Co_29 | Irak | Landrace |
| Co_30 | China | Landrace |
| Co_31 | Benin | Landrace |
| Co_32 | Angola | Landrace |
| Co_33 | Spain | Landrace |
| Co_34 | Uzbekistan | Landrace |
| Co_35 | Spain | Landrace |
| Co_36 | Spain | Landrace |
| Co_37 | China | Landrace |
| Co_38 | Spain | Landrace |
| Co_39 | Iran | Landrace |
| Co_40 | Nigeria | Advanced breeding line b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Afonso, P.; Castro, I.; Carvalho, M. Salt-Resilient Cowpeas: Early Identification Through Growth Parameters and Gene Expression at Germination Stage. Int. J. Mol. Sci. 2025, 26, 1892. https://doi.org/10.3390/ijms26051892
Afonso P, Castro I, Carvalho M. Salt-Resilient Cowpeas: Early Identification Through Growth Parameters and Gene Expression at Germination Stage. International Journal of Molecular Sciences. 2025; 26(5):1892. https://doi.org/10.3390/ijms26051892
Chicago/Turabian StyleAfonso, Patrícia, Isaura Castro, and Márcia Carvalho. 2025. "Salt-Resilient Cowpeas: Early Identification Through Growth Parameters and Gene Expression at Germination Stage" International Journal of Molecular Sciences 26, no. 5: 1892. https://doi.org/10.3390/ijms26051892
APA StyleAfonso, P., Castro, I., & Carvalho, M. (2025). Salt-Resilient Cowpeas: Early Identification Through Growth Parameters and Gene Expression at Germination Stage. International Journal of Molecular Sciences, 26(5), 1892. https://doi.org/10.3390/ijms26051892

